Menu
Sign In Pricing Add Podcast

Bailey Sarian

👤 Person
1024 appearances

Podcast Appearances

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

the other day i was in the mood to watch an old movie so i turned on casablanca and if you watch old movies there's something that you notice that maybe you forgot about there's always so much smoking, right? And the movies in like, well, Casablanca was in all black and white. So it just, it looks so, everyone just looks so cool and so sophisticated. And they're just like, what did you say?

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

So he's smoking a lot. At the time, smoking was, again, totally normal. And then one day, this all changed. Han's father, also heavy smoker. He got diagnosed with lung cancer and sadly passed away from it. For Han, this was like a really big wake up call. And he finally decided that he wanted to stop. So he turned to nicotine patches, you know, for help.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

And they were definitely helping, but you know, there's that oral fixation. that you lose, you don't get that with a patch, okay? He still had that desire to smoke. It was better than nothing, but it's hard. One night, Han forgot to take off his nicotine patch before bed, and I guess he had some insane nightmares all night. He said that he woke up a different man.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

He realized why the patches just weren't cutting it anymore. With patches, you get a small continuous dose of nicotine. With smoke, you get a sharp and quick high of nicotine, which for him, relaxed him. So Han decided to create a solution. He thought he could use his knowledge of Chinese medicine to help. He wanted to create a device that would mimic smoking without, again, the deadly smoke.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

In 2003, he invented his own version of an e-cigarette. He called it the Rouillon, which translates to like smoke. In his device, liquid was being turned into vapor through something called an ultrasonic atomizer. Sounds so fancy, I know. But I guess it's similar technology to ultrasonic cleaners people use to clean their jewelry in TikTok videos. I got one of those. Oh, they work so well.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

I don't know how they work, but they work. Okay, it's weird.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

but essentially vibrations are used to like shake the liquid so hard and fast that it turns into like super tiny droplets aka vapor and this created a much smoother and better drag when it was inhaled maybe you've seen these devices they look like cigarettes and when you inhale them there's a little light on the end and it looks kind of like a lit cigarette initially the products were only sold in china as a way to help people quit smoking cigarettes

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

but by the mid-2000s, they made their way to the US. In the patent Han and his company filed, they said the device functioned as, quote, substitutes for quitting smoking and cigarette substitutes, end quote. Han's device sold really well in the US, so well that in 2013, Imperial Tobacco Group bought the product for $75 million. Good for him, huh? As for Han,

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

He went back to smoking cigarettes, so, you know. He still vapes, I guess, so now he's just addicted to two things, but hey, you go, Han. You tried, and that's all that matters. Since Han's invention arrived in the US, a ton of other companies decided to get in on the e-cig business. Since 2007, e-cig sales in the US have been rising more and more.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

Before we get into it, don't forget to like and subscribe, because I'm always here for you, posting new content. And let me know what you think in the comment section, because I read them at the end. Did you know that? Okay, well now let's get into it. Before we get started, let's all get on the same page about what I mean when I say the word vape.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

According to a report from GAO, to this day, 90% of the e-cigs that we have in the U.S. are imported from China. There's one vape pen that was started right here in the U.S. of A. And many people believe this vape pen redefined the vape business forever. You know her. You heard of her. You love her. She's kind of gone now. Jewel.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

Paul, just because you look like you work at a bank doesn't mean you know how to manage money. Managing your money can be difficult. Thanks to Rocket Money, my financial wellness goals are now within reach. Rocket Money is a personal finance app that helps find and cancel your unwanted subscriptions, monitors your spending, and helps lower your bills so you can grow your savings.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

You can see all of your subscriptions in one place so you know exactly what you're paying for and know exactly where your money is going. And if you want to cancel like a subscription or something, well, guess what? Rocket Money can help you do that. It's so easy. If you're looking to kickstart the new year with like a new budget, maybe just cleanse all of the all of the stuff you're paying for.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

I'm I'm at the I am this close. If you can see me, I'm very, very close here. I'm about to cancel all of the subscriptions, every single one of them. That's where I'm at right now. I'm ready to start over. Well, if you're like me, you can easily create a personalized budget to help keep your spending on track, which is nice.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

They have this new feature called Goals, which automatically saves money for you, so you don't even have to think about it. It's like, hey, what's your goal? And you're like this, and it'll be like, okay. With the Rocket Money app, you can input your bills so you can get an alert if there's an increase in price, if there is unusual spending, or if you're close to going over budget.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

Rocket Money has over 5 million users and has saved a total of 500 million in canceled subscriptions, saving members up to $740 a year when using all of the app's premium features. Cancel your unwanted subscriptions and reach your financial goals faster with go to rocketmoney.com slash darkhistory today. That's rocketmoney.com slash darkhistory, rocketmoney.com slash darkhistory.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

There are a ton of different names, brands, and products that are associated with vaping. E-cigarettes, vaporizers, e-pipes, hookah pens, jewels. Are jewels still around? Vape, whatever. But essentially, they all do the same thing. They're all battery-powered devices that heat up a liquid, then turn it into vapor. And then you inhale, and it tastes good, because they have a lot of good flavors.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

In 2004, James Monsees and Adam Bowen were students at Stanford University. I guess, you know, smokers, they were smokers. And while they were on a smoke break together, they were talking about how they were so sick of being addicted to cigarettes. You have to buy the packs, the lighter. You got to find a place to smoke. Find time to smoke. Plus then you stink all day. You smell like a smoker.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

Your fingers start to turn kind of like this yellowish color. It sucks. So they decided to create something that would help them quit smoking. So they put their heads together to design their very own take on a vape pen. By this point, dozens of vape pens had crashed and burned in the industry. So they're like, okay, we have to stand out, you know?

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

First of all, they were setting themselves apart from Han's device. They didn't want this to look like a cigarette. They wanted it to be in a category all on its own. It was going to look futuristic and chic, and it wasn't going to be disposable, okay? This was something they wanted people to take pride in owning. A vape pen to leave to your grandchildren.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

a vape pen to pass on for generations to come. Now, in order to create a good product, you had to obviously look at the research. What did people like about e-cigarettes? What did they not like? What did they keep buying? Why did they keep buying them? Instead of digging into the typical research, the guys decided to get creative.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

They discovered that a nearby college had access to public records of internal documents within the tobacco industry. Hello, score. When all these scientific studies came out about how cigarettes and cancer were connected, it also came out that tobacco companies had been lying to the public about how deadly it was.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

Big tobacco companies were sued and they were forced to turn over the data that they had been hiding from the public. including data on who bought cigarettes and why. This information was gold to James and Adam. Suddenly they had decades worth of research. Now they didn't have to do all of their own research because Big Tobacco had like done a lot of it for them.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

They got to sit back, relax, and almost in a way cheat their way through research. I don't like saying cheat their way because really it was all available to them. They just use their resources. You know, they're like, thank you. This helps us tremendously. And from there, they figured out how to market to each and every demographic. Smart, I'll give them that.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

They were so stoked about this product that they decided to make it their senior thesis. They invented a portable vape pen called the Plume. It sounds like something for like douching, right? Kind of sounds like something like douche, you would douche with, like plume, keeps you fresh. but that's what they went with, okay. But with this device, it was portable and it didn't look like a cigarette.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

It was almost like a shiny black car key, you know, just a little bit bigger. The plume heated up pods of flavored nicotine, which created a nicotine vapor that could be inhaled. James and Adam's professors warned them that they were moving way too quickly with their idea and not doing enough research. But you know how it is. They're like, nah, we're going to do it anyway.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

After they graduated, they moved to Silicon Valley and began a startup based around Plume. But right away, it wasn't going so well. The plume needed butane fuel in order to work, so users had to carry a little can of fuel with them in order to refill. Talk about an inconvenience. Also, apparently the plume would sometimes electrically shock users when they used it. So it was a good idea.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

They just needed to work out the kinks. So they ended up getting a $10 million investment and redesigned the plume into... The Pax pen. Okay, this I remember. I remember Pax pens. Now, these were, this was the beginning, right? So things are like ridiculously priced. The Pax pen was $250. So who's gonna buy that, okay? And yeah, Bob down the street can like not buy cigarettes for a week.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

Over the last 10 years, it seems like these vape pens have just really come out of nowhere. It's like, suddenly your Aunt Barbara is sucking on a banana ice-flavored puff bar. And you're like, let me hit that. Is it good? But the truth is, vape pens have been around in some form for almost 100 years. I know. I was like, I know nothing, you know? And it all started with a man named Joseph Robinson.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

And I'm sure he would have the $250 to do that. But Bob's not gonna do that because he needs his fix now, you know? So it wasn't really exactly for everyone. James and Adam, they knew the only way that they would attract the younger everyday person was to design something with a reasonable price tag and also give them that good hit of nicotine. So they got the design down.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

They came up with a four inch long device that honestly looked like a USB drive. It had these flashing lights that would activate as soon as you sucked on it and inhaled. They called this creation The Jewel. They called it jewel because of a jewel, like jewelry. Yeah, nothing deeper than that really. I thought it was like a cute name. No, just like jewelry.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

With the Juul, it's supposed to be, quote, discreet and aesthetically pleasing, making the user feel like they have a little piece of modern luxury. And they spelled it out that way just to stand out. The Juul was invented in 2015. They kicked off marketing for Juul right away to try and make vaping appealing and easier and an option.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

They went right after companies like Vice Magazine, which mostly targeted young people. They took out a Times Square billboard. They sent free samples of Juul to people like Leonardo DiCaprio and Bella Hadid. And they did whatever they thought they should do to make the product cool and in the public eye, you know? And it worked. By the end of 2017, Juul was the number one vape pen in America.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

And by 2018, the company was valued at $15 billion. Insanity. Literally three years after it hit the market. That is insane. I loved my Juul though. I had a Juul. I loved it. There was like a mango. I would just like suck on it all day. It was so easy to use. It was like small. I don't know. I liked them. I liked it a lot.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

Even though Juul was a preferred vape pen in America, they were starting to get called out for their questionable marketing. Life in general can be chaotic, but if you're in charge of order fulfillment for an e-commerce business, good luck, because that's a different kind of chaos. But with ShipStation, you can count on your day-to-day remaining calm. Don't freak out.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

Setting up my ShipStation account has saved me hours of time. Plus, ShipStation users are able to save money every month by shipping from all your stores with one login, automating repetitive tasks, and finding the best rates among all the global carriers.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

You can print shipping labels at the click of a button, and you can manage all of the orders on one dashboard, so you're not losing track of anything. I love using ShipStation because it's the fastest, most affordable way to ship products to your customers with discounts up to 88% off UPS, DHL Express, and USPS rates, and up to 90% off FedEx rates.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

That must be why over 130,000 companies have grown their e-commerce businesses with ShipStation. And 98% of companies that stick with ShipStation for a year become customers for life. Calm the chaos of order fulfillment with the shipping software that delivers. Switch to ShipStation today. Go to ShipStation.com and use code DarkHistory to sign up for your free trial.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

That's ShipStation.com, code DarkHistory. Some experts believe that the company was actually trying to target children. I mean, they were sending free jewels to celebrities, so they'd be caught vaping in paparazzi photos. And we all know how young people are influenced by celebrities. I mean, look at me. I started smoking because of Mary Kay Olsen.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

And I'm sorry, I don't want to put that pressure on her because at the end of the day, we all make our own choices. But I wanted to be like Mary Kay so bad. So I was like, parliament lights, me too, girl. American spirits. So if you're seeing celebrities vaping these Juul pens, same thing. But Juul would remind website visitors that you had to be a legal adult in order to purchase their products.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

You see, in 1927, Joseph invented something called the Mechanical Butane Ignition Vaporizer. Rolls right off the tongue. But he didn't invent this device for smoking. Instead, he wanted to make something that could help people inhale their medicine. Almost like an inhaler for asthma, but... You know, not for asthma. He designed the device and even got a patent for it in 1930.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

Even if you were underage and couldn't legally buy a vape, you'd still be able to get Juul marketing emails. And even if you failed the age verification page on their website, you'd still get spammed with advertising. They'd be following you.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

Juul was even accused of advertising near schools, selling their products out in the open in stores, not behind the counter, and funneling free vapes to the new wave of celebrities, influencers. Where was mine? I didn't get one. Hello? So rude. I'm very upset about this. You know, but at the end of the day, this quote unquote bad press wasn't bad for Juul.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

We all know that if you tell people and teenagers that they can't have something, they're gonna wanna do it even more, especially if you try to ban it. I mean, there was this whole controversy over vape flavors being created just for kids. So there's flavors like cotton candy, bubble gum, mango, you name it, okay? I loved mango.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

People who were anti-vapors believed that these flavors were created specifically for children. Do you guys remember when they banned those mint Juul pods? Now, the reason was that they believed, they being whoever's in charge around here, that certain Juul flavors would stop young people from smoking. In my personal opinion, banning mint isn't gonna stop young people.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

Cause like we're going, young people want like bubble gum. They want fucking mango. They want fucking like cake. You know, mint. Mint gave me a stomach ache. I didn't really care. I was like, go ahead, ban mint. But it doesn't take a genius to know that there's more than one company making a flavor that you like. It just seems like this was all...

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

There was a study done in 2021 by Dr. Abigail S. Friedman, which showed that teenagers in San Francisco specifically, they actually started smoking cigarettes more after they started banning vape flavors. So people are addicted and they're gonna get their fix where they're gonna get their fix. You know what I'm saying?

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

But then in 2019, the North Carolina Attorney General sued Juul for designing, marketing, and selling its e-cigarettes to young people. And surprisingly, they won. Juul was forced to pay $40 million into programs that would help prevent addiction to e-cigarettes. They also had to agree to stop advertising near schools.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

Plus Juul was given the strict order to stop quote unquote, misrepresenting the danger of nicotine and its products. In 2022, the FDA banned the sale of Juuls in the United States. Then in 2024, they partially reversed the decision, letting them sell Juuls while they were under review by the FDA. So it was like, make up your freaking mind.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

And look, to be clear, it's not just Juul that they were doing all of this to, they were just the ones who were being made an example of. Dozens of vape companies took advantage of young people wanting to try vaping by advertising on social media. There were ads on Facebook, Instagram, YouTube, Twitter. X, whatever, Pinterest, I don't know, vape everywhere. Everywhere you go, vape.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

And the kids and teens who didn't have social media, Jewel bought ads on Nickelodeon, Cartoon Network, and teen magazines, which is so weird, right? And it worked because it's still smoking. I don't know. From 2014 to 2016, a poll was done that showed 78% of American middle school and high school students confirmed that they had seen at least one ad for vaping. And surprisingly,

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

But Joseph like never actually followed through and made the product. No one knows why. But his invention was not a waste because for years, people wanted to make an inhaling device similar to his. And that's where a man named Herbert A. Gilbert comes in. Herbert Gilbert. That's a cute, cute name. He sounds like a hippo. Herbert Gilbert.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

63% of adolescents don't know that Juul specifically contained nicotine. And to be honest, we don't really think of nicotine as being that serious. It's kind of like caffeine, you know? Because of how new it is, this is my assumption, That's the reason why we you never really hear about like long term health risks for adults when it comes to vaping. Yeah.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

I mean, it's always about the kids, which I get. But I'm wondering if you're an adult, you know, is vaping really that bad for you? You know, I don't know. Well, the answer always goes back to two things, nicotine and additives. And vape pens are always compared to cigarettes. So I wanted to do a quick comparison.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

According to the American Lung Association, there are around 600 ingredients in one cigarette. And when burned, the cigarettes create more than 7,000 chemicals. At least 69 of those chemicals are known to cause cancer. Okay, so we can all agree, not great. Now, it's a little more complicated to study vape pens since one, there are so many companies,

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

And the FDA rules for vape pen manufacturers are hazy, confusing, and a little blurred. There was a study done in 2021 by a team of researchers at Johns Hopkins that found over 2000 chemicals in popular vape brands. Most of those chemicals hadn't been reported by the manufacturer. Some people would have no idea that they were I thought it was just water and vapor. I don't even know.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

I just thought nicotine and smoke. I don't know. No one knows. In 2014, there was a study published in a scientific journal called European Addiction Research, which showed that using e-cigarettes is around 95% less harmful than regular cigarettes. I'll make sure to link these studies down below if you're more curious.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

But to be fair, I'm just saying this in my own opinion, that study was done in 2014. Vapes have progressed a lot and there are so many out there. I mean, who knows? What are in these vapes? The only thing that we really have solid evidence on is the nicotine. I learned that nicotine is not great. I know you're probably thinking I'm dumb, but I didn't realize that nicotine actually can lead to

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

cognitive deficits meaning uh this is good like it affects your ability to learn and it affects your memory oh yeah now this is especially true if you're a young person whose brain is still developing which probably makes sense because my memory is so bad and i've been vaping on and off for so long i've been vaping for so long is that why my memory sucks I don't know.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

You know what they say, everything in moderation. Right? Most vape pens contain the same amount of nicotine as 20 cigarettes or one standard pack of cigarettes. Oh shit. So we're just getting hit with that. Our brain is probably like, what the fuck is going on, bro? So if you limit yourself to just a few puffs, it's still better than blowing through a bunch of cigarettes, I guess.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

Well, in the 1960s, Herbert was living like, you know, beautiful, peaceful life in Beaver Falls, Pennsylvania. Beaver Falls. It already sounds like there's white picket fence houses, green grass. It just sounds nice. Beaver Falls. Okay. Well, he was raising a family while working at his small business, a place called Gilbert Iron and Steel. And they were essentially scrap metal dealers.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

The problem is it's so easy to quickly grab a hit of a vape. Many people are inhaling as much as 200 times a day. And that's when things can, you know, take a deadly turn. This episode is crazy, right? I mean, who knew vaping had such an intense history? I mean, Paul over here got a little too inspired by the episode and he ended up injuring himself. Do you want to tell them how, Paul?

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

Oh, no, Paul? No? No? Okay, well, long story short, Paul was ripping so many fat clouds that he sprained his wrist. Now, Paul, I highly suggest you see a doctor. I mean, you might not even be able to vape again. Is that what you want? Well, don't worry, Paul, because finding a doctor is easy. Thanks to ZocDoc. Hey, it's an ad.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

ZocDoc is a free app and website where you can search and compare high quality in-network doctors and click to instantly book an appointment. Oh yeah, we're talking about booking in-network appointments with more than like over 100,000 doctors across every specialty, from mental health to dental health to primary care to urgent care and like so much more.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

You can filter for doctors or specialists who take your insurance, who are located nearby, who are a good fit for whatever need you may have, plus are highly rated by verified patients. Once you find the right doctor, you can see their actual appointment openings Choose a time slot that works for you and click to instantly book a visit.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

Appointments made through ZocDoc also happen fast, typically within just 24 to 72 hours of booking. Plus you can even score same day appointments. Now I love ZocDoc because one, it's easy. Two, it takes all the intimidation out of booking a freaking appointment and you don't waste time. Just show me the doctors that take my insurance. Is it that hard? Well, ZocDoc makes it easy. I love that.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

Stop putting off those doctor appointments and go to ZocDoc.com slash Dark History to find and instantly book a top-rated doctor today. That's ZocDoc, Z-O-C-D-O-C dot com slash Dark History. ZocDoc.com slash Dark History. In 2021, a 29-year-old woman from Ohio named Jordan Brielle decided she wanted to quit smoking cigarettes.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

She'd been smoking pretty heavily since she was a teenager and she was ready to quit. So she decided to give vaping a try. I mean, it seemed to be working for so many other people, right? You know, great. So she picks one up, loves it. The flavors, the convenience, and not long after she started vaping, Jordan said that she became totally addicted. It was crazy.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

one addiction to another, you know? She said that she was spending around $500 a week to keep up with her vape habit. She was constantly hitting the vape pen. She said she would sleep with her pen, wake up, hit that shit, go back to bed, and she would take a shower, hit it in the shower. She wasn't taking breaks, okay?

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

In 2023, about two years after she started vaping, Jordan said that she started to feel a little off. She felt like she had this heaviness in her chest. She went to the hospital several times thinking maybe she had like an infection or bronchitis. She also started to develop a horrible cough and she had little to no voice.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

Her body was swelling up from her ankles to her kneecaps and she could barely walk. Her skin was turning gray. She was feeling confused. The doctors couldn't figure out like what was wrong with her and just would send her home. Everything came to a head in May of 2023 when Jordan's partner found her unresponsive in bed. She had black liquid, black liquid goo pouring out of her nose and mouth.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

Now, just like every other man in the area, Herbert was a big time smoker. you know at one point he was uh said to be smoking like two packs a day now Herbert he knew he had to quit right but quitting cold turkey hell so he got to thinking what makes smoking so bad for your health I'm sure were like everything, right? Yeah, but he was thinking it.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

I guess at this time she was gasping and she like couldn't like catch her breath. She was still alive. Her partner called 911 and she was rushed to the hospital. Once she got there, the staff scanned Jordan's lungs and found that they were badly damaged. Doctors had to pump two liters of fluid out of Jordan's lungs.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

two liters that's like a big bottle of coke you know i guess the liquid that they had got out of her was like the vape juice because when you think about it if you vape because i know you do i know a lot of people vape like it's the juice was in her i know i know i'm gonna quit Jordan said, quote, Ugh. Okay.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

Jordan had to be placed in an 11 day long medically induced coma, but thankfully she survived. Jordan has permanent lung damage as a result of all of this. And she also suffered a minor brain injury due to lack of oxygen. Oh my God. She said, quote, they told me if I had waited any longer, I wouldn't have been here. I haven't touched a vape since, end quote. Good for you.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

That must have been real scary. Even though cases like Jordan's are rare, she isn't the only person we know of to be hospitalized because of her vaping habit. And a lot of people weren't as lucky as her. Around the time Jordan got sick, other strange illnesses started to take over the media. And maybe you saw this.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

A condition called E-valley, which is a lung injury that's associated with e-cigarettes or vaping, this name E-valley was created because there was a surprising rise in vape related hospitalizations. E-Valley, what a name. It kind of reminds me of, do you guys play Animal Crossing? It sounds like an Animal Crossing island. I'm going to E-Valley. Send me your island codes. I'll come visit.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

And it made me wonder like 50 years from now when they make movies about us, will we all have vapes in our hands? I mean, if they want like the movie to be accurate, vapes might be included. It seems to be a controversial topic, but to be fair, everyone is vaping these days.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

Okay, I love Animal Crossing. Okay, so E-Valley, bad, bad. There's not a whole lot known about E-Valley. We do know patients went in with serious breathing issues and most cases turned out to be related to something found in illegal weed vape pens.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

called vitamin e acetate now weed vape pens are different i mean there's the same concept right but you don't know what chemical you're getting in these vapes when you hit and inhale the vitamin e in a vape pen form it could create a highly toxic gas they were around 2800 and 68 deaths. Most of the cases were connected to illegal street bought vape pens.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

And it does seem like they're trying to scare us a lot with vaping, but the reality is there's still a lot of background information missing when it, when it comes or it came to like these cases. So people could have had health conditions that they didn't know they had before vaping. Some people could have lung damage from smoking cigarettes and some people buy their vapes in shady places.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

I keep saying this, when it comes to vaping, I feel like we are the test subjects. We really don't know long-term what this is gonna do to us, but we're gonna find out, bitch, because a lot of people out there are vaping. If you look around, I don't know where you live, but where I live, everyone has a fucking vape in their hand, and we're vaping all the time. I vape all the time.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

Now Herbert wasn't in a lab, so he couldn't do like fancy experiments. He basically lived in the woods in Pennsylvania. So one day he looked in his backyard and thought, quote, the problem, as I concluded, was that when you burned leaves and wood, even if you did it in your backyard, it yielded a result that no one wanted to take into their lungs, end quote.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

It's disgusting, and I hate it, and I wanna quit. I don't know how. And it's like, I'm so good in my life, personally. Like, I don't drink, I don't do drugs, I'm not promiscuous. Not that there's anything, I would love to be. But like, I don't, like, I don't do anything wild. Like, vaping, I feel like, is my one vice. And that's what, I'm like, well, we all have that one thing.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

Like, that's always my excuse. But shit, I would love to quit, you know? Because we really don't know where this is going to go. So... Good luck to us is what I'm getting at. What's crazy to me is that all the vapes we talked about today have something in common. They followed the same design Herbert patented in 1963.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

We could say poor Herbert, because he never saw like any money or any profit from that. But if it wasn't for Herbert, I mean, we probably wouldn't be here. So pros and cons, I don't know. Herbert wasn't bitter about it or anything though. In an interview, he said he was proud that he is at all associated with an invention that he believes helps people quit smoking.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

He said, quote, the only substantial thing I received was the satisfaction of saving millions of lives, end quote. Aw, see, that's so nice. And again, if you think about it, vaping really only took off in the last decade, so stay tuned. I don't know, we might just be dropping like flies. Everyone always wants to fight with me in like the comment section.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

There was another dark history we did where we mentioned popcorn lung and the vape community came after me so hard and I'm like, shut up. I vape too. For now, what we do know, vaping shouldn't be marketed towards kids, especially because nicotine does some shit to your brain. You should definitely look into this a little bit more about the effects that nicotine has on your brain.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

And it might make sense as to why you're feeling the way you are. Anxiety, impulsiveness, anger, can't sleep, shakiness, like it all comes from nicotine. And if you're vaping a lot, it's probably

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

probably that just letting you know and you don't want this to be on your kids because you want your kids to develop a full brain and then let your brain go to okay you know so and kids they love this stuff well according to most of the studies we have available to us today vaping can be incredibly helpful if you want to stop smoking cigarettes just know as someone who has been doing this

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

You're just replacing one addiction to another. And I'm not trying to discourage you. Just know it's one addiction to another. Yeah, I know. Now, if you're like me and you're over it and you're ready to quit vaping, listen. Good for you. I'm right there with you. It's hard. So then I do nicotine gum and to help me like wean off of it.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

That seems to be working for me as long as I'm keeping my mouth busy. There are also medications you can ask your doctor about to help you quit. There's also a phone number you can call 1-800-QUIT-NOW or 1-877-44U-QUIT. And you can call this number, talk with a counselor who can help you get this quitting process started, which is nice. Or maybe you're like, I hate calling people on the phone.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

So Herbert got to figuring out how can you heat something up without making it toxic? So he goes to the kitchen and he opens up the fridge when he has another thought, saying, quote, I happen to remember how tea is brewed. That solved the problem. Using logic, I had to find a way to replace burning tobacco and paper with heated, moist, flavored air. End quote. So this just gets his mind going.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

Well, you can actually chat with the National Cancer Institute at Live Help, or you can text QUIT to 47848. If you need to get help, it's better than suffering in silence, you know? I'm going to call this number. I'm very curious to see what they have to say. Like, I love vaping.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

You know, when I tried to quit smoking originally back in the day, you can tell me like, there was nothing you can say to me to make me feel better at that time there, you know? But I remember I came across this picture and it was of a human body. And it was like, here's what your lungs look like every day that you quit smoking. And it was like, after...

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

two weeks this starts to grow after four weeks this starts to grow like your lungs know how to repair themselves so if you quit like they your lungs can fix itself and i would read this chart and it always gave me motivation knowing like okay my lungs are now like doing this today

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

It kind of sounds stupid as I say it out loud, but it's also kind of reminds me of women when they're pregnant and then they do those apps and it's like, your baby's a pea. And then like the next day, your baby's a mango. It was like that, but like your lungs are now this today. Your lungs are now that.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

And that was what really kept me going was having this visual element of what my lungs looked like. They could be lying, but like, I don't know. That's what kept me going. And maybe I should do that again. for vaping, I don't know. Stay tuned. I mean, maybe in a few years we'll be doing another dark history of like, hey, vaping. That went wrong. And look, if you vape, I'm not here to judge.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

Okay, we're all just trying to make it through this life. I fucking get it. I'd love to hear your thoughts though down below. So let me know in the comment section. I've also heard about this new thing. It's not new. God, what is it called? It's like a chewing tobacco, but it comes in little pouches and you put it in your lip.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

and you don't have to spit and kids are now really liking this so i think vaping might be phasing out and people are going to be going to this new lip thing it's called zen it's called zen parents just letting you know because kids are doing this it kind of looks they come in like a little Like it could be mints, who knows? You open it up, you put one of those in, you don't even know it's there.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

They don't have to spit. There's none of that nasty tobacco to it. It comes in a clear pouch, not sponsored. No, I haven't tried one because I feel like it's just going to be another addiction for me. And I don't want to have to like lose my lips. But just letting you know, parents, Zyn, that's out there too. Vaping, there's a lot. I don't know how you guys are raising kids out there.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

You gotta be aware on the social medias, on the drugs that are out there are so different, the nicotines, the energy drinks. God be with you, okay? Now, after this episode, I personally am ready for a little escapism. And my personal favorite place to escape to, Disneyland. specifically the Pirates of the Caribbean ride.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

Now, it's crazy that it started as a ride and then they based a whole movie franchise off of it, right? And it was like super popular because people just, I guess, are obsessed with pirates. People love pirates. And I discovered that pirates in real life are way more violent and sexual than even Captain Jack. And my favorite part, some of the most well-known pirates in history were women.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

So join me for the dark history of pirates. Arr! By the way, we're dark next week, so there won't be a new upload, but we'll be back on March 12th. Hope to see you there. Well, friends, thanks for hanging out with me today. You can actually watch these episodes after the podcast airs on Thursday over on my YouTube. Also, you can catch up on my murder mystery and makeup. I do that too.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

He's like, I have to figure out a way to trap hot, moist air into some kind of device I can suck on. So he looks around his scrap yard and he grabs some extra metal and he gets to work. And what he ends up inventing is a black metal tube with a silver tip. It was battery powered and able to make vapor out of heating a liquid.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

And while you're there, hit that subscribe button, because again, I... I have something for you all the time. Now let's get to my favorite part. Let's read a couple of comments you guys have left me. Dylanfell6975 said, Bailey, will you marry me? Dylan. Okay, I got a couple questions for you. One, what's your credit score? Do you have a 401k? Do you have a savings? Do you have a career?

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

Where do you live? Are you, I'm not trying to be shallow, but like, if we went to a concert together, would you be able to put me on your shoulders? If there was a fire in the house, would you be able to carry me out? How's your dental hygiene? Do you have any serious illnesses I should know about? What are your dreams? What are your goals? Are you good at Scrabble? How do you sleep at night?

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

Do you snore? Are you a bed hog? Do you like animals? Dylan, we can't just jump into this like this, you know? Like, we gotta get to know each other a little bit, you know? Is there a ring? If you come from money, you can skip all those questions, go to the straight of the line, and pick me up at seven, okay? Thank you. Hope to see you there.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

Allie Graham left us a fun fact saying, did you know that Google's original name was Backrub? Okay, all right. Okay, Backrub? Okay, okay. I'm trying to process this. So I'm glad they decided to pivot to Google because I think Google is more, it's catchy, it's good. Backrub sounds like something... It sounds creepy.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

It sounds like your creepy uncle coming up, rubbing your shoulders, and you're sitting there like, okay, yeah. Backrub. It's a little too close to Backpage, but, you know, I want to do an episode on Google. I really do. Yeah. We'll see, though. They might kill me. They own everything. Okay. Well, thank you for that.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

I'm going to look that up because I'm very interested in how they came up with that name. Backrub. Apocalypse Mouse. Love that. 473 left us an episode suggestion. Squirrel cage jails. Squirrel cage jails. Okay, okay, okay. Apocalypse Mouse, you are onto something. Just found out a squirrel cage jail is a jail cell that would rotate in a circle constantly so prisoners couldn't talk to each other.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

Wow, that's really interesting. I am intrigued. Squirrel, cage, jail. I was over here thinking, have you ever heard of a blue squirrel? Well, blue squirrel, A lot of makeup brushes were made from blue squirrel. They don't really do it so much anymore, but like, and that was like one of the best hairs you could get, blue squirrel.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

So I was thinking, oh, this is probably where they get all that hair from, but no, that was a pivot. Okay. Well, thank you guys so much for watching and hanging out with me and always recommending episode suggestions. I love it so much. Make sure to leave a comment and maybe I will read yours. Wouldn't that be fun? Okay. And hey, if you don't know, Dark History is an Audioboom original.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

Herbert's invention is very similar to what we know today as like the vape pen. Now the difference is, Herbert did not want there to be any type of addictive substance in it, like nicotine, but he did go on to invent vape juice that would go inside of this little contraption. And not just any random vape juice. He thought of all of his favorite things he liked to eat and drink.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

I want to give a big special thank you to our expert, Chelsea Boyd, epidemiologist and health policy thought leader. And I'm your host, Bailey Sarian. I hope you have a good day. You make good choices. And I will be talking to you very soon. Goodbye.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

Things like rum, cinnamon, mint. And he managed to create a vapor for each flavor. When he inhaled the pen, It was like drinking a Mai Tai. Not only would this help people quit smoking, he thought, you know, but Herbert was also thinking maybe it could help people diet. I mean, a lot of people were smoking because it was being advertised as like, skip a meal, have a cigarette.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

So kind of like, okay, I can see the connection there. Herbert called this invention the smokeless. And in 1963, he patented it. He packed his briefcase and started networking with people to get this invention off the ground.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

He knew that this had so much potential, so he was pitching this idea to chemical companies, pharmaceutical companies, tobacco companies, but for some reason, no one wanted to touch it. Now, Herbert was devastated. He knew that this device had so much potential. And here's what really sucked.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

Herbert was trying to make his smokeless device pop off during a time when most of America didn't consider smoking a serious issue. No one really knew that they were all gonna be dying. You know, like he was just ahead of his time. It's like, why smoke that when I could just have my lucky strike?

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

If you've ever watched my TikTok like for you page videos on Instagram, you know that I take, I like to take a hit of the devil's lettuce from a vape pen. But every time I post one of those videos without fail, someone is like, you know, vaping so bad for you, blah, blah, blah. And I'm like, yeah, I know, you know, People are always on opposite sides of the fence, really.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

A year after his invention failed, the US Surgeon General publicly released a report showing a direct connection between lung cancer and smoking. The public finally realized that they needed to at least try to quit smoking because, look, You're gonna die. There could be like some deadly consequences, okay?

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

Herbert gave up hope after none of those companies or corporations took interest in the smokeless, even after the report came out. So his patent expired and his invention kind of just... fizzled out. Over a decade would go by before the vape pen returned to society, but this time it had to have something that a smoker would quit their cigarettes for.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

It needed to be something that would take the edge off quitting cold turkey and keep users coming back for more. Well, seasons are changing. I don't know about you, but I'm dry. I'm looking like Leatherface. I'm looking like beef jerky. I'm looking like dehydrated, thirsty, ugh.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

You know, and with the changing seasons, you have to change your skincare, because your skin needs different things, you know? And it can be frustrating. Like, where do you start? But that's why I'm always excited to partner with Apostrophe.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

Whether you're dealing with acne, signs of aging, dark spots, dehydration, oily skin, Apostrophe helps you get access to the right treatment for you and your skin. Now all you have to do is fill out an online consultation, snap a few selfies of your skin, then your dermatology provider will create a customized treatment plan just for you. Through Apostrophe, you can get access to...

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

treatments, medications, skincare, whatever you need to help address your skin concerns. I love Apostrophe. I've been using it for years. Hi, have you been watching? I really, really use Apostrophe. I love it. It's easy. You don't have to leave your house. You update your profile online. A dermatologist will be like, okay, here's what you need to do.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

And then it gets, whatever like you decide to get, it gets shipped to your house. So you don't even have to leave. It's the best. Right now we have a special deal for our audience. You can get your first visit for only $5 at apostrophe.com slash dark history. When you use our code dark history, that's a savings of $15. And listen, this code is only available to our listeners.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

To get started, just go to apostrophe.com slash dark history and then click get started. Then use our code dark history at sign up and then you'll get your first visit for only $5. It's worth it. I'm telling you. A big thank you to Apostrophe for sponsoring today's episode. Now let's get back to today's story. So by this point, it's the 1970s.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

Tons of people are still smoking, but now they at least have some knowledge that it's bad for them and they're looking for alternatives. Then in 1979, a man named Phil Ray was one of those people looking for a solution. Phil, he worked, well, he was like a computer genius who worked for NASA, and he was known for helping men land on the moon. So, smart guy, you know?

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

But everyone has their vice, and for Phil, he was a smoker. He liked smoking, okay? And he got to the point where he really wanted to quit, but there weren't any good options out there. Well, that's not true. There was an option. The only option was nicotine gum, but at this time it wasn't very effective nor satisfying. You didn't get that. It's just, it's not the same, you know?

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

And like, look, real talk here, real talk. People always say like, well, it's better than smoking cigarettes. And you're like, well, okay. She's like, I don't know, you know? So of course, naturally, I was like, look, we gotta like look into this, right? Who the hell invented the vape pen? And are they really that bad for you? Spoiler alert, let me just say the answer might surprise you.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

And he's thinking, why am I waiting around for someone to invent a smoking alternative? I work at fricking NASA. I need to figure this out, you know? So Phil goes to his doctor. His doctor's name is Norman Jacobson. And he asked him to help create an e-cigarette. He wanted to preserve the buzz and the throat hit of smoking a cigarette, but eliminate the smoke.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

So he designed a product that was the size and shape of a cigarette. And it was even painted to look like one too. Oh, I was like, oh, okay. But what was in it? Well, Phil had a light bulb moment.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

what if people smoke pure nicotine vapor that way people could actually stop buying packs of cigarettes and maybe even just stop smoking altogether at this time science was saying that smoking was bad for your lungs and caused cancer which true okay chemicals all that yes but a major reason people were addicted to smoking and still are is because of the nicotine.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

Nicotine is a chemical that is in the tobacco plant. So if you could figure out a way to get your nicotine fix without hurting your lungs, you should be good, right? Now, scientists, of course, did not agree with this because nicotine was still addictive and it's still a chemical, you know?

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

But Phil argued that his nicotine e-cigarette was basically like nicotine gum, just a different delivery system. A piece of paper soaked in liquid nicotine would be placed inside the device and once you inhaled, a beautiful puffy cloud of pure nicotine would come up. Phil called this device the favor. Oh. He filed a patent and actually got the product sold on the market.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

They even used the tagline, do yourself a favor when advertising it in stores. And it seemed like this was the product of the future for smokers looking to quit. But pretty much right when it got on the market, the FDA tried to ban it, which is like... They claimed it was a drug. Dr. Jacobson, Phil's co-inventor, called BS. He's like, this is not a drug.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

The favor had less nicotine than a traditional cigarette. So how could their product be a drug? But cigarettes were still allowed to be sold. It made no sense. Make it make sense. They were pissed. And even though Dr. Jacobson didn't have any solid evidence, he believed that Big Tobacco screwed with their company because they knew how successful the product would be or could be.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

And I mean, they would be in direct competition with each other. And Big Tobacco, they want to keep their customers at all costs, okay? But also, to be fair, Phil and Dr. Jacobson were ignoring a major flaw with their product. The Favors e-cig juice is just nicotine. When nicotine sits for a while, it becomes very bitter and it tastes nasty.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

The product would have probably flopped on the market anyway. Still, the product created an appetite for nicotine in e-cigs. And Phil is actually the guy who created the term vaping. Wow, way to leave your mark, Phil. I mean, you could say it wasn't all a waste. And look, over the next few decades, so many different companies tried to create an e-cig that actually could make it in the market.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

And all of them failed. Finally, in 2003, one man succeeded. And he single-handedly changed the vaping scene forever. In the 90s, a man named Han Lick Love that. Went to study traditional Chinese medicine at college. He was always supposed to go there. It was like a career chosen for him when he was younger. Han was born in China where there were more than 300 million smokers.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

Welcome to the dark history of vaping. Hi friends, I hope you're having a wonderful day today. My name is Bailey Sarian, and I'd like to welcome you to my podcast, Dark History. Here, we believe history does not have to be boring. It might be tragic, sometimes it's happy, but either way, it's our dark history.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

So just like many people he knew, as soon as Han was an adult, he started smoking. He said that as soon as he woke up, cigarette in the mouth. He'd go to class, smoke in between, smoke at lunch, smoke on the way home, smoke, smoke, smoke, smoke. He'd usually go through two packs by the time he got home and smoke a third over dinner and drinks with his colleagues.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

Damn, didn't you feel like doo-doo? Okay, side story, side note. I started smoking cigarettes when I was 18, because I wanted to be like Mary Kate Olsen, whatever, come from me, don't care. But I just thought she was so cool, and I wanted to smoke, and then like, it's very addictive, you know? And you just, whatever, I smoked so much.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

I was up to like, I thought, I was up to a pack a day at one point in my life, and I felt like garbage. So I don't know how you're up to three. I don't smoke anymore. I vape. I'm sorry. I'm sorry. Leave me alone. Shut up. Shut up. When I first got into vaping, the only people who were doing it were like kind of, no offense, low key, high, I was there though, douchebags.

Dark History
161: Saving Millions or Making us SICK?? The Shocking Truth Behind Vaping

Like all the douchebags, all the bros, they were vaping. It was like so embarrassing and it was like cringy. And I show up today and Paul looks exactly how these vape bros used to look. And maybe they still look this way. And I'm just out of touch now because I'm a little bit older. But Paul, you look, you look like a vape bro. Vape life! Anywho, back on track, Bailey. Good times.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

Hi friends, how are you today? My name is Bailey Sarian and today is Monday, which means it's Murder, Mystery, and Makeup Monday. Okay, so let me tell you a little bit, a little introduction for you. Quiet city of Petersburg, Russia. Now, police, they made a chilling discovery in 2015 that would shock the nation and earn one elderly woman the infamous title of the killer granny. Oh yes, oh yes.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

With Stitch Fix, they don't force you into, you know, a subscription service, okay? You can order boxes when you want and how you want it, okay? No stores, no crowds, no last minute panic ordering online. Just personalized looks that you will love. Stitch Fix makes it all so easy. Personal styling for everyone. Get started today at stitchfix.com slash makeup. That's stitchfix.com slash makeup.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

so the police come out they start to question people in the neighborhood and realize that nobody had seen valentina in days so um police they also they go out to the pond they collect the bags they do all that stuff and one day after uh finding these body parts police were able to link them to valentina so police they head back to Valentina's house.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

They go to Valentina's house and then they knock on the door and guess who answers? Tamara answers. Of course she does. She's like, this is my house now. Apparently Tamara was very welcoming. She told the police officers to come on in. Don't be shy. Come on in. So once the police get inside, you know, police are looking around as they do.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

And they find traces of blood in the kitchen and the bathroom. And then they realized, hey, wait a minute. The shower curtain has been torn off. Hmm. That's a little odd, ma'am. So the investigators, they confronted Tamara and they were like, look, babe, listen. There's blood, there's blood, there's evidence. Plus no one has seen Valentina in days.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

And without hesitation, Tamara was like, okay, you got me. Like she didn't even try and deny, which is good because you know, they didn't have to like chase her down, I guess, the bright side here. She told the officers like I murdered Valentina. It was I. So the police, you know, they obviously arrest her. They're like, okay, great. Thank you for confessing.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

So once she's arrested and in custody, she tells the police the whole fight over the dishes, which must've just sounded ridiculous, right? She tells him about buying the drugs at the pharmacy and putting like all 50 pills in her salad. And the police then, you know, they searched Valentina's apartment and that's where they ended up finding Tamara's diary.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

And let me tell you, this lady, she told her diary everything, which is great for investigators. Not great for her. Not that I want it to be great for her, you know. I was like, girl, come on. I mean, even though her diary was written in three different languages, they were still able to decipher it and read everything.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

Tamara grows up there, but there's really not like much else that we know about her childhood, but it is Russia. So, you know, I'm sure it wasn't. rainbows and lollipops, but that's just my assumption. So Tamara, when she graduates high school, she ends up moving like 14 hours across the country to attend college in Moscow. So in Moscow, Tamara, she enrolls at Moscow State linguistic university.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

The investigators, they realized they were not just reading a diary full of songs and poetry. There was handwritten confessions to several other murders. Several other murders. Like she was a very, very busy lady. She really was. So remember how Tamara used to have roommates? Keyword, used to. Yeah. Well, according to her diary, she killed some of them. She was like, I don't know.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

They were annoying me. Including one of her earliest tenants, his name was Voladia. Well, she wrote in her diary that she cut him to pieces in the bathroom. She put... pieces of him into plastic bags and then threw them away in different parts of a different district area. The name is real difficult, okay?

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

Another diary entry described how she dismembered the body of a 44-year-old man named Sergei. bodnaven i'm so sorry sergey or sergey yeah but she she did that okay i guess tamara and him had some kind of argument and murder was the answer she decided to kill him she put his body parts in different plastic bags and dumped them around the neighborhood

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

And it turns out in 2003, a headless, armless and legless man's body had been found on the same street that Tamara had mentioned in her diary, but it had gone unsolved. Damn. I know. She also wrote in her diary about his tattoos. So it was connecting the dots for investigators. They didn't have to do much investigating. They just read the diary and they're like, oh, okay.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

All the answers are here. After her arrest, Sergi's business card and traces of his blood were also found in her apartment. So it just really solidified the situation. In her diary, she wrote about how much she loved Valentina. So I don't know, but you know, that didn't work out. There were also things written in the diary that made it sound like Tamara had like eaten her victims.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

Allegedly, she liked cutting out their lungs and eating them based on him.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

diary but they were never officially reported like in the media or i don't know they were never like officially reported on so it's like hard to know if that's true or not but police also never released information about possible cannibalism because there was no physical evidence to prove that tamara actually ate her victims because she ate the evidence

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

You know, so they don't really know, but Tamara told the police that her diary entries were real. So she's like, yeah, that happened. And maybe she did. She seems like she tells her diary everything. So at this point, sure. I believe it. So according to her, she would eat parts of the lungs, legs, and pieces of the head. of her victims before disposing everything else.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

What was she making, like some kind of soup or something? Was she giving it to other people? That's what I was like, I don't know. Go over to grandma's house for dinner and she's giving you head? Oh. Sorry, not like that, actual head. You know, sorry, flagged, it's over for me. Grandma's not giving you a head, sorry. I am having a day.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

So on July 29th, 2015, Tamara is taken to the Fruensee District Court of St. Petersburg. And they actually put her in a cage in the courtroom. She's like, I'm being treated like an animal. It's like, girl, you ate people. It's valid. I think you need to be in a cage. Even though Tamara's in a cage, she's still able to talk to journalists.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

So she turns to the media and she's telling them kind of like, I knew this day would come. I don't know why she has a southern accent, but she does, in my mind. She doesn't, she's a Russian. Okay, and that it's such a disgrace that the whole city will know what I did. but she also told reporters that she was being haunted by a maniac upstairs who forced her to kill.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

People were assuming she meant that she was hearing voices in her head, but not fully sure there. There was no clarification. Most of the time in court, she was behaving Quite strangely, they said. I wonder why. She either had her head in her hands and she'd be like hiding from the camera. I think she was more ashamed of being caught. Like, oh my God, everyone's gonna know.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

So she's like learning languages. She's living the city life and she seems to be good at it. Learning languages. I wish I could. And then once she graduates from college, she moves to Leningrad, which eventually turns into St. Petersburg. So we'll just call it St. Petersburg because that's what it is now. So at this time, it's the early 70s and she's living in St. Petersburg. It's a big city.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

Like she was embarrassed of that. Or there were other times when she was crying, which again, I just think like she was embarrassed to be caught and like have her name ruined, which is like, Okay, then why'd you do it, girl? But then there were other times where she'd be sitting up proudly and even flirting with the court and the media.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

She's like blowing kisses, hi, and like fixing her hair for them, trying to act all cute. And then there was another time where she acted like she didn't know where she was. So people were like, is she putting on an act or is she... Like what's going on? In one translation of what she told the judge, Tamara said all of the killings were deliberate.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

That for the last 10 years, she had been preparing for this day and to quote, close the chapter with the murder of Valentina. This is what she said, allegedly. She wanted to be known as a serial killer, which like goes against how she was behaving. It's like, damn girl, make up your mind. So I guess when she killed Valentina, she realized she had nowhere to live.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

And she was like, I should just live in prison. So I'll just confess, which is weird. Cause I thought she was getting her place renovated, but maybe that was just all a lie. I don't know what to believe with this lady. So Tamara, she ended up telling the judge that she was indeed guilty and that she deserved the punishment. Good for her.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

The judge announced to the court that Tamara would be held in custody to which Tamara smiled and clapped her hands. So she gets put in jail while she's awaiting trial. And also while the police like continue their investigation.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

Even though she had confessed to all sorts of murders, it was kind of hard to take Tamara's word on things because she had told the police just lots of like very colorful stories, you know, and many of them were like contradicting each other. So it was like, I don't know. They didn't know what to believe.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

She also told police that she was an actress and a graduate of a very well-known ooh-la-la type of school, Vaganova, I think it's called, Vaganova Academy of Russian Ballet. And then she changed her story, saying she worked at one of the city's most prestigious hotels. So police obviously had a hard time trying to piece the story together on their own, because she was...

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

Just talking, just saying shit. I don't know. Maybe she was trying to come off like she didn't know what she was doing, you know? She's like, I don't know. I'm just like a little old lady. Help me. I don't know what I'm talking about. But you know, police, they reviewed all the CCTV footage they got of her dumping the bags into the pond. And at least they had that.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

And they also had CCTV footage of Tamara carrying like the saucepan, which was believed to have the hands and the head, but they never found it. So I don't know where she put that. So now it's November of 2015 and Tamara's been in custody for a few months, again, waiting for trial. And the court has her undergo a psych exam.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

I mean, this may not be surprising because the psych came back and said like Tamara is a danger to herself and society. So yeah, that was the review. So a month later in December of 2015, she moved to a special psychiatric prison in Kazan until police finished the full investigation.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

At one point during the investigation, they had talked to Tamara's family and neighbors and friends, you know, and according to a lot of them, They said that Tamara would brag that one day she would be famous and popular. Yeah, Tamara was telling everyone that she would eventually cause a sensation. I don't know what sensation. Tingling, stabbing sensation, I don't know.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

She never said why or how, but that's what she always told people. And then Tamara's neighbor who like knew, knew Tamara for like 15 years said that Tamara was really interested in the serial killer, Andre Chikatilo, AKA the Red Ripper, which I did an episode on him many moons ago, a long time ago, but she kind of was like really interested in him. You know what I mean? This guy.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

Andre, he had like killed and eaten at least 52 women in the 70s and 90s. Yeah, he was very busy. And according to the neighbor, Tamara had like lots of knowledge about this murderous Andre guy. The neighbor said that back in the day, Tamara would sit topless with her back to the window. He was like, yeah, I don't know how I know that, but I just know that she did that a lot.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

There's like almost 4 million people who live there. And you know, amongst all these people out there, she meets a guy named Alexei, not the one who invented Tetris. Do you know that story? Should I tell you the history of Tetris? Because it's actually really interesting, but I... I am distracted, I had a Red Bull. So the two hit it off and she eventually marries. She marries Alexei.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

and that Tamara's body was quite attractive. He was like, okay, you didn't have to give that much information, but all right, guy. I don't know what this has to do with anything, but that's what the neighbor said, that her body was very attractive and she would sit naked sometimes. I wasn't looking, but I noticed that she was doing that.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

But this neighbor actually did give a little information that may have been helpful. They said that Tamara asked to borrow their hacksaw years back and she never returned it. Rude. But now that we know she murdered all these people and like cut them up. She probably was using it.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

It was also revealed in the investigation that Tamara had been in and out of mental institutions at least three times over the past 15 years. I guess the doctors thought that she had schizophrenia, you know, schizophrenia, you know, schizophrenia, you know, her hallucinations, delusions, it's thought disorder, movement disorder. Honestly, it sounds really scary and awful.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

But remember, Tamara had said that she was haunted by like a maniac upstairs, which maybe it was in her head. That doesn't excuse her behavior, but it's like, oh, maybe it was that. So investigators, they also talked to one of Tamara's school friends from back in the day. And this school friend told police that Tamara had apparently killed her own mother-in-law. I know, I was like, girl, what?

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

Why wouldn't you say anything? Well, Tamara had threatened this friend saying, look, if you say anything, I'm gonna cut you up into pieces and throw you out to the dogs. So don't make me angry or I'll do it. And so the friend was like, okay, guess I won't say anything. All right, sounds good.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

So while the police are learning all this stuff from Tamara's friends and neighbors, Tamara is still in treatment at the special hospital. There she gets officially diagnosed with paranoid schizophrenia and it's determined she is unfit to stand trial.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

So the judge orders Tamara to spend the rest of her life in a mental institution where for years to come, it showed that she continued to be a threat to those around her and herself and that she required special monitoring. So remember how I mentioned like there's possibly other victims that Tamara had written about in her diary? Well, many investigators believe like she killed a lot more people.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

Some reports say she killed like 11 people. there was 11 murders and then others say 14 different murders. But we know that some of them were like a handful of her tenants who just disappeared. But it's hard to confirm because the police did not have solid evidence aside from her diary and her own confessions. So yeah, you know what they say, like without a body, like it's hard to prove anything.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

But her diary did reference both cannibalism and the occult. So... People were like, well, maybe that's why she had all those black magic books in her apartment. Trying to link it to like that. I don't know. Police also suspect that Tamara killed and dismembered her husband. Yeah, remember him? Yeah. In the very beginning, the guy who allegedly ran off with another woman.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

Well, it turns out police think that Tamara killed him. I mean, why wouldn't she at this point? Jeez, you know? But again, they can't confirm because nobody knows where the bodies are. Now, as for Tamara, guess what? She's still alive. I was kind of surprised. I don't know why, but I was. And she is still continuing to live out her days in the high security psychiatric prison

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

And as one source to the investigation put it, we may never know the extent of the granny's killings. Maybe one day she will give a full confession. I doubt she will just because I think she would have done it by now. She's probably not well. How about they just release the diary? I'd love to read that. I mean, I wouldn't love it, but like, you know, I'm just curious. I would read it.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

So the newlyweds soon move into a newly built panel house in the Kupchina area. Okay, shut up, I'm trying. But panel houses were like these low cost buildings that popped up all over the Soviet Union after World War II. They were cheap and easy to build. So when the city was growing, they built these quickly to accommodate the growing population. So she gets into one of those.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

if it were available. So that is the awful story of Tamara Samsonova. She was a killer who killed for who knows why, because she wasn't getting money for it. She was just like killing for fun. And you don't, to be fair, you don't really hear a lot of women murderers who just kill for fun. It's always like... The man, sorry, but it's kind of like, it's true, right?

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

Women always kill, it's always a passionate killing. So the fact that she did and like nobody can figure out why, it's pretty rare. She wasn't gaining anything from it. I don't know how, I don't know. What was her motive? Why did she, you think she's just sick and she was just killing? Yeah, I guess so. I mean, that's really it Bailey. I think that's it.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

Could you imagine if one day you wake up and you find out your grandma had killed a bunch of people and was a serial killer and you're like, grandma, grandma. That must be wild. I hope you have a good day. You make good choices and I'll be seeing you guys later. Goodbye.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

After that, she ends up getting a job working as a travel agent. She was putting her linguistics degree to good use. So she's working as a travel agent. She's great with people. She's a sweet, nice lady who speaks, again, a lot of languages. So people just like her. Then she gets a job working at the Grand Hotel Europe, which was like this fancy hotel that got a lot of foreign visitors.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

And it turns out Tamara was like really good at this fancy hotel job because she ended up working there for 16 years before retiring. So she retires and nobody really knows what she was up to at this time. But what we do know is that shortly after she retired, Tamara's husband, Alexi, he just like goes missing.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

Now listen, him and Tamara had been together for like 30 years at this point and then suddenly poof, he's gone. Do you guys remember that feeling when you were a kid and you were walking into the mall? It was so cool. I was like, well, you know? I mean, yeah, I only had like $8 in my pocket, but I could go to Claire's really quick and like get some barrettes.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

Just felt like the world was at my fingertips. Shopping was so fun. And it's just so hard to replicate that online because of how hard it is to set up a great retail experience. through a screen, you know? Especially if you have multiple stores, big staff, fulfillment centers, separate workflows. I mean, what the? It's a lot.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

What was her name, you ask? Tamara Samsonova, an unassuming, soft-spoken senior known to her neighbors as a polite and gentle woman. But behind her kind face lurked a horrifying truth, one that would eventually reveal her as a suspected serial killer with a taste for murder, dismemberment, and dark ritual. I know.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

But with Shopify Point of Sale, you can do it all without the complications. Shopify's point of sale system is a unified command center for your retail business. It brings together in-store and online operations across 1,000 locations, guaranteeing that shopping will always be convenient for your customers.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

With Shopify POS, you can keep shoppers coming back with personalized experiences and first-party data that give marketing teams a competitive edge. In fact, it's proven. Based on a report from EY, businesses on Shopify POS see real results, like 22% better total cost of ownership and benefits equivalent to an 8.9% uplift in sales on average relative to the market set surveyed.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

Capture that just walked into the mall feeling with Shopify. Want more? Check out at shopify.com slash makeup, all lowercase. Makeup is all lowercase. And learn how to create the best retail experiences without complexity. Shopify.com slash makeup. The makeup is all lowercase. So Tamara goes to authorities and she reports Alexi missing. She's like, my husband's missing.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

Like, I don't know what to do. And then she tells him, I think he ran off with another woman. Yeah. She tells the police that Alexi ran off with some other lady. So there wasn't much urgency to go looking for him because like, that sounds like a marital problem. You know, they don't really care.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

So now that Alexi is gone, Tamara, she decided to start renting out her room in her apartment, you know, extra income. That's great. But it turns out she had like a really hard time keeping them around. I wonder why. It was said that Tamara was kind of difficult to live with. Her neighbors actually would later say they remembered hearing a lot of like loud banging on the radiator.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

They would hear yelling and all sorts of just like loud noises coming from her apartment pretty often. So as soon as like a new roommate would come in, they would quickly move out. As a neighbor, they're like, of course they're watching. They're like, this lady's crazy, watch. I give him five days, he'll be out. But Tamara, she didn't just like let her feelings out on her roommates. No, nay nay.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

She also kept like details of her life in her diary. She was, she had diaries for years, but she would write in her diaries in like Russian, English, and sometimes German. It was just like where she expressed her thoughts on life. And you know, she'd like write down things things like she slept badly, she drank coffee, took medicine, normal diary stuff. And Tamara, she had like a lot of interests.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

She liked writing songs, music. Apparently she had lots of like books about black magic and astrology. Like she loved that shit. Okay. So a few years go by and it's like 2014. Tamara decides to renovate her apartment. And it was great timing because she had just been introduced to 79-year-old Valentina Nikolaevina. Nailed that. Valentina, she's almost 80, right?

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

So she was looking for someone to like move into her place who could help around with chores and around the house or whatever. Tamara at this point is 68 and Tamara tells Valentina she'll move in and like help her with the housework and whatever. So it's like great arrangement. While Tamara's apartment's getting renovated, she can stay with this lady. Well, it turns out like, what's her name?

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

Tamara. She like really loved this new little setup she had going on. She loved Valentina's place. Unfortunately, the feeling was not mutual. I guess like over time, the relationship between Tamara and Valentina started to just go south and Valentina like asked Tamara to move out. And Tamara's like, no, I'm not moving out actually. That's crazy.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

Crazy you bring that up because that's not happening. Valentina told her that she was pretty much tired of her. It's like, she wasn't really keeping up with housework or anything like that. She was just pretty much being a squatter. Okay. Either way, Valentina was like, please leave. And Tamara just like kept refusing. Then in July of 2015, they got into a bad fight over unwashed dishes. I get it.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

I mean, imagine like opening a dusty old diary and finding pages upon pages describing brutal killings written by the very grandmother who lived down the hall. Today we dive into the twisted mind and gruesome acts of Tamara Samsonova. I mean, what drove her to commit these heinous crimes? And how did she manage to go unnoticed for decades?

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

No one likes doing the dishes. So apparently neither of them wanted to clean the dirty dishes, which is fair, you know, except the whole reason that Tamara was living there was to help Valentina with her housework. So it was, you know, annoying, right? Tamara couldn't keep up with the bargain. And once again, she was just being an inconvenience to Valentina.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

So instead of Tamara moving out, like, you know, she was asked, Tamara decides, I need to get rid of Valentina. She's a problem. So she decides, Tamara, she decides she's going to poison her. I know, big, big jump here. I was like, okay, all right. She was about to get aquatiphonied. So Tamara, she later said that she panicked because she was scared to live at her home, which I was like, okay.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

And if she killed Valentina, she could live in peace for another five months because that's when the renovation would be done. So, okay. All right. So anyways, the two of them fight over unwashed cups and Tamara, you know, she's had enough. So she goes out and she buys some drugs for the poisoning.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

She drives to a nearby city and she somehow convinces a pharmacist to sell her a prescription drug called which according to the internet is like a Xanax type of drug. It has a very calming effect, make you, knock you out, I guess. This drug was actually developed in Russia to treat neurological disorders like insomnia and anxiety. So the pharmacist ends up handing over 50 pills to Tamara,

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

She's like, thank you. And she goes back to Valentina's. When she's back at Valentina's tomorrow, she ends up cooking one of Valentina's favorite meals, an Olivier salad, which I guess is like a traditional Russian dish. I'm sorry if I butchered the name, but it's made with peas, potatoes, carrots, onions, pickles, eggs. and like some sort of meat and they mix it all together with mayo.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

So it was like the perfect meal to sprinkle in some pills. And by sprinkle in, I mean, Tamara literally put all 50 pills into the salad.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

and then she served it to poor valentina who had no clue what was going on so tamara gives valentina her food and then go ends up like going to bed waiting for the pills to kick in but around 2 a.m tamara she wakes up and she goes down to the kitchen and that's where she finds valentina's body just laying on the kitchen floor

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

Now, this is where reports get a little wonky, but some say that Valentina was still alive when Tamara found her. But either way, it didn't stop Tamara from doing what she did next, dismember Valentina. Tamara later told police she did all of this in the kitchen because Valentina was too heavy to carry into the bathroom.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

So it's unclear what Tamara did with the body parts and the organs, but we do know she wrapped the rest of the body parts in pieces of a, um, like a shower curtain. Yeah. And then she placed them in plastic bags before dumping them in a pond near her neighborhood. CCTV footage actually caught Tamara dragging plastic bags to the pond seven different times. I mean, okay, all right.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

So buckle in, kitty cats, because today's story is just like, what? What? Grandma? Grandma! No! So Tamara was born on April 25th, 1947 in the city of Auger. I think is how you say Augur, which is a government town in central Russia. Now it wasn't like a super big place back then. From what I understood online was that like 20,000 people were living there at the time that she was living there.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

Now it's about three days later, it's like July 26, 2015. And there's a couple who's out walking their dog, just minding their own business by the pond. And this dog became very interested in a bag that had, you know, come ashore. So the couple, they decide to open the bag. What's in the box? Only to see a headless and limbless torso. Could you imagine? No.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

So of course they called the police right away. And police actually, the night of Tamara's murder, they got a phone call from someone who saw Tamara out by the pond, dropping bags into the pond. So that person called the police. So now the police are like, oh shit, something's going on here. Right. Hoping that they're putting the pieces together.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

And then on top of that, talk about a bad day to murder someone because a social worker had stopped by to see Valentina to make sure everything's okay, you know, and Tamara had refused to let her into the apartment. So all the pieces are coming together very quickly. The other day I hit a wall. I was invited to this party that I was super excited for.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

But as the party got closer and closer, I started getting more and more nervous. I had nothing to wear. Oh, I panic shopped online and of course, you know, you order it and it comes next day and then like, it doesn't fit, it doesn't look good on you. I always have to remind myself, I'm not a five foot nine supermodel and that's why the dress looks different on me than it did on the website.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

You know what I'm saying? So for the party, I just wore what I always wear. My black dress that if you ever see me out in public, I'm probably wearing it. I'm actually going to wear it tonight because I'm going to a party tonight. I have nothing to wear. I'm going to wear that black dress. I wear it everywhere. I don't really give a shit anymore. I give up. Because you know why?

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

Shopping sucks, okay? I know a lot of you can relate. But thankfully, there's a better way to shop online with... Stitch Fix. Stitch Fix is an online personal styling service that makes shopping easy. And hey, if you're like me and you really just don't know where to start, Stitch Fix has your back. They pair you with a Stitch Fix stylist who curates pieces that they know will work for me.

Murder, Mystery & Makeup
Grandma is secretly a serial killer and CANNIBAL?? The shocking crimes of the Granny Ripper

I just give my stylist my size, style, and budget preferences, and they send just for me pieces, plus outfit recommendations and styling tips. They're like, girl, put this with this. Wear it. And I'm like, oh, I would have never done that. The best part is I can keep what I love. And then if, you know, you don't love something else, you can send it back. Send back the rest.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

Now before going on this date Johnny actually met up with his friends and he told him that he was going to meet this lady from Plenty of Fish. Now Johnny actually gave his friends the address that Mark who was once again pretending to be a woman, had given him for the meetup. So he's like, this is where I'm going. Like, this is the address. And he gives this to his friends.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

So once he's done hanging out with his friends, he's like, he heads out. He's gonna go on this date. Johnny heads to the location, you know, that was sent to him. And kind of like before, Johnny was told to enter through the garage. So he parks his car and then he goes into the garage.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

So when Johnny gets inside the garage, he's then attacked with a lead pipe. And then like, once he's like knocked out or whatever, attacked with a lead pipe. And then after that, he was stabbed to death. Brutal. Like what the, what? Like he didn't have time to think. Well, it was Mark. Okay. It was Mark. Mark then takes it like a step further and and decides to cut up and dismember Johnny's body.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

I guess like Mark tried to burn some of the body parts. Yeah, but we know he tried to. I think he realized it either wasn't like a good idea or something because he gave up on that. But he ends up like dismembering the body and like cutting it up and then putting the remains in different garbage bags.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

I'm assuming they met in college because like they got married like right after graduating college, but you know, whatever. But Megan, she was from Illinois and the two of them, they got married, you know, and Mark ended up moving to Illinois with her. And again, there was like not much said about their marriage, but I think it's safe to say

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

And then he was gonna take all those garbage bags and like drop them into the storm sewer, which he does. I mean, if you've been paying attention, which I'm sure you have been, this whole attack was just like the movie that Mark had made called House of Cards. Mark had like just filmed House of Cards two weeks prior to this attack, to this murder, sorry.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

And it was filmed in that garage where the murder took place. I don't know what to say to that. So three days go by and Johnny's friends and family, they're like getting kind of worried about him. You know, at first they thought like, oh, he's busy, you know, whatever. But on day three, they're like, okay, something's not right.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

Especially because there was an email that went out from Johnny's, Johnny's email account saying that he had met a woman who was taking him on a tropical vacation to Costa Rica. And it's like, okay. What? Right? So Johnny had sent out an email from his account and I have it in my notes. Don't laugh at me. The email went out October 13th, 2008 at 8.52 a.m.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

It says, hey there, I've met an extraordinary woman named Jen who has offered to take me on a nice long tropical vacation. We'll be staying in her winter home in Costa Rica. Phone number to follow soon. I won't be back in town until December 10th, but I will be checking my email periodically. See you around the holidays, Johnny. If I could flip this table, I would.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

So, um, people were like, I don't know what kind of friends you have, but like if you're a friend, I know. Okay. If one of my friends was like, sent me this type of email, I'd be like, first of all, what? Second of all, where's the invite? Third of all. What? Like it just, right? It doesn't, it doesn't make sense. It's just random.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

And then on top of that, Johnny's boss also received a resignation letter through the email, through Johnny's email. And it was like, I'm quitting my job. I'm going to Costa Rica or whatever. The boss writes back asking for a forwarding address to send Johnny his final paycheck. But like... He never got a response. So all of this is not sitting right with Johnny's friends and family.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

They knew something was up. And these are some great friends, seriously. Three days and they're worrying. I could be missing for weeks. I don't know who's showing up. But these friends, they end up driving over to Johnny's condo and they decide to break in.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

because they think like inside they can find some kind of clue or evidence or maybe Johnny's inside like in the condo and like no one knows or something you know they were just like going and looking for something now when they go outside technically they don't like there's no evidence found but what they do notice was that there appeared to be no evidence that Johnny had left for a vacation

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

It didn't work out because after three years of marriage, they got divorced. And like, that's all that was said about the marriage. After the divorce, Mark had moved back to Canada. And while he was back at home, he signed up for a dating website. you know, plenty of fish. He was like, I'm gonna get back out there and start dating again.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

Like all of his belongings were all still there. There was no sign that he had like taken off for a long stay somewhere. Nothing like, again, bizarre, weird, not sitting right. So they decide it's best to call the police. I know. I was like, these people, these are some great friends, right? So when they go to police, you know, they tell them everything they know, but

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

the handover, the evidence that Johnny had shared with them. Remember like before he went on the date, Johnny had shared the location of the date he was going on. And that was like, the last time they saw him. So luckily they still had this information and they go to the police, they give the police the location and these directions would lead the police directly to the garage Mark was renting.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

So police, they go out to the location and when they get there, they come across Mark, you know, and at first they weren't considering him to be a suspect or anything. They just wanted to ask him some questions, but they knew like something wasn't right with Mark's story. Because Mark told police that Johnny had come by.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

He's like, yeah, Johnny came by and bought his, Mark's Mazda for just 40 Canadian dollars. And then after that, Johnny told him that he was leaving the country with a woman and police are like, $40. Huh? Red flag. What? That doesn't make sense. So police, they, you know, they're at this garage location and they're like, can we like look around the garage?

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

So they're like looking around and they notice that there's blood spatter inside. And the police are like, you know, what's this about? There seems to be like blood all over the walls. What's up? And Mark tells the police like, oh, I just filmed a movie called House of Cards. And we just filmed an execution scene. And, you know, we got fake blood everywhere. You know, cause it's for a movie.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

So the police ask like, oh, can we collect the names of like these actors from the movie so they can go and you know, question them and make sure like this movie scene actually happened. And Mark is like, yeah, no problem. Hands over the names to these actors and whatnot and thinks he's golden. So police, they actually go and they find one of the actors who starred in Mark's film.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

And the police ask like, hey, how much fake blood was like used in that execution scene? Was it messy? You know, was there blood everywhere? And then the actor responds to police by saying like, there was no blood. There was no fake blood. There was not, you know, I think you get it. Like, they're like, okay, this Mark guy, weird. We're gonna go back.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

We're gonna do, like, he's obviously knows something. They end up going back to Mark's garage and they end up doing a luminal test. And the luminal test can uncover blood that isn't visible to the naked eye. like they could spray it on or whatever. And then when they do a black light, it'll show you all the blood that used to be there before it was cleaned up.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

So they do this luminol test and it reveals that like there was excessive amounts of human blood that had been cleaned up around this garage. And they're like, fucking sound the alarm. This is no fake blood. Like this was real. And it was a lot. Well, police, they're like, okay, we have our guy, right? Obviously. They're like, that was easy. Mystery solved.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

Hi friends, how are you today? My name is Bailey Sarian and today is Monday, which means it's murder, mystery, and makeup Monday. If you're new here, hi. My name is Bailey Sarian and on Mondays I sit down and I talk about a true crime story that's been heavy on my noggin and I do my makeup at the same time. Let me tell you about today's story because I went down a rabbit hole with this guy.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

So he gets on this dating website and he ends up meeting a girl named Jess. And this was like 2005. And the two of them, they hit it off and they start dating each other. So then in 2007, Mark, you know, he's still super into movies, right? And he wanted to create his own. It was his passion in life. So he worked on like a little passion project

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

So the police say no, that this is their guy, right? And on October 31st, 2008, Mark Twitchell was arrested and charged with first degree murder. On Halloween. I know, I was like, wow, that's very fitting, kind of, you know? Like, all right. Once the media gets a hold of this story, it's out there, it's circulating, you know, it's getting around. And you know who sees it? Gilles.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

Marc's first victim, he sees the story. He sees the story and he's like, oh my Lord. Like this is the same dude who attacked me. So once he sees the story, Gilles goes to police He decides to come forward and see what happened to him. And he does this on November 3rd. So just a few days after everything went down, you know?

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

So when Gila came forward, the media gave him the nickname, the one who got away, which is like, okay, yeah, I mean. And Gilles would later write a book called The One Who Got Away, Escape from the Kill Room. He got to share his story. Poor guy. I was thinking he probably had so much like guilt, you know, maybe, I don't know. I don't want to make assumptions, but I could only imagine.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

So Mark ends up sitting in custody for like quite some time. And during this time, he's like swearing he's innocent. He's telling everyone that like he quote unquote accidentally killed Johnny in self-defense. And it was like, make it make sense. But he wasn't trying. He was just like, it was self-defense.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

But after two years behind bars, Mark finally like cracks and he ends up giving police handwritten directions as to where he dumped Johnny's remains. Because at this point they didn't find his remains yet. So they print out this little like Google map. And then what's his name? Mark.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

He like, he wrote handwritten details at the bottom of the page and it kind of like drew like where the remains were at. So at the bottom, he like hand wrote the location of where to find the remains.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

in an alleyway between 86th and 87th street south of 130 avenue where two manhole slash sewer covers are in close proximity the only area in the alley where this occurs the cover on easternmost edge of alley on private property fifth light post from 130 avenue indicated by red circle above and then he signed it and then he dated it they were able to uncover the remains

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

Then in June, 2010, Mark was like fully ready to take the stand at his trial. Like he really thought he was gonna like say something good that was gonna get him off the hook because he really like wanted to argue that he had quote unquote accidentally killed Johnny in a horrific accident of self-defense. Like he was gonna fight for this.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

So while he was in prison, this guy named Steve, Steve was working as like an investigative journalist with Edmonton Journal. He got wind of the story, wanted to talk to Mark. So he like wrote him a letter and started talking with Mark behind bars. And boy, did Mark deliver. Kind of. Steve said that like Mark just like straight up called him out of the blue. I was like, hey, I got your letter.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

I would love to communicate with you. And then afterwards, the two of them kept in contact by writing each other letters. So they were sending letters back and forth. And Steve said that he got around 30 to 35 letters from Mark. It was like a total of 350 pages.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

steve said he was trying to push mark to explain himself but like he never received a good answer and it was like yeah you know i don't think you can receive a good answer with these types of people right there is no good answer i don't know what would qualify as a good answer i did it for the gram i don't know we are teresa and nemo and that's why we switched to shopify the platform we used before shopify needed regular updates that sometimes led to the shop not working

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

And it was a Star Wars fan film that was written, produced, and directed by him. Oh yes, he did it all. Now when it came to this film of his, I mean, he went off. All the way off. I mean, Mark had a major talent for prop and costume design. For his film, he had created like replica suits from the Star Wars universe. And honestly, they looked really legit.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

What is a good answer? It doesn't matter really, but there wasn't one. One of the letters from Mark said, quote, after curiously shoving aside my human sensibilities, I dealt with his remains in a disrespectful manner that traumatized me forever, end quote. He was referring to Johnny's murder. And then in another letter, it said, quote, it would appear that I'm unique in the world.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

There is no key, no root cause. End quote. I know. Have you ever noticed that like killers, they always want to be so unique and special. They always claim this shit. You know, I mean, I am talking about him. So I guess like, I don't think he's unique. Okay. Thank you. There was another letter that said, quote, it is what it is. And I am what I am. Wow, I know he's so deep.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

Steve, the journalist, he actually wrote about the conversations that he had with Mark in a book titled The Devil's Cinema, The Untold Story Behind Mark Twitchell's Kill Room. So when police had arrested Mark, they also searched his home and his car and they took away like anything and everything that might have been evidence or have evidence on it.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

With that being said, at the time of his arrest, they got Mark's laptop. Oh, the laptop. So of course they search it, right? And they uncover a document that Mark tried to delete. And you know how computers go. Like you think you delete something. Baby girl, Lisa, listen, no. It can always be found, can always be found. So when they searched his computer, they came across a document called S.K.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

Confessions. And this would end up being like the key piece of evidence for the murder trial. S.K. Confessions, to their surprise, stood for Serial Killer Confessions. Police are like, great, you know, confess away. Love that, we love a confession. SK Confessions starts off with, this story is based on true events. Great, love that. The names and events were altered slightly to protect the guilty.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

This is a story of my progression into becoming a serial killer. Like anyone just starting out in a new skill, I had a bit of trial and error in the beginning of my misadventures. Allow me to start from the beginning, and I think you'll see what I mean. It's like, go on.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

I don't remember the exact place and time it was that I decided to become a serial killer, but I remember the sensation that hit me when I committed to the decision. It was a rush of pure euphoria. I felt lighter, less stressed, if you will, at the freedom of the prospect.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

There was something about urgently exploring my dark side that greatly appealed to me, and I'm such a methodical planner and thinker, the very challenge itself was enticing to behold. This realization was just the last in a series of new discoveries I made about myself. I just knew I was different somehow from the rest of humanity.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

So the title of this movie was called Secrets of the Rebellion. And it was said that it was receiving like some online hype. People were like kind of excited about it. But like, I'm not really sure because the movie, it wasn't ever completed or released. So I'm not sure who or where they were hyping this up, but allegedly it was hyped.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

I feel no such emotions as empathy or sympathy toward others, for example. Great. So this document literally had Mark's planning, his failed first attempt and his successful second attempt to lure a man to his garage by using a fake dating profile in order to murder them. Like it matched line by line to Johnny's murder. Line by line. In this document, I mean, it included like the hockey mask,

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

the attack with the lead pipe, the quote unquote, Dexter prepped garage. There was a line about the killer trying to burn the remains in a barrel, which police had found a barrel, a burned barrel inside of Mark's garage. So they were like, okay, check, check. Just kind of like a, it was like a checklist really. In the confession, it got really dark. He wrote about how he cut Johnny's head

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

and like gave details saying, um, I grabbed his jaw with my gloved hand and moved it while making a funny voice to make it look like it was talking and chuckled to myself at the total silliness of it all. You know, What the hell do you even say to that? So this document alone is pretty damning, but police, I mean, they found lots of other evidence of Mark's involvement in the murder.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

Like they found Johnny's blood on several articles of Mark's clothing. They also found the knife that was used, the murder weapon. And it, you know, it belonged to Mark. There was like dozens of pieces of evidence tying Mark to Johnny's death. And they were found in Mark's home. They were in his car. They were at his parents' house and also the rented garage where the murder happened.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

There was also like evidence that was recovered from Johnny's car. I guess after the murder, Mark was straight up driving around in Johnny's car. Yeah, great. So Mark also admitted to accessing Johnny's email after his death and sent out that email telling Johnny's friends and family that he was going away on vacation.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

Like he admitted to it, which was just confusing to me because he was claiming it was self-defense, but then like, this doesn't help your case. You know? Oh, oh, oh. And then there was also another document that was found on his computer. And this document did not make its way into evidence. I don't know why. I didn't, I'm sorry.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

I didn't really look that heavily into it, why it didn't make it into evidence. Sorry about that. I'll do better next time. But I have it in my notes. It was titled, A Profile of a Psychopath. Now, obviously investigators, they find it on his computer and they believe like, you know, Mark had written this, it was on his computer, but it went on to say some stuff.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

It started off with saying, I habitually lied my entire life, despite my incredibly well-adjusted and healthy family life and upbringing, it never stopped. I always apologized, but never meant it and never corrected the behavior. For as long as I can remember, I have always had a distinct lack of empathy. I've always had a dark side. I've had a sugarcoat for the world.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

I feel like also Mark probably just was telling people like, yeah, it was super hyped. Mark loved Star Wars. He would dress up in like a costume that he made himself and he would attend movie premieres or anything that was related to the Star Wars world. That was hard for me to say. Star Wars world. You get it. He would dress up. That's great. Like I like, like have your hobby. That's great.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

I've often fantasized about killing people who have wronged me or threatened to hurt me or my family in the future. But that's where it ends. Well, obviously not. Well, it goes on to say, like, I can direct my dark energies into my film work. And like, as a producer, I can profit from the sale of my work and like, blah, blah, blah. No one cares about your movie shit. Sorry. He admits.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

to cheating on his wife pretty often, like all the time. And he said, I still cheat, but only for the thrill of it. And then going on to say, I had a conversation with my wife one night where we fully explored my lack of empathy. She asked me a variety of probing questions. Every answer I gave her, although truthful this time or deeply disappointing to her.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

No after no, when she was looking for yes after yes. His wife is an excellent mother and the greatest partner that anyone could ever ask for. So... It's a little mixed there, isn't it, huh? So they find this. Now this, again, it doesn't get admitted to evidence at all, but they found it. And I think that says a lot too. So... The trial, let's talk about the trial.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

So the trial began and through his lawyer, Mark tried to plead guilty so he would get a lesser charge of interfering with a dead body. But the prosecution rejected that offer and they continued with the first degree murder charge. So the prosecution requested that Mark also be charged with the attempted murder of Gilles in the same case.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

But for some reason, well, the judge decided to keep the two cases separate. During his trial, Mark admitted to killing Johnny and also to writing the SK confessions. But he went with his original story saying that the murder was an act of self-defense. Mark also went on to say that the SK Confessions was fiction based on fact.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

As if to say he planned Johnny's death deliberately in order to write a compelling story. I know, I was like, I'm not sure how, again, how is this helping you? How is this helping your case? I don't know, at least he's confessing. I'll give him that. The prosecution, they really focused in on Mark's obsession with the television program, Dexter.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

If you don't know, Dexter was an American crime drama about this guy named Dexter Morgan, who was like a blood spatter expert who solved murders but committed them to. I guess he was a serial killer, but his justification was that he was killing quote unquote bad people. The show ran from like 2006 to 2013. People really liked it, okay? Everyone talked about it. Mark liked it too.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

He even posed as Dexter Morgan on Facebook. Like he was a total fan boy. I know everyone, everyone was talking about that show when it came out and everyone was like, you have to watch it, you have to watch it. And I never watched it. I'm sorry. I know. I hear it was so good. I'm sorry. I miss that boat. Everyone got on that boat. I was like, bye boat. Bye.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

I'll be over here watching Full House again. I don't know. I just never got. Maybe I'll watch it one day. I don't know. But everyone loved that show. Okay, everyone loved it. So the prosecutors were like, Mark wanted to become a serial killer inspired by this television program. And like he was trying to merge his violent fantasies with real life experiences, just like the TV character did.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

So once again, you know, the Dexter connection. When the media heard about this, they started referring to Mark as the Dexter killer. So keeping the Dexter theme going, many believed Mark's kill garage resembled a scene right out of the show. Like the inside of his garage, it had plastic sheets like all over covering all the windows and There's a table with like blood spatter all over it.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

But listen, I guess his costumes were like really, really good because there were two costume contests that he won in 2007. One was at Bear's Halloween Howler and the other was at Sonic's Monster Mash Halloween Bash. What a name. And like each of these were Halloween parties. And you know they had awards for like best costume. And Mark he won. Great, you know? You know the movie Transformers?

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

And then there were cleaning supplies laid out. So Gilles took the stand and told the court about his experience with Mark and literally how just like a week before Johnny's death, he barely escaped Mark's attack. There was also another person who took the stand. Their name was Renee.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

And I guess this person was like kind of friends with Mark, not understanding fully what their relationship was, but Mark felt comfortable enough with this person to like talk freely with them. So this person Renee told the court that Mark had sent them a message on Facebook saying that he quote, crossed the line. and he'd sent this message the weekend of Johnny's death. What line?

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

So then Mark went on to discuss through Facebook Messenger with this Renee person, the best way to kill someone So, all right. You know, I don't know what Mark was doing here, but you know, thank God for like receipts. This guy is just an idiot. So on April 12th, 2011, after five hours of deliberation, the 12 member jury returned with the verdict of guilty. I mean, right?

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

And they should, if they didn't, we'd probably, I'd be like, what the fuck? So after the verdict came through, that's when the courts did the victim impact statements. It's part of like the sentencing procedures. Johnny's mother was there and she went on to say like, it was just really sad. There's like no words to describe the pain and feeling of horror one goes through. There's no joy in my life.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

It's been ripped away from me. and then adding it was her wish that Marc die a slow death in prison, reflecting on his crime. Makes sense. Yeah, I would probably wish that too. After what the judge called a very difficult case, Marc was given life in prison with no chance of parole for 25 years.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

Once Marc was convicted and sentenced to the maximum prison term, the court found that there was no need to try Marc for the attempted murder of Gilles. Which is like, I'm torn on that. Like, I mean, I get why they did it, you know? But at the same time, like as a victim, you'd probably want like some kind of justice. Like, but it's fine. Like he got, Mark got locked away forever.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

I just hope Jules is okay. And like he got the closure and healing that he needed, you know? So Mark, who was 31 at the time of sentencing, he was asked, you know, by the judge, like, do you have anything you want to add? And Mark said, I think I'll pass on that. So. For someone who likes to talk, he sure didn't want to talk, you know?

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

So he was being like walked out of the courtroom, you know, by like the sheriff people or whatever. And one of Johnny's family members yelled, bye, have fun. Kind of nice little dig, you know? Fuck that gang. So in May of 2011- This was like a few weeks after his sentencing. Mark filed a written appeal without the help of a lawyer where he requested a retrial, this time without a jury.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

He said, the media attention surrounding my case was so extensive, so blatant, and so overtly sensationalized that it is unreasonable to expect any unsequestered jury to have remained uninfluenced by it, regardless of judge's instructions in the charge. All right.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

He then added he believed his lawyer did not, quote, adequately and satisfactorily addressed key points on state of mind and credibility. Those points include his advanced knowledge of computers, which undermines the implication I would use a computer to carry out a crime. All right, my guy, like, no, no, that ain't it. He's trying.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

Mark also took issue with how the Crown, aka the court, presented evidence where he lied to his former girlfriend, his wife, and also the police, saying that, quote, this led the jury to make an inappropriate and skewed character judgment, concluding that I'm a lifetime liar. End quote. You know, actually, I believe in those, that SK Confessions. Didn't it say I've been lying all my life?

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

I'm a habitual liar. I think that is what actually made people think that he's a lifetime liar. Just my opinion. Maybe it was that. So Mark tried. He really did. And then he dropped his appeal in February of 2012 when he realized he was an idiot. Mark Twitchell is serving his life sentence at a maximum security prison in Prince Albert, Saskatchewan.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

Yeah, you know the movie Transformers. So I guess his costume, he made a suit that was just like Bumblebee from Transformers. But Mark said that he went through 240 square feet of plexiglass and foam to make this suit that he made. I'm sure it made him feel good to, you know, when you go off like that and to like be acknowledged and win a prize and, good for him, you know?

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

Well, while he's been in prison, he's still doing stupid shit. It was said that in prison, Mark continued to watch Dexter. The media reported that he purchased a flat screen TV and also a cable package, which I was like, what? All right. But he would watch like reruns of Dexter and then new episodes as they were coming out. Then two years after his imprisonment,

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

Mark wanted to try and revive his film career. Oh yes. Oh yes. So while in prison, he requested access to the hard drives that the police had confiscated, which he believed had hundreds of hours of unreleased film footage on it. There's like a letter from prison. Mark wrote, all the footage is sheer gold. Way too many amazing people gave so much of themselves to make that film magic.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

you

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

All right. Mark believed that his life's work was being held hostage, quote unquote held hostage by the courts and that it was slowly being like suffocated in the process. So Mark was like, he's really wanted to get the footage. He was like, my life's work, it means everything to me. And I think like Mark went on to say like, I refuse to let my story, my life end in a tragedy.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

Yeah, what a serious clown. What a fucking clown. Sorry, dude, but you're an idiot. Stay locked up. Thank you. I feel bad for his wife and stuff, right? Like I don't, I didn't really look too much into like what happened to her. I kind of like to leave them out of it because it's like she didn't fucking know.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

So there was like a staff sergeant who was like head of Edmonton's homicide unit who came out and said like, why would we give anything back to a convicted murderer? He's taken a life and he shouldn't benefit from that in any way.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

period and that my friends is where this story ends this was the mark twitchell case aka the dexter killer the clown the idiot the like may he sit in prison forever rest in peace to poor johnny who just freaking wanted to go on a date huh It was so sad. I mean, like, luckily he had some good friends and like people who cared about him, right?

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

And this really helped like catch Mark before he can move on to the next one, which I'm sure he would have done, right? He probably would have kept going because he thought he's something. I thought about Jill a lot, you know, just for like not coming forward when he was originally attacked.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

I understood like why, but I hope that men like feel like you guys do have a safe place to come forward if you're attacked and there's nothing wrong. with speaking up if something happens to you, you know? Which I'm sure my little speech means nothing, but I don't know. You know, it's just sad. Just sad. I hope he's okay, like, after the fact.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

Like, surviving that awful crime and then, you know, like, survivor's guilt, I'm sure it was really hard. Other than that, one, make sure your man's going to work. Okay? Like, real talk, like, this guy was lying. Like, what was he doing? He's being weird. Okay? Does your man have a job? We gotta make sure, okay? Two, if you're going on a date, share your location. Share your location, okay?

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

Be careful out there, you guys. Seriously, go with your gut feeling. If something doesn't feel right, get the fuck out of there.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

and make sure you meet in a public place and i don't know i'm kind of like the worst because when i was like doing online dating i was so dumb that's not funny but like you think i would be smart and i was like making stupid mistakes i was like what you want to meet in an empty parking lot sure and then i'd be there like wait this is probably not a good idea just don't be like me all right

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

Anyways, well, I hope you have a good rest of your day. You make good choices. Please be safe out there, okay? And I'll be talking to you guys later. Goodbye.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

That's the only time we'll be rooting for him, I guess. Anywho, not long after Mark and his girlfriend, Jess, they would go on to get married. And then about a year later, they would have a daughter. So throughout 2008, Mark started to work on like another passion project of his. It was a short crime film called House of Cards.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

Now this short film was like about a killer who lured a cheating man off of an online dating website, attacking the victim with a lead pipe and then stabbing them to death. I know it was very clue. A lead pipe? Come on. Not sure what the moral of the story was, but like that's, you know, that's what he was going with. I have to say, I'm impressed with you guys.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

A lot of you reached out to me saying you're turning your passions into a side hustle. I'm proud of you. I see you online doing your thing, building your craft. I know that sometimes taking the first step and starting your own business, it's really hard. It's really, really hard.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

And creating really great retail experiences can be tough, especially if you have multiple stores or ideas, a team, staff, whatever. It can be a lot. But with Shopify Point of Sale, you can do it all without complexity. Shopify's point of sale system is a unified command center for your retail business, which means it brings together in-store and online operations across 1,000 locations.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

With Shopify, you'll always be able to guarantee that shopping is always convenient. Endless aisle, ship to customer, buy online, pick up in store, all made simpler so customers can shop how they want and staff can have the tools to close the sale every time. With Shopify POS, you can keep shoppers coming back with personalized experiences.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

Ugh, ugh. ah this guy's too much this guy's too much today we're talking about this 29 year old his name is mark and he was like a super fan of a tv show called dexter do you remember no okay great well we'll talk about it mark's obsession with the showtime series dexter would eventually lead to the media dubbing him as the dexter killer let me tell you This guy is a lot.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

Now that alone is super helpful because as business owners, you know, bringing in new customers can be really expensive. And Shopify customers have seen real results from this system. Based on a report from EY, businesses on Shopify POS see real results, like 22% better total cost of ownership and benefits equivalent to an 8.9% uplift in sales on average. relative to the market set surveyed.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

Want more? Check out at shopify.com slash makeup. Makeup is all lowercase. Shopify.com slash makeup, all lowercase. And learn how to create the best retail experiences without complexity. Shopify.com slash makeup, all lowercase. So with this film, Mark, you know, he would do the same thing. He would write, produce and direct it.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

And then on top of that, he was also trying to gather funds to produce a feature length comedy called Day Players, which I guess was gonna be about like the secret lives of extras in the film industry. So, I mean, that's great, you know, good for him, I guess, whatever. Well, while following his passions in life, things were not going so well back at home.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

Jess Twitchell, Mark's wife, would later say that the marriage started to go like downhill in the fall of 2008 and that they were at this point sleeping in separate rooms and like also trying to go to marriage counseling. Now, during the time of their marriage, she was under the impression that Mark was working as a salesman for a security company. I mean, every day Mark would get up.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

He would go to work every day. You know where I'm going with this. Because later on, she would learn that Mark actually didn't have a job. and was just pretending to go to work for the last five months. She had no idea. She had no clue. She didn't think twice about it, you know?

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

He's like literally getting up every day, leaving the house and going to work and then returning like around five or whatever. Uh-uh, run for the hills quick, okay? Nay, nay. No. Okay? No. I'm trying to think of like, if I found out I was with someone and they were lying to me about going to work every day and they weren't going to work, I don't know what the F I would do. What?

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

What have you been doing? What have you been doing? It doesn't matter, but she finds out. So Jess would later tell the court that on the days where he was committing his crimes, there was a note on the family kitchen calendar that said Mark was at his psychiatrist appointment. Oh yes, you know the calendar that you keep in the kitchen, you see everyone's schedule.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

His was saying that he was at a psychiatrist appointment and boy. Boy, on October 3rd, 2008, a computer company contractor, his name was Gilles, he was looking for love as everyone deserves. So he goes on plentyoffish.com and he ends up matching and like messaging this beautiful five foot, six inch blonde woman named Sheena. Now the two of them, I guess like hit it off.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

They're talking and messaging back and forth and they decide to meet in person. And Gilles thought it was kind of weird when the Sheena woman, she would not like give an actual address of where to meet her. Instead, Gilles was sent detailed directions that would lead him to the location where they would meet. I don't know, it kind of sounds confusing actually.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

You know, like normally you'd be like, hey, meet me here. And you send like an address or something, or maybe at the McDonald's, like on the corner. But this was not the case. This Sheena person was like, you're gonna make a left, then you're gonna go straight, then you're gonna make a right, and like wouldn't give an address.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

And then Sheena told Gilles that, quote, the garage door will be open for you. It's like, okay, no front door? All right, that's fine. So when Gilles gets to this location, You know, it's a garage. Great. And it's kind of like partially raised and he can kind of like see inside the garage and it's pretty dark in there.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

It's like kind of a weird way to enter, but you know, this is what Sheena told me to do. So, okay. You know, when there's like a crack in the garage and you gotta get down low so you can get into the garage. You get it. So he does that and he gets into the garage. And then as soon as he gets into the garage, Gilles feels someone grab him from behind. Surprise, it was Mark.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

Mark was inside wearing a hockey mask. As soon as Gilles gets inside, he attacks him with a stun baton as soon as he like steps in that garage. Now a stun baton is like, I guess way more intense than a stun gun based off of my quick little Google research. I could be wrong, but from what I Googled, it said the stun baton is like way more intense than the stun gun.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

I don't know how he got his hands on one of these, but I guess maybe you could just go get one. I don't know what I'm talking about, but he stuns him. Okay. And then Mark pulls out a gun and then orders Gilles to get on the ground. He's like pointing the gun at him. He's like, get on the ground. Yeah. So when Gilles is on the ground, Marc then puts duct tape over Gilles' eyes. Mm-mm, oh yes.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

Let's get into it, shall we? Let me tell you about this Mark guy. Okay, so Mark Twitchell. He was born on July 4th, 1979 in Edmonton, Canada. It was said from a young age, Mark was obsessed with movies, right? And he dreamed of making it big in the world of cinema.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

Gilles told himself, like, I'd rather go my way than his way. And, you know, adrenaline is pumping. So he gets up, he rips the duct tape from his eyes. I know, I was like, ooh, ah, he rips that shit off. And then he grabs Marc's gun from his hand. And at this point, Gilles realizes that this gun was plastic. It was a plastic gun, which must be such a relief in that moment, I'm sure.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

Well, adrenaline's going, but you know, you're like, oh, thank God this shit's plastic. Anywho, so I guess after this, like there's a violent struggle between the two of them. So they're fighting each other and Mark is like grabbing at him and Gilles was wearing like a jacket, kind of like I got like a zip on, you know?

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

So Mark was like holding onto his jacket and Gilles like kind of maneuvers out of it. Do you know what I'm saying? Like when you can kind of like snake your way out of the jacket, he snakes out the jacket. And then he rolls out from under the garage door, you know, getting ready to make a run for it.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

But he, like, he rolls out from under the garage, stands up, and I guess Mark is, like, right on his ass, grabs his legs and, like, is trying to, you know, drag him back into the garage. Run. Run. Luckily, Gilles, he is able to get that dirt bag, get off my feet and takes off running and hollering. Now at this point, Mark had like come outside of the garage. He's still wearing his mask.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

Comes outside of the garage and he's like gonna start going after me.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

but he looks and across the street there was like this couple who was walking their dog and they're watching like this whole like weird situation go down and they're like this is like so weird you know you would stop and be like what the fuck is going on so mark actually sees the couple he's like oh shit you know and he's trying all of a sudden to act natural He's like, ha ha.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

I mean, I guess Mark wanted the couple to think like the two of them were friends and they were just playing around. So he's like trying to be loud and like, ha ha ha, my friend is so crazy. You know, wow. He's like, isn't that crazy? Like I'm wearing a mask, LOL. So after taking a few moments to make it look like, I don't know, that was his friend. He's just like, all right.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

And then Mark goes back into the garage. Gilles was able to escape. Sadly, after the fact, Gilles wouldn't report like what happened to police because he was embarrassed, which is so sad. You hear about this, like men not wanting to report things because they feel embarrassed by it and stuff. And it's just like this... It's just sad.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

You know, he didn't feel like he had a safe space to like report this. Gilles would later say that like he tried convincing himself that the attack wasn't as serious as he was making it out to be. Or at least like he was trying to convince himself of that. It's just so sad. I felt so bad when I read that. Because at first you kind of want to be frustrated with him.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

So Mark went on a study at the Northern Alberta Institute of Technology, and he participated in the school's radio and television arts program. After graduating college, Mark married this woman named Megan in 2001. Now there wasn't much said about this first marriage situation.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

Like, why wouldn't you report that? Like, why wouldn't you report that? But I understand. And it's just sad. I hope men feel like it's safe to come forward. If you're a victim of an attack, catfish, anything like that, like you can come forward and you could speak out. Don't be embarrassed.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

And the couple that was walking their dog, they didn't report anything either because technically they just saw like a weird situation take place, but nothing, I guess that was worth reporting to police. You know what I mean? Like you see something weird and you're like, yeah, that's weird, but I'm not gonna call the cops weird. So noted, and that was about it. So then it's October of 2008.

Murder, Mystery & Makeup
When a superfan goes too far for his "art" - The Wannabe Dexter Killer

Johnny Altinger is a 38 year old former oil field equipment manufacturer from British Columbia. So he too is looking for love. Hops onto plenty of fish and starts talking to people, you know? He matches with this nice lady. and they start talking to one another seem to hit it off messaging back and forth and they decide that they're going to meet up and they're going to meet on October 10th.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

Hi friends, how are you today? My name is Bailey Sarian, and today is Monday, which means it's Murder, Mystery, and Makeup Monday. Hi. If you're new here, hi, my name is Bailey Sarian, and on Mondays I sit down and I talk about a true crime story that's been heavy on my... noggin, and I do my makeup at the same time.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

Both at this time were well-known figures in South Africa and they were good looking, you know, and they just attracted a lot of media attention. By all accounts, they were both deeply in love, you know? And it wouldn't be long. It was like months later. Their love story comes with like a devastating end. Just like months later. It's where it gets a little funky right here.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

Hey, I don't know if you know this about me, but I love a good mystery, especially if it's a murder mystery. I also love a good video game, you know, one that I could just kind of zone out on, whatever, you know? So when I heard about this murder mystery video game, I was like, yes, tell me more. Go on. Well, you might have heard me talk about it before, okay? Because I freaking love this game.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

It's called June's Journey. Yeah. So it's all about using your observational skills. So if you're an observer like me, you will love this game, okay? The main character of the game, her name is June. She's trying to uncover like this dark family secret to find out the truth behind her sister's tragic murder. Oh! I know. So while you play, you're exploring these gorgeous hidden object scenes.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

They're set in places like New York, Paris, blah, blah, blah. And everything is set in like the 1920s. So it's almost like you're stepping into a time capsule when you play. Plus it's so vibrant and beautiful. Each chapter of the journey reveals new mysteries you have to untangle.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

Along the way, you can collect little bits of information to fill your photo album and learn about more each character you meet as you try to solve the mystery and get closer to the truth. So every level is like a little bit more difficult, you know? So it's always a fun challenge. You can join something called a detective club to chat and play with others. Oh, the game is so fun. It's so fun.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

And if you like looking at things and finding and solving puzzles and using your brain, you're gonna love this game. June's Journey lets you escape reality and join an exciting world of murder, mystery, and romance. You can even enjoy seasonal content with changing challenges, stunning landscapes, and exclusive rewards year round.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

Discover your inner detective when you download June's Journey for free today on iOS and Android. So it's Valentine's Day, 2013. It's like the early morning. Oscar woke up in the middle of the night and he fired four shots with a gun, four shots through the locked door of his bathroom. Well, let me rephrase that. He shot at the bathroom door, which was locked and somebody was on the other end.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

He said that morning or late at night, he heard a window open and he believed that there was an intruder and this intruder had entered the house. So he said that he panicked. He got up out of bed and he walked on his stumps. He grabbed his gun and then he fired thinking he was defending himself from this intruder, right? And he would later say he believed that Reva was sleeping in bed next to him.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

Now it's a crucial bone because it supports the larger tibia. And without it, walking can be a severe challenge. Now this condition, fibular hemimelia, I guess it's like, it's pretty rare. And it happens early in pregnancy between like the sixth and the eighth week when the limb buds are forming. Now the exact cause I guess is like, it's still a mystery.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

So according to Oscar, He came down the hallway towards the bathroom with a gun in hand. He then shouted down the hall to the bathroom for the intruder to flee. Oscar said that he needed or he wanted to get between this intruder and Reva and that he needed to approach this person because... he, Oscar couldn't run away without his legs.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

That's when he fired four shots from his nine millimeter pistol. And then Oscar realized, he said he then realized that Reva wasn't in bed. And at that moment, the horrifying truth had dawned on him that he had just shot and killed his girlfriend. So the bathroom door was locked, but behind the door was Reva. Reva was shot in the head, pelvis, in the hand.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

I guess she had, she died almost instantly. Well, 911 was called. And so the paramedics, they arrive on the scene, but you know, at that point when they showed up, it was too late. Her body was removed around 8 30 AM.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

and oscar pistorius was taken into custody and was being charged with murder so details start coming out you know and they're just swirling around because people don't know whether like oscar is telling the truth was it really just like this awful accident where he was trying to protect himself and his lover from an intruder or had he intentionally killed riva

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

after a heated argument now according to oscar it was like he heard this intruder and he didn't put on his prosthetic legs he just got up he grabbed his gun and he wanted to confront the intruder and protect riva so he just like saw that the door was shut i guess saw that the light was on and just shot at the door that was his reasoning but a lot of people out there are like

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

Dude, the first thing I would do is like look to see if my partner's there. If my partner's not there, then I would assume it was them. If they are there, then I would like act. But you wouldn't just shoot at a door. You would wait for a confrontation. So there's a lot of like, I don't know, dude. I don't know.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

Like he's not dumb, but according to Oscar, because he didn't have his prosthetic legs on, to him was like, I have to shoot this person because I can't run away and I can't defend myself. That was his reasoning. I don't fucking know, bro. I don't know with this one. So, you know, the media is reporting on this. People were like, shock, stun, what?

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

Like they just couldn't wrap their head around this. Who do you believe? So Oscar's ex-girlfriend, gotta love an ex-girlfriend. Cause you know, she's gonna have the truth. Her name was Samantha Taylor. Now, she would later testify that Oscar was quick to anger and that he would often scream at her and her family.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

She even went on to say that Oscar cheated on her multiple times and he never went anywhere without his gun. Now, does that make him a murderer? No, but doesn't look good, right? But then she said... She said, this is the ex-girlfriend, she said that there were a couple of times that he had drawn his gun and fired it out of anger on more than one occasion. So...

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

I wonder what, this is like a side note and it has nothing to do with anything, but I wonder what he was so mad about. Like he had such a loving mom. Usually like when you have a shit mom or something, you like, you know, it kind of, this whole anger thing makes sense. It doesn't make sense, but you get what I'm saying. Like, but he had such a loving mom. So I don't know. What am I getting at?

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

I don't know. It's just like different, you know? So Reva's family was convinced that like the killing was not an accident. And, you know, they weren't the only ones who felt this way. Again, the media, the media was all over this and the public opinion was divided.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

Some people truly believe that like, you know, well, they saw Oscar as like a tragic figure, a man who just, he made a terrible mistake in the heat of the moment, trying to protect his home and his loved one. And then others believe that he was like this cold blooded killer who had finally just like snapped and shown his true colors.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

It's possible that it has something to do with the activation of the genes responsible for forming the baby's legs. But they don't really know. No one really knows. For some, the condition is mild affecting just like one limb. and it can be corrected with surgery. But in Oscar's case, the deformity was pretty severe. So I guess his feet were also malformed.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

So on March 3rd, 2014, Oscar Pistorius, his trial started and it was at the Pretoria High Court. So the prosecution was arguing that the killing was premeditated. They presented evidence from neighbors. Now these neighbors said that they heard a domestic squabble around 3 a.m. followed by gunshots. Mm-hmm.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

There were some that even said that they heard a woman scream before the gunshots had fired. They heard screaming. Now, Oscar's defense argued that it was actually him screaming and he was screaming at the intruder to like, I don't know, stop or something. But Oscar's team was like, yeah, it was him. He was the one screaming. Now the trial, it was a media sensation.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

I mean, every detail was scrutinized. Every piece of evidence dissected. People just really didn't know what to believe. Prosecutors said that morning, Oscar, he had time to put on his prosthetic legs. And to them, this was showing the court that he was not in a hurry as he said he was, but rather that he was cool and collected as he went to kill his girlfriend.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

Now, listen, this was like the big debate. If he put on his legs, to them, this meant that it was premeditated. If he didn't put on his prosthetic legs, then that meant he was truly like in a hurry, just like trying to confront the killer or the person who broke in. So they were focusing hard on this part. The defense, they even brought in the bathroom door as evidence

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

to show the angle of the bullet holes and by these angles it proved that Oscar was not wearing his prosthetic legs meaning it was not premeditated they were arguing that you know without his prosthetic legs he was very vulnerable and which explained like his panicked The prosecution, they also pointed out that Reba had brought her phone with her into the bath. Remember, it's like 3 a.m.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

or something like that. So she brought her phone with her into the bathroom. They believed, or they were saying that she was trying to call someone to like come and pick her up.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

call someone for help just call someone the defense came back and said you know she's just a young woman she's just attached to her phone like everyone else like that's why she brought her phone with her I don't know how I feel about that one I'm trying to think about it because like I get it like being attached to your phone and like bring it with you everywhere but like if you got up from sleep let's say to go to the bathroom the first thing I don't know about you guys but I know I don't grab my phone if I've woken up from sleep to go to the bathroom I take my phone if like

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

I'm being shady. If I'm trying to low key call someone or text someone and not get caught, I'll lock myself in the bathroom. I don't do that now, but like I used to, you know, you'd go in the bathroom and lock the door and be like, fuck. Right? But we don't know. We don't know like what she was doing. But again, Oscar's team, they were like,

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

Oscar and Reva, they had just bought each other presents recently. Remember, it was Valentine's Day. They had just bought each other presents. So they were in a good spot in their relationship. They got presents. And therefore, Oscar did not plan the murder. Presents. That's why. Which might be true. I don't know.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

I was looking through my closet and I realized that I've been wearing the same clothes for the last 10 years. I hate shopping. I really do. I don't do it often. I wear what I have and that's it. But I am getting a little bit older and I could use some new pieces, especially when it comes to like attending a wedding. I can't be dressed in like a whole bag to a wedding.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

I need something, you know, I need a little help, okay? That's why I decided to turn to Stitch Fix. Yeah, Stitch Fix is an online personal styling service that helps your style without the stress. All you have to do is sign up for an account, enter some information about your style and budget, and then you're assigned a Stitch Fix stylist.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

He had just like two toes on each foot, the big toe and the index. So upon the doctor's recommendation, the parents, you know, they had to make a tough decision and they decided to just have Oscar's legs amputated. From like halfway between the knee and the ankle at just 11 months old. You know, the doctor just assured it was going to be like the best option for him.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

Stitch Fix stylists discover personalized pieces just for you and in your size. Thank you so much. Don't send me something that's not gonna fit. Then on top of that, they ship the items straight to your door. Stitch Fix doesn't force a subscription service on you. You can choose to order a box of clothing picked for you by your stylist, or you can just skip. It's up to you.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

Plus on top of that, when it shows up to your house, it's nice because you could try everything on in the comfort of your own home. And then you can keep what you want, and then send back what you don't want, or maybe send back everything if you don't like anything, or maybe keep everything if you like anything. It's really up to you.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

A nice little perk with Stitch Fix is like when they send you the items, they also send like styling tips and tricks, recommendations, outfit ideas, you know, with the items in your box. So you're like, oh, I wouldn't have thought of putting that leather jacket with that skirt. You know, it's just helpful. I'm a visual person. I need that kind of stuff.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

If you're interested in true crime and you like makeup, I would say subscribe because I'm here for you on Mondays. So today we are diving deep into a story that has like all the elements of a Shakespearean tragedy. Oh yes, a world famous athlete, a beautiful model, a brutal crime, and a courtroom drama that really captivated the world.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

If you want style without the crowds, the stores, the harsh lighting, try Stitch Fix. Personal styling for everyone. Get started today at stitchfix.com slash makeup. That's stitchfix.com slash makeup. The defense countered by saying that Oscar's actions were those of a terrified man. A man who felt he had no choice but to defend himself and his loved one.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

They argued that Oscar was suffering from generalized anxiety disorder, which made him hyper vigilant, hyper vigilant. There we go. Also prone to panic. Therefore, this is why He reacted the way he did. Side note, my opinion, I don't know.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

If you are trying to protect your loved one, wouldn't your first response to be like when you heard someone come in, you wake up, you look over, is my loved one there? If they are and I'm hearing a noise, then I react. If I wake up because I hear something, would your response be to just go and not look, right? That part doesn't make sense. And then they're saying like. Look.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

Just because he didn't have his prosthetic legs on. It meant that it wasn't premeditated. But like. I don't know. I don't know. I don't know. Maybe he thought that part through. Maybe he's like, hey, if I don't put on my prosthetic legs, then I can be like, I didn't know. I'm helpless. Just the point of him waking up and reacting and not checking her in the bed, to me, that is suspicious.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

Okay, that's questionable. And she was in that bathroom with her phone. Probably like, fuck, I need to get the fuck out of here. Did anyone look up like what she was searching on her phone? I should have looked that up. I can't remember. I don't remember that being brought up, but. You know, too many questions.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

The prosecution had argued that he knew there was a human being in the bathroom and his intention was to kill That human being. And they were like, look, if Oscar had shot into a cubicle, knowing that there was like a human in this cubicle, then he would be found guilty of murder, right? You can't just like shoot and be reckless about it.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

And because Oscar had said that he wanted to shoot the intruder and not his girlfriend does not change the fact that it was murder. He should be punished for murder is what they're getting at. His plan was to kill who was ever in the room. The media, the public, everyone was very torn, very torn. And then sentencing or the verdict and all that jazz happened on September 11th, 2014.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

Judge Tuko Zile Masipa. Did I do that? Okay. Anyways, but this judge, she delivered her verdict now. very controversial. She acquitted Oscar of murder, citing that he did not foresee the possibility of someone dying as a result of his actions.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

So Oscar was fitted with prosthetics before he turned two years old. And then by 17 months, he was walking. But Oscar's life wasn't all like hardships and challenges. Like things were good. He came from a loving family. His parents, they ended up getting divorced when he was like seven years old. And you know, divorce can be like really tough on kids.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

You know, many disagree with that, because if you have a gun and you're shooting towards someone or at someone, you think the result might be dying, but whatever. Instead, she found him guilty of, quote, culpable homicide, end quote. or negligent killing. The judge ruled that the prosecution had not proven beyond a reasonable doubt that he had intended to kill Reva or anyone else.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

Now, this distinction was crucial in determining his sentencing. On October 21st, Oscar was sentenced to five years for negligent homicide and an additional three years for I guess an unrelated gun charge. His team was trying to get the judge to give him like a house arrest but the judge ruled that he should serve time behind bars to send a message to society.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

Do you think he was doing steroids and that's why he had such a crazy reaction? Sorry, I just now thought about it. Because usually, you know, sometimes steroids are involved. And when steroids are involved, they get crazy, which would make sense why he was like, would be shooting. I don't know. I'm just trying to think.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

again uh the public opinion or their reaction to all this was very mixed some felt that like justice had been served and then others believed that the sentence was like it was it was too kind the debate over whether oscar was a murderer or like a man who just made like a tragic mistake

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

really just continued to rage so the prosecution they were not satisfied with the sentence they were like hey this is way too light and completely inappropriate for the circumstances so then in december 2015 the supreme court ended up overturning the conviction and found oscar guilty God, I wonder if he was doing steroids. Not that it excuses his behavior, but it would make a lot of sense.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

Would it? I don't know, maybe. Anyhow, he's overturned, guilty. The court ruled that Oscar should have like foreseen that firing four shots into a small enclosed space like a bathroom would have lethal consequences regardless of who was behind the door.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

snaps that makes sense right the appeals court handed the case back to the trial court for resentencing so in july of 2016 that same judge judge masipa sentenced oscar to six years in prison for murder just six years just a little sprinkle i think this judge like had a crush on him or something because

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

Technically this sentence, the six years, it was like way below the prescribed minimum of 15 years for murder in South Africa. So again, led to some controversy. People are like, what the fuck is going on right now? Now the judge said because of Oscar's disability and his apparent remorse, this was the reason for the lighter sentence. Judge, I have a question, statement maybe.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

Because like the whole time Oscar like didn't wanna be treated like a man who had a disability. He wanted to be treated like normal. Now's your chance. Treat them like normal. Well, it sounds like it's over, but it's not because the state wasn't done yet. Prosecutors appealed once more, arguing that the six year sentence was shockingly lenient. I mean, it was.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

In November of 2017, the Supreme Court of Appeal agreed and they increased Oscar's sentence to 13 years and five months. So then fast forward to November of 2023, six years after the Supreme Court of Appeal had handed down its final sentence, it was announced that Oscar Pistorius would be released on parole. Now the parole board set his release for January 5th, 2024.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

But for Oscar, I don't wanna say it wasn't bad, because I'm sure it hurt in some way, but like he was lucky that both of his parents remained actively involved in his life. I know, shocker. I was like, wow, rare in these stories, huh? So Oscar would mainly live with his mother And his mom was said to be like strong, supportive.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

Now it said that his parole conditions are strict. He moved in with his uncle in the Pretoria suburb of Waterkloof. There's like a random K in this word, Waterkloof? Waterkloof. Anyways, he moved there. And this I guess is like the same place that he was staying during his trial. His parole conditions include attending therapy sessions,

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

anger management programs and programs on violence against women he's also required to complete community service hours meet regularly with parole officers and be subjected to unannounced visits until the end of his sentence in 2029 now riva steenkamp's mother her name is june she didn't oppose oscar's release but expressed concerns about his

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

huge anger issues is what she said, which she felt hadn't been addressed in prison. I guess she had opted to not attend the parole hearing saying that she couldn't face him again at this stage. Now Riva's father, his name was Barry. He had passed away like earlier that year, but before his death, he actually met with Oscar as a part of like the rehabilitation process.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

We can only imagine what was said. We don't, we don't know, you know, but Oscar Pistorius was quietly released on January 5th, 2024. He is not permitted to speak to the media as per his parole conditions, but his lawyer mentioned that Oscar's parole allows him limited time each week to attend work commitments and church. He must also continue his therapy and rehabilitation efforts.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

and just be a real good boy. It's just so different, huh? Like America versus anywhere else, really. Like they actually, he still, he murdered someone, look, real talk. But like, at least they're like, they put you in a bunch of programs and like trying, I don't know, try and help some kind of way. They do kinda in America, but like, not really. Not really. Maybe it's better there. I don't know.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

I don't think it's better there, but I don't know. What am I getting at? I don't fucking know. What am I even getting at? I don't know. So here we are. Oscar Pistorius is on parole. His career is in ruins. And his life is forever marked by the events of February 14, 2013. Are we supposed to feel bad? He's the one that picked up the gun. He's the one that shot at the bathroom door.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

He's the one that got up. He's him, him, him, him, him. Him. You gotta take some responsibility for yourself there, bud. Okay? You murdered someone. And who, like, really knows? if it was on purpose or not. I think it, I think, I think, I think it, I think it was, I don't know. I mean, it's really unlikely we will ever know like whether Oscar truly intended to kill Reva.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

He continues to maintain that it was a tragic accident saying, quote, I did take Reva's life and I have to live with it. But regardless of whether it was a heat of the moment argument, a premeditated act, or an attempt to protect horribly gone wrong, the reality remains that Rima Steenkamp was killed at the hands of Oscar Pistorius, period.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

I mean, it's a tragedy that's left scars, not just on those directly involved, but on everyone who followed the case, who saw the rise. of this amazing guy, right? And then the fall of this global icon. Well, friends, thanks for hanging out with me today. Purpose, not purpose, huh? Doesn't matter, he's out now, you know? At least he still gets to live. Reva does not.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

You know, she also made sure that he maintained a relationship with his father. There were like no strict rules about visitation with daddy. And all of the kids were encouraged to spend time with, with both parents. So Oscar's parents, they wanted him to spend his kid years in his teenage years, like any other kid his age.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

She had so much going for her too, it's such a shame. Well, guys, I hope you have a good rest of your day. You make good choices. You be safe out there. And I'll be seeing you guys really soon. Goodbye.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

So they sent him to a mainstream school instead of going to like a school for children with special needs. And it was said from a very young age, he developed a passion for sports. So it was said in school that he just threw himself into a variety of activities. from tennis to cricket, soccer, gymnastics, wrestling, you name it, Oscar was all up in it.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

He would even go on to compete in triathlons and he would lift weights with his dad. I mean, nothing was stopping this guy. He ended up getting his very first medal in wrestling. I don't know how, but like, again, nothing was stopping this guy. If you've been following me for a long time, then you know my struggle with the hormonal breakouts along my jawline.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

I've done a couple of YouTube videos on it where I shared like my skincare routine and I showed pictures also of how bad my skin got. Like I wasn't trying to be cute with one or two pimples and being like, oh my God, I'm breaking out so bad, no. my whole jawline was filled with these painful, painful hormonal cysts. And it happens every time I get really stressed.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

And that's when I know it's like, okay, girl, you gotta go outside, touch some grass, go on a walk, get it together. Okay, your body's telling you, you are stressed the F out. So while I am managing my stress, this is when I really, really depend on apostrophe. Yeah. And that's why I'm always so happy to be partnering with Apostrophe, the sponsor of today's episode.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

Apostrophe, if you don't know, is an online platform that connects you with an expert dermatology team to get customized acne and dermatology treatment for your unique skin. So whether you're dealing with mysterious breakouts, signs of aging, or random dark spots, Apostrophe helps you get access to the right treatments for your skin.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

Through Apostrophe, you can get access to oral and topical medications you might need for your skin concerns. To get set up, all you have to do is fill out an online consultation about your skin goals and your medical history, then snap a few selfies and a dermatology provider will create a specialized treatment plan just for you.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

So for me, I hopped right back onto my Apostrophe account and I was like, hey guys, hi, it's me again. Hormonal breakouts are happening, help me out. They send me products in the mail delivered right to my door and it's the same products that my dermatologist recommended to me that I had to drive an hour to go get and then It was a whole process to like get the actual treatment stuff, you know?

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

Today, I'm gonna be talking about Oscar Pistorius, the man who went from being a celebrated sports hero to a convicted murderer. Oscar's story isn't just about like one night of violence. It's a tale of triumph, fame, and a fall from grace that really shocked everyone. So let's start at the beginning.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

So it's so nice to avoid all that and just go through Apostrophe, talk to an expert, talk to a dermatologist, and then get the skincare products I need right at my front door. Right now, we have a special deal for our audience. You can get your first visit for only $5 at apostrophe.com slash makeup when you use our code makeup. That's a savings of $15. This code is only available to our listeners.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

To get started, just go to apostrophe.com slash makeup and then click get started. Then use our code makeup at sign up and you'll get your first visit for only $5. A big thank you to Apostrophe for sponsoring today's episode. Now let's get back to the story. So as a teenager, Oscar attended Pretoria Boys High School. It was an English language boarding school.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

And when he was here, he found himself in like a whole new world. It was the first time he was living outside of Johannesburg. And while he, he definitely had to participate or like endure the typical hazing of a boarding school. For the most part, he was largely like accepted by his peers.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

So Oscar started playing rugby and water polo, you know, very serious sports, especially for someone like, not trying to be mean, but you know, like he had prosthetic legs, but he was making it fricking work, okay? Nothing was stopping this kid. By this time when he was playing these sports, he was using a much lighter hooked shape prosthesis But, you know, these weren't really perfect.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

You know, they often, I guess they broke a lot, which would cause him a lot of frustration, especially when he's trying to like kick butt and then it would break on him. Then at the age of 15, Oscar experienced another life altering event. His mom ended up passing away following like complications from a hysterectomy. Yeah. Completely unexpected, you know? And this was devastating to Oscar.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

His mom was like his rock. She was always there to support him, encourage him. Her death seemed to like... Just leave a major void, you know, that would never be filled. But Oscar, his life, you know, his life goes on. And in 2003, while playing rugby, he ended up like injuring his knee. At first, he didn't like think it was a big deal, right? And he ended up like finishing the match.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

But by the next day, it was very clear to him that something was seriously wrong. So this injury that he got, it didn't require surgery.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

but it did require extensive rehab which included running and water aerobics and it was around this time that oscar started wearing his new prostheses it's called the like the cheetah first of all i was like wow cool it's a different kind of design okay these were like game changers

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

for him and they were the ones that he could he would wear uh throughout his whole athletic career it was like this hook shape i forget what it was made out of but it wouldn't snap like all the other ones would and it was just groundbreaking his first race with the cheetahs was a 100 meter sprint And he ended up clocking in at 11.72 seconds.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

Now his dad was like, holy Toledo, you know, he was so impressed. So he started like looking up, his dad started looking up times that other people have done this. And he realized that Oscar, his time would actually qualify him for a world record in in his Paralympic category. So once his dad and Oscar like realized that, you know, he was good, he was real good.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

right, we always do, with the birth of a baby boy who would go on to be known as the Blade Runner. Oscar Pistorius was born November 22nd, 1986 in Johannesburg, South Africa. His family wasn't the wealthiest by any means, but they were comfortable when he was growing up, like the family lived a decent middle-class life. So when Oscar was born, I guess it was clear from like the start that his life

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

You know, Oscar was about to take the world by storm. So after this first race, I think Oscar, like, you know, he had a goal now. He had a goal. So he threw himself into intense training. He ended up qualifying for the 2004 Paralympic Games in Athens, where he ended up winning silver in the 100 meters and, 100 meter? 100 meters. He won silver. And then he got gold in the 200 meters.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

So he set a new world record. Do you know how hard that is to do? Yeah, you know how hard it is to do. Like what? This guy? He did. He was doing it. He set these new world records. Oscar was not satisfied. He wanted to compete outside of the disabled races. In 2005, he competed in the South African Championships and he ended up coming in sixth in the 400 meters.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

It was like his first race against abled bodied athletes. Sixth place, I mean, that's pretty damn good, right? And like, he didn't stop there. By 2007, he was competing internationally, finishing second in the Gold Gala 400 meters race, which was in Rome.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

But you know, like you win some, you lose some because he ended up competing in another race in Sheffield where he would end up like finishing last. As Oscars fame grew, so did the scrutiny. People started to question like, hey, are his prosthetic legs giving him an unfair advantage? You know, they bounce, feet don't bounce. You know, they're just like looking for reasons to pick it apart.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

In 2007, the International Amateur Athletic Federation, or IAAF, they expanded their rules to ban any quote, technical device that incorporates springs, wheels, or any other element. You know, their reason was like, they believe that it gave the athlete an advantage essentially.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

To Oscar and like a lot of people, it felt like they were specifically targeting Oscar, his cheetahs and like anything like that. The IAAF, they said it was because like there was these new shoes out that had springs in the bottom of them. And they were like, no, no, we did this because we want to make sure those shoes don't make it in to the competition.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

But again, a lot of people thought like, hmm, just seems like it's against Oscar. Oscar, you know, when he heard this, he fought back. He got a team together. He got a team of like scientists together to prove that his prostheses did not give him a fair, unfair advantage. Sorry, unfair advantage.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

So the ruling was essentially overturned, which would allow Oscar to compete, but the controversy really never died down. People really thought it was truly unfair. So despite, you know, the ongoing debate, Oscar made history in 2012 by qualifying for the 400 meters and the four by 400 relay at the Summer Olympics in London. First double amputee to compete in the Olympic Games.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

Pretty groundbreaking, you know? Now he didn't win, but his participation in itself, again, was groundbreaking because he was the first double amputee to race in the Olympic games. Right? So Oscar, he had carried like the South African flag in the closing ceremony. And then he went on to win gold in the four by 100 meters. And he won silver in the 200 meters at the 2012 Paralympics.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

So he's kicking ass. Okay. Just wouldn't seem like Oscar Pistorius was like on the top of the world really. His life took a dark and tragic turn. Reva Steenkamp was born in Cape Town, South Africa in 1983. Now she was stunning. She was beautiful. She was intelligent. She was able to juggle a law degree and be like a successful model. Wow, you know?

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

would be anything but ordinary. He was born with a congenital birth defect known as fibular hemimelia. Try not to laugh, but if only you knew how long I've been sitting here trying to get that word out of me. So basically what I'm trying to say is he was born without the fibula in both of his legs. Now the fibula is kind of important. It's like one of the two long bones in your lower leg.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

By 2007, she had moved to Johannesburg after being chosen as like the face of Avon in South Africa. Avon the makeup company. So she was now the face of Avon. Now at this time, her career was on the rise. She had big plans. She even like applied to the bar in New York. 2011, hoping to qualify as a legal advocate by 2013.

Murder, Mystery & Makeup
World Famous Olympian turned murderer?? Did He Do it or Honest Mistake?

I guess she and her friend had discussed possibly starting a law firm that would be meant to help abused women. So then November, 2012, Reva and Oscar, they ended up meeting. I guess they met through like mutual friends. They were at some kind of car event. They were introduced and they must've just hit it off. Their relationship, like it became public pretty quickly.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

Hi friends, how are you today? My name is Bailey Sarian, and today is Monday, which means it's Murder, Mystery, and Makeup Monday. Today, I'm excited because we have an audio exclusive. Oh yes, this is just for the podcast. This is just for you. I just want to give a disclaimer that today's episode does involve children and infants and death and murder. Hi. I'm sorry.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

She became a nurse attendant at the Bristol Lunatic Asylum in 1871. That was not to last, however. While her name is not listed, records show an attendant who was let go after, quote, being deemed overly aggressive, end quote, with a patient. There was an argument that escalated until said attendant wrestled with the patient, shoving them to the ground. Many believe it was Amelia.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

Amelia was the only nurse attendant not listed as still being employed in 1872, so... If we do the math, we can assume she was the one let go for her aggressions. But not to worry, Amelia had plans outside of her nursing career. In 1872, Amelia, now 35 years old, she met and married her second husband, William Dyer. He was 27 years old and taking a page out of her previous husband's book.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

So she was the youngest of five children, and she was born into like a pretty respectable working class family. She was the daughter of a master shoemaker. Hello. So, you know, she had things to live up to. When Amelia was around five years old, her mom contracted typhus fever, okay?

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

She lied about her age. Amelia said to be only 29 on her marriage license. I wonder if he knew that, but wonder what her skincare routine was. She lied on an official document so much, it's honestly hard to know what to believe. How old was she really? We don't know.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

Anyway, once again married, Amelia was able to retrieve her daughter Ellen and bring her back to live with her and her new husband, William. Ellen returned and would live through her adulthood, apparently never suffering the same neglect Amelia made a habit of with her baby farms. Amelia and William would go on to have an additional two children together. One was a son named William Samuel,

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

and the other, a daughter named Mary Ann, nicknamed Polly. Later in life, Amelia would claim to have given birth 13 times, so it's thought she and William may have had and lost other children during this time. In 1877, William was laid off from his job at the sugar factory. Unfortunately, Amelia figured out a way of making up for the loss of income.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

You know what always surprises me in my true crime deep dives? How often life insurance comes up as a motive for murder. Oh, right, it's always a case. According to Murderpedia, there are over 600 people murdered every year because someone wants to collect life insurance on a person, right? I've personally always avoided dealing with life insurance because it's first of all, why do I need it?

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

And second of all, why is it so expensive? I don't get it. Period. But I know it's important. It's important. You got to protect your family's future. And I feel confident I'll find the right insurance for me with the help of SelectQuote. SelectQuote is one of America's leading insurance brokers with nearly 40 years of experience.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

helping over 2 million customers find over $700 billion in coverage since 1985. SelectQuote can help you in as little as 15 minutes. You'll speak with a licensed insurance agent who can tailor a life insurance policy to your family's needs and also your budget. Head to selectquote.com and a licensed insurance agent will call you right away with the right policy for your life and your budget.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

Selectquote. They shop, you save. So get the right life insurance for you for less at selectquote.com slash makeup. Go to selectquote.com slash makeup today to get started. Around this time in 1877, Amelia began working as a midwife out of her home. We know many of these details from Polly, Amelia's daughter, who would later testify during Amelia's trial. Yeah, there's a trial.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

And yes, we will get into it. Polly talked about how the sounds of a woman in labor were constant in childhood. Many of the children Amelia helped to deliver were declared as stillbirths and documented as such by coroners.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

According to Scotland Yard records from this period, it was thought that midwives knew how to make a baby's death appear to the world like a stillbirth, which would be pretty handy if you knew a lot of desperate women with nowhere to turn. After two years of Amelia's running her midwifery and baby farming business, a doctor finally reported Amelia to authorities.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

So she gets this and she starts to experience hallucinations and other like mental health problems because of the typhus fever. She was going crazy, okay? And she ended up being admitted to a private asylum for treatment. And then eventually her mom, Amelia's mom, would return home. So just because her mom was home didn't mean things were better.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

Too many babies and children had died under her care for it to make statistical sense. And it was catching up with her. When Amelia learned she was under investigation, she immediately tried to commit suicide. She did so by ingesting a large amount of opiates she had been using to keep the infants quiet. She didn't ingest enough, though, and survived the suicide attempt.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

She was put on trial for the death of multiple children who had been under her care, but there was no proof that the deaths had occurred intentionally. Obviously, there had been massive neglect, with the judge even calling her establishment An infant's hell. But that same judge admitted that her incompetence could not be proven as an intentional criminal act.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

At the same time, it would have been unthinkable that a woman was purposely committing the mass murder of children. The jury returned a guilty verdict after only 20 minutes of deliberation. But because intent couldn't be proved, she was sentenced to only six months hard labor. While she was gone, her daughter Polly was told by her father that Amelia was sick and receiving treatment.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

Amelia's first daughter, Ellen, who had been farmed out as a little girl, left town after her mother's trial. She became estranged from the family, which no one can blame her for. In 1880, Amelia was released from prison right on time. Not looking to return to forced labor anytime soon, she actually attempted to earn money through a series of legitimate jobs.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

These attempts included a return to nursing, dressmaking, and laundry services. None worked out. Amelia had begun abusing both alcohol and opium and was unable to hold down a job because of these habits. Not to mention, Amelia's trial was public and received enough attention for songs to be written about it. When she was released, her community was well aware of her past and treated her as such.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

So the Dyer family decided that they should move from their small hamlet to the larger town of Bristol. Here, again, they attempted to make money legitimately, but by 1884, the family's laundry business failed, and Amelia went back to the only job she was able to hold down. Baby farming. Knowing the authorities were aware of her past, Amelia and her family moved often to avoid detection.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

Her husband William didn't enjoy the nomadic lifestyle, and it had a large impact on their marriage. Yes, the moving was a stressor. But the baby murdering? By the early 1890s, William and Amelia separated. I guess Amelia had learned something from her previous conviction. First off, she would no longer report the deaths of the infants to the coroners.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

This meant there was no record of the number of children that were dying under her care. She was then free to kill the children by whatever method she liked and disposed of the bodies herself. She no longer worried about making their deaths seem like stillbirths. So she used varied methods of murder.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

This also helped avoid the crimes coming back to her since no pattern could be established, even if the bodies were found. Of course, in some cases, parents did return to Amelia, asking for their children back. Because these children were overwhelmingly likely to be dead, Amelia would simply take another child in her care. and give them to the parents.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

Since most passed off their children as newborns, they were unable to recognize that the child wasn't theirs. Again, Amelia was able to avoid suspicion. But she remained on high alert. If she felt authorities were making any gains towards catching her, Amelia would simply check herself into the local asylum. she would claim she suffered from suicidal thoughts and receive treatment.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

Once the heat from authorities died down, she would be released from the asylum, claiming to be mentally fit again. Eventually, William decided to forgive his baby-killing wife. and she moved back in with her family. The baby farming business continued to boom. By 1891, suspicions turned once again toward Amelia.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

There was permanent brain damage to Sarah's mind, you know? And so the hallucinations, they would continue and they caused periods of mania. Her speech was also altered and dysfunctional. And then in 1848, Amelia's mother passed away. You know the saying, when it rains, it pours.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

Despite her many efforts to avoid suspicion, Amelia was faced with one mother who demanded her child back. Now, this mother had been a governess and had become pregnant after a relationship with one of the sons of the house she worked in. The governess gave her baby to Amelia with intentions to return. Amelia, of course, killed the baby and moved.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

After the governess ended up marrying the baby's father, her child became legitimate. So she returned with the hopes of collecting her child. but she couldn't find Amelia. Amelia had used a false name and had since moved, making it even more difficult for the mother to find her. The police eventually did find Amelia and questioned her about this specific child.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

She was able to lie and buy herself time. Knowing they'd return, she tried to kill herself by slashing at her own throat. She also claimed to hear voices that both told her to commit suicide and threatened that her daughter Polly was trying to kill her. She even threw a knife at Polly, which stabbed her through the hand.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

Amelia had not only spent time in an asylum herself, but had also worked in one and also witnessed her mother's mental illness firsthand. Because of all that, no one could say for sure whether she was actually experiencing hallucinations and dangerous delusions at this time, or if she was just particularly good at faking them.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

She was also addicted to both alcohol and opiates, so even if they were real, the hallucinations could have been self-inflicted. Regardless, this well-timed mental breakdown sent Amelia back into the asylum. Only a few months later, she was once again considered to be recovered and was released. After only a week at home, Amelia was back to business.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

She took in yet another child in order to have enough money to move her family again. The family moved. When they arrived at their new home, there was no baby in sight. Finally, in 1893, the former governess who was looking for her baby tracked Amelia down. Amelia quickly went out and bought opiates, enough to kill herself.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

She ingested the opiates but once again survived and was admitted back into an asylum. I don't think she was really good at math. She keeps trying to kill herself and like not doing it. After being released from her latest vacation at the asylum, Amelia left her husband William permanently. By this time, Polly had married a man named Arthur, and Amelia left to live with them.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

They moved around often, but somehow still our persistent and impressive governess was able to find her once again, still demanding to know what happened to her child. The governess identified Amelia to police. She was not arrested and spent some months in a lunatic asylum. This one, at least, did seem to leave a lasting impact on her.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

She wrote to Polly, claiming she had lost her soul while under care at the asylum. Or at least, what little of it she had left. This year I'm trying to be better when it comes to keeping track of my automatic payments. Ugh. They always sneak up on me. Listen, recently, you've noticed this.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

I know you have all the notifications coming in saying that all of the streaming services are raising their prices. And I'm like, excuse me, didn't we just do this like a month ago? Please. Bust out the DVDs, I say. I hate these surprise charges. They are overwhelming and I just... I need to take a deep breath sometimes. But thankfully, I got Rocket Money, so this should never happen again.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

And that seemed to be the case for Amelia because after her mom passed away, then her two younger sisters, they both passed away from an illness called I'm making an assumption here, but Amelia ended up leaving school at the age of 14, I'm assuming because she probably needed to help take care of the house and work, but I don't know for sure.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

Rocket Money is a personal finance app that helps find and cancel your unwanted subscriptions, monitors your spending, and helps lower your bills so you can grow your savings. With Rocket Money, you can see all of your subscriptions in one place. Hi, that's great. And know exactly where your money is going.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

And if you find yourself wanting to get rid of a few subscriptions, Rocket Money can help you cancel them. Ooh, love that. And not only that, Rocket Money can send you alerts if bills increase in price or like if there's any unusual spending activity or if you're close to going over your budget that you set. I mean, they got your back. It's super helpful.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

Rocket Money has over 5 million users and has saved a total of 500 million in canceled subscriptions, saving members up to $740 a year when using all of the app's premium features. Cancel your unwanted subscriptions and reach your financial goals faster with Rocket Money. Go to rocketmoney.com slash makeup today. That's rocketmoney.com slash makeup. rocketmoney.com slash makeup.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

While her mom was gone, Polly didn't just lay around. She had a family business to run. She and her husband took out ads themselves, farming babies without Amelia. Of all the children they took in, only one child would survive and continue moving with them from house to house. Soon, Amelia returned and was ready to get back to her dark work.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

But just as she did, newspapers in Bristol began to write stories about the many bodies of infants that were cropping up all over town. Police were once again circling her, and now her many neighbors began to take notice of Amelia's activities. They walked. They talked to police about their suspicions, noting the sheer numbers of babies and unwed mothers that came and went from her house.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

But Amelia, Polly, and Arthur kept moving, leaving police constantly one step behind. By 1896, Amelia had stopped letting babies waste away and just began strangling them instead. That year, a barmaid named Evelina Marmon... placed an ad in a local Bristol newspaper, hoping to find a family to adopt her illegitimate daughter, Doris.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

Coincidentally, Evelina saw an advertisement next to hers for a married couple looking to adopt a child. The name on the ad was listed as Miss Harding. Unbeknownst to Evelina, this was one of the many pseudonyms used by Amelia Dyer. Evelina reached out to Ms. Harding and arranged care for her daughter.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

She hoped to arrange a schedule of week-to-week payments, as it was her intention to go back to work. and earn enough money to then reclaim her child. Amelia didn't agree to these terms and convinced Evelina to pay her a lump sum for the care of her daughter. Miss Harding, aka Amelia, claimed to be a married woman with no children of her own.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

She convinced Evelina that she was not interested in taking a child just for payment, but because she and her husband were fond of children and having one would improve their home. Evelina was heartbroken to be unable to care for her own daughter, but sent her daughter with a box of her clothes to live with Miss Harding.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

But she left school at the age of 14 and she started an apprenticeship as a corset maker. And then sadly, her father ends up passing away of bronchitis. So now she, well, her parents are dead. Some of her sisters are dead. I mean, what the hell is she supposed to do? So she ends up living at a lodging house.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

Evelina received one letter stating that everything was going according to plan with her daughter and sent a response. She would never receive a reply. Amelia ends up taking the girl to the London home her daughter was staying in. There, she used white edging tape to strangle the baby. The tape was normally utilized in dressmaking, which was just one of the many legit careers Amelia had attempted.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

Amelia tied it around baby Doris's throat, saying she liked to watch the babies with the tape around their necks. By the next day, after Doris was dead, the tape was removed and used to murder another child, Henry Simmons. Both bodies were put in a carpet bag, which was then thrown into the River Thames. The clothes that Doris's mother had lovingly sent with her were pawned off.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

Just before the deaths of Doris and Henry, a fisherman found a different carpet bag in the River Thames. This one contained the body of yet another baby. Helena Frye. The girl's body was wrapped in brown paper, on which was the address for a Miss Thomas. This was yet another false name used by Amelia Dyer.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

The police, who by now were aware of Amelia, quickly connected the alias back to her and placed her home under surveillance. They used a young woman to arrange a meeting with Amelia. The woman claimed to want to use her services, and Amelia agreed. But instead of a young mother, the police arrived at the decided time of the appointment and quickly searched Amelia's home.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

In the house, police found a wild amount of evidence. Telegrams regarding adoption arrangements, pawn tickets for children's clothing, receipts for advertising, and letters from mothers checking in on their children. Apparently, of all the evidence, the worst was the smell. There was a stench of rotting flesh coming from the kitchen pantry and a trunk under Amelia's bed.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

Confident they had discovered a baby farm, the police quickly dragged the river Thames, looking for more victims of Amelia Dyer. More bodies were discovered, including those of Doris and Henry. Evidence showed at least 20 children had been placed under Amelia's care in the last few months alone.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

Police estimated that over the course of the decade she participated in baby farming, Amelia Dyer would have had access to somewhere in the realm of 400 infants and children. So while the only crimes officially linked to her belonged to the six bodies found in the river, this is why her actual victim count is considered to be in the hundreds.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

Due to overwhelming evidence, Amelia was promptly arrested, along with Polly's husband, Arthur as an accessory. Amelia was quick to confess, stating, You'll know all mine by the tape around their necks. Like, oh, okay. This may have been a final effort to avoid at least some of the punishment she deserved, since for years she had used opiates to kill the infants in her care.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

Maybe that was the only choice she had left once her asylum method would no longer work in her favor. Somehow, there was not enough evidence to charge Arthur or Polly as accomplices for the crimes. Amelia, however, gave a written confession, but only for the murder of Doris Marmon. She also did not implicate her daughter or son-in-law. Arthur was released while Amelia appeared at the Old Bailey.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

She tried to plead insanity, pointing out her numerous trips in and out of the asylum. While in custody, Amelia used a lot of religious rhetoric, prophesizing to other prisoners. and hoping she would be forgiven for her crimes by God. These hopes can be seen in the letter she wrote prior to her trial.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

And I know this might be dumb, but whatever, I'll be dumb because I was like, what's a lodging house? So I Googled it and I'm just, I'm here for you if you're like me. A lodging house is a Victorian-era term for a form of cheap accommodation in which the inhabitants are all lodged together in the same room or rooms, whether for eating or sleeping. You're welcome.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

Her defense team tried to use her letters as evidence, but the prosecution pointed out she had done this act before, using her trips to the asylum to avoid detection when police were getting too close had become a hobby for her. Polly testified against her mother, detailing one of the murders.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

but also being sure to say both she and her husband didn't participate or even fully realized what had happened to the babies in Amelia's care. She claimed Amelia told them both the baby was sleeping and shooed them away when they tried to see for themselves. She also brought up her mother's delusions and confirmed her many, many, many, many trips to the asylum.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

The defense also cited her suicide attempts and difficult childhood, with her being witness to the horrible death of her mother as evidence that she was mentally unwell. In the end, the trial lasted only two days. The jury declared her guilty in five minutes, shattering the previous 20-minute record of her first trial.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

This time, her luck had finally run out, and instead of hard labor, she was sentenced to death. While waiting for her sentence to be enacted, Amelia wrote a last and true confession. as well as several poems. Only one poem survives, and it reads, By nature, Lord, I know with grief, I am a poor fallen leaf, shriveled and dry, near unto death, driven with sin, as well with a breath.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

But if by grace I am made new, washed in the blood of Jesus, too. Like to a lily I shall stand, spotless and pure at his right hand. It was signed Mother, because sometimes real life is a horror movie. Amelia Dyer was hanged on June 10, 1896. When prompted for her final words, she said, I have nothing to say. Apparently she thought the poem said it all.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

At the time of her death, Amelia was the oldest woman to be executed in over 50 years. In the wake of Amelia's crimes, the Children's Act was passed in the United Kingdom in 1908. It required legal registration for foster parents and allowed authorities to have additional powers to protect children in the foster system.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

This helped stop people from taking advantage of the system the way Amelia Dyer had. Let's not forget about Ellen, huh? After this law, it became significantly more difficult for a foster family to up and disappear after gaining charge of a child. Between 1917 and 1918, multiple societies were created to help ensure that children would only be adopted by respectable people in stable homes.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

Even with these organizations, which attempted to ensure baby farming would become a thing of the past. It wasn't until 1926 that child adoption became a legally regulated act in the UK. Prior to that, adoptions were all informal and secretive, largely because of the shame that led to adoption being necessary in the first place. In the mid-1800s,

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

The government created laws that were intended to reduce the amount of children born outside of wedlock and therefore lessen the need for services like foster care or adoption. Instead, they managed to help encourage a business model that relied on the deaths of children.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

Baby farming preyed on women when they were out of options and led to the death of more children than we'll ever be able to fully account for. Amelia Dyer was convicted of only a small fraction of the crimes she committed. But at least she was convicted at all.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

So she is at this lodging house and this is where Amelia meets another boarder who was a tradesman just like her father and her brothers. This guy, his name was George Thomas. He was a 57 year old widower whose wife had just died, I guess like a few months earlier. Look, it's the 1800s. So, you know, 24 year old Amelia naturally marries this 57 year old guy named George.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

Her mentor, Ellen Dane, managed to live the rest of her life in the United States and avoided being punished at all for her role in baby farming. All of the changes to the laws in the UK only started over 10 years after Amelia Dyer was hanged. But prior to her case, the general public couldn't imagine the mass murder of children. That's why she received such a light sentence early in life.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

Because of this, she was able to continue her horrific crimes for decades to come. But the grisly details of her crimes helped bring to light the horrible practice of baby farming. And eventually... change the law in an effort to protect more children. And that, my friends, is the story about Amelia Dyer and baby farming, essentially.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

Unfortunately, this is just one story in the grand scheme of many people who were baby farming at this time. She wasn't the only one. she was the one who got caught. And luckily she did because of that, all of these laws came from it. But you know, it's just so sad. It's weird because she cared so much for her own children.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

You just think she would have that natural mother instinct when it came to these other children. But maybe it doesn't work like that. I don't know. I don't have children, so I don't have that mother's instinct. But I would assume you would care for other children too, but I guess that's not the case. I am uneducated in that field, so I apologize there.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

I want to know what happened to Ellen Dane because you know she continued doing some shady shit. What a basic white name too. Because it's like if I google that and try and go down a rabbit hole to see what happened to Ellen Dane. Like do you know how many Ellen Danes there probably are? How am I going to find her? Because watch me.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

Watch me go down a rabbit hole as soon as I'm done recording this. rabbit hole i'm making a note anyhow i would love to hear your thoughts would i though not really this story sad i mean a bunch of babies died who knows how many i was gonna say this one's kind of tricky because look at the end of the day i think we can all agree killing babies is not it Right? Okay, great.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

I'm glad we can decide that. But at this time, these women didn't have any options. If you got pregnant, you had to have these babies. And financially, you were so fucked. Like, what were you supposed to do? I'm not saying kill the baby, but you would just drop them off and probably never look back and just hope for the best, right? I don't know. Anyhow, it wasn't that fun, you guys.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

Well, we laughed, we cried. I'm just kidding. That was awful. uh let me know of any murder mystery and makeup suggestions you may have but other than that i hope you have a good day you make good choices and you be safe out there and i'll be talking to you guys later goodbye

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

It was only five months after the death of his wife when George and Amelia got married. Which some people are like, it's a little quick. And then they actually lied on their marriage license saying that George was 48 years old and Amelia was 30. I guess, you know, back then, even back then in the 1800s, people would have thought that this was a little gross.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

So listener discretion is advised. Today we're going to be talking about Amelia Dyer. Have you heard about her? Because I didn't. So let me tell you about her, okay? So she lived in the late 1800s, and if the estimates are accurate, she killed as many as 400 infants and children over the course of her life. Yes, you heard that number correctly, 400.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

Maybe she was a little too young for him. With the new year, I thought it'd be best to just, you know, clean out my skincare little drawer that I have and get rid of all the products that have just been sitting and I know I'm never gonna use, okay? Yeah, you know nothing? I just, ugh. But afterwards, I was feeling very accomplished. So I cleaned out my drawer. I got rid of everything.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

And now that my drawer is empty, I was like, okay, back at square one. And now I just don't have skincare. But that's why I love Apostrophe, the sponsor of today's episode. Apostrophe is an online platform that connects you with an expert dermatology team to get customized acne and dermatology treatment for your unique skin.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

Through Apostrophe, you can get access to oral and topical medications that use clinically proven ingredients to help address whatever skin concern you have. Getting started is really simple. All you have to do is fill out an online consultation, then you snap a couple of selfies, and a dermatology provider will create a customized treatment plan just for you and your skin needs.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

And you guys have heard me talk about Apostrophe for years now, okay? And I love it. I love how convenient it is. I can sign up, have my appointment, and get my tailored treatment plan all on my phone or just my laptop. And plus, everything gets shipped to you, okay? So you don't even have to leave the couch. You don't have to go to the doctor's. You don't have to go to a dermatologist's office.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

It's the best. Right now we have a special deal for our audience. You can get your first visit for only $5 at apostrophe.com slash makeup. When you use our code makeup, that's a savings of $15. Okay. This code is only available to our listeners and to get started, you just go to apostrophe.com slash makeup. Okay. And then you click get started.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

Then use our code MAKEUP at signup and you'll get your first visit for only $5. It's so worth it. So worth it. A big thank you to Apostrophe for sponsoring today's episode. Now let's get back to today's story. So one thing you should know is that back in the 1800s, there was a problem. Too many people were having babies outside of marriage, okay? They did not like this.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

In order to try and discourage people from having illegitimate children, the, quote, Poor Law Amendment Act was introduced in 1834. This law did a few things, but one of the biggest was to remove financial obligation from the fathers of illegitimate children. So it was pretty much saying that if a man was to father a child outside of wedlock,

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

he was not forced by the law to provide any financial support to said child. The idea being that if women were left without the option of financial support, they would be more likely to marry before having children. I know, this is like, that's fucked up. In reality, all this law did was make it easier for men to just up and disappear. They really didn't see that coming, I guess.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

So yeah, they would just disappear, leaving the mother, you know, the mother of their child with very few options. You are so fucked if this happened, okay? Orphanages, they did exist, but they would only take in what they called, quote, respectable orphans, end quote, meaning the fathers of the children had to be officially documented as dead instead of just being out of the picture.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

So these poor women would either starve to death themselves or choose to, quote, make an angel of their baby. So this legislation, which was supposed to lower the number of children born outside of wedlock actually caused a sharp increase in the rate of moms killing their babies. Okay. Listen, some, and like, look, some mothers would attempt to make it look like an accident by smothering the baby.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

Again, these are estimates, but she was convicted of killing six. So it's between six to 400, the number's in there somewhere. And honestly, I think we can all agree that killing six alone is horrific in itself, right? Okay, thank you. I'm glad we agree. A lot of witnesses and neighbors at the time think that police only scratched the surface of what this woman did.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

They could. claim that they had accidentally rolled on top of the baby in their sleep. Other times the baby would be abandoned in public. These women, they did not have many choices. It's sad. It's just all around sad. I think we can agree on that. So with all of that being said, going back to Amelia. So remember Amelia and George, they got married and they're living their life.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

And Amelia meets this woman named Ellen Dane. They all somehow are living together. Look, I'm not gonna get into it because I don't know. I couldn't figure it out. But just know that Amelia meets Ellen and Ellen really changes Amelia's life. Ellen introduces to Amelia something called baby farming. So baby farming, it sounds, I don't wanna know.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

When I first heard the word baby farming, I didn't wanna know. I was like, Bailey, Go no further. So with all these new unwanted babies out there, families are adopting or fostering these children when the mothers were unable to care for them. But at this time, it came with a catch. The mothers would pay for the care of their babies.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

So like you would give your baby away, but then you'd be paying them. So this is what Ellen did. She would take in pregnant women and then like once they were beginning to show and then she would provide care for them throughout their pregnancy. This would allow the women to maintain secrecy in society and not become known as an unwed mother.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

So you'd be hiding out for like nine months because you didn't want people to know that your ass was pregnant and not married. Wild times, huh? Anyway, so you'd be hiding out with like this Ellen chick. And then once the baby was born, the midwives would accept payment for the continued raising and care of the children. So there were arrangements you could make with midwives

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

these midwives like Ellen, where you could pay a large upfront fee or you can pay in installments. And a lot of the times, like with these installments, the family was agreeing to raise the child for a certain period of time. Like, okay, you're gonna have Susie for six months and then I'm gonna come back and like, I'm gonna...

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

take her back essentially, or something like that, or maybe five years, I don't know. But usually there was some kind of like set period of time that they would have the kid. This all started out with good faith, but soon people like Ellen realized how much money could be made, especially with those upfront fees. She's like, cha-ching.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

A lot of the time, if the mother was paying an upfront fee to these midwives, it usually meant that the mothers were not coming back Okay, so Ellen is like, okay, I can just take this lump sum and, you know, who's checking? Who's checking up on me and who's checking up on these kids?

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

Her plan was that she would simply collect the money the mother was offering and then neglect the infant or child until death. This way, all the money would go straight into her pocket and she, you know, not towards the baby. This is where the term baby farming comes from. People would start adopting babies for profit, farming them like crop of potatoes or something.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

And just like with a regular farm, the larger the crop, the more money you make. Unfortunately, these shady practices were able to thrive because mothers, like the original mothers, were not often willing to contact police or authorities. I mean, even if they knew their child was missing or dead. So Ellen would advertise her services in newspapers using a fake name.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

So take a journey back with me to Victorian era England, a time when young women were vilified and the government did nothing to help them. Amelia Dyer, she was born in 1838 in the southwest of England in an area called Pye Marsh. I believe it's Pye Marsh, okay? But this was like, I don't know, a little small town, a mining district, one would say, but it was near Bristol.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

And then when the babies were in her care, she would continue collecting payment, but she would neglect the children by providing them little actual food, often cutting their milk with things like chalk.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

Then, to keep the starving babies from crying, she would give them a helping of Godfrey's Cordial, which is this medicine, quote-unquote medicine, which was marketed as a way to calm babies during teething or if they were sick. But the ingredients were ginger, sugar, aniseed, licorice extract, and opium. A healthy dose. of opium. No wonder the baby stopped crying.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

Of course, this product was intended to be used in small quantities, but that didn't stop Ellen from using Cordial to aid in slowly neglecting babies to death. Ellen continued these practices for years until she realized the authorities were beginning to figure out her murderous ways. When she felt like they were getting too close, she fled to America and avoided being prosecuted for her crimes.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

With Ellen in the wind, you'd hope the babies of Bristol would be safer. But unfortunately, before she fled, Ellen deigned. had already passed along the tricks of her trade to Amelia Dyer. A couple of years into her marriage to George, Amelia started studying to become a nurse at the Bristol Royal Infirmary. But in 1864, she was forced to quit working when she became pregnant.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

Her daughter, Ellen Thomas, was born in 1864. Yes, she named her daughter Ellen, maybe because it was a super popular name at the time, or maybe because... She was really influenced by that friend of hers who was a baby killer. The one we were just talking about. I'm not sure who can say. But Amelia's life took another turn for the worse when her husband George died in 1869.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

George died of diarrhea. That's what was listed on his death certificate. diarrhea. After this, Amelia was forced to quote unquote farm out her then five-year-old daughter Ellen, meaning she was going to have to give her baby away to one of the baby farms. Now with her daughter being taken care of elsewhere, Amelia decided to open her house to baby farming.

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

So she farmed out her own daughter, and now she was being paid to neglect the children of people who were in the same situation as she was. It's both confusing and...

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

fucked up i'm not trying to justify her actions rather than like explain remember her husband died she's on her own she has to take care of herself and she learned from ellen how to make good money by doing this baby farming thing maybe she gave away her own daughter ellen because she didn't want to kill her own daughter so she was hoping her her daughter ellen would go on to have a better life but then she was in turn taking in other people's babies and then

Murder, Mystery & Makeup
Caregiver to Killer: Amelia Dyer & The Dark World of Baby Farming

killing them, so this woman is so backwards. Anyways, Amelia, she did learn from the best, Ellen, and she advertised her services under a fake name, She charged between 10 and 80 pounds for the care of a child, which is the equivalent of between $1,200 and $9,000 in today's money. Since she was neglecting these children, Amelia still had enough time in her schedule to return to work in nursing.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

Hi friends, how are you today? I hope you're having a wonderful day so far. My name is Bailey Sarian and welcome to the Murder Mystery and Makeup Podcast. Today we're going to revisit one of the most infamous true crime stories I've ever covered. The story of Charles Manson and the horrific murders carried out by members of his cult in the summer of 1969.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

It was owned at the time by an 80 year old half blind man named George Spahn. So they find this place, they think it's perfect, great, the whole gang moved in. Great location for a cult, honestly. So soon after, a woman by the name of Leslie Van Houten, she joined the family and they all stayed in that old torn down movie set, Spahn Ranch.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

If you're interested in true crime and you like makeup, I would highly suggest you subscribe because I'm here for you on Mondays. This week, I fell down a huge rabbit hole with this story. My brain has turned to mush. I never want to talk about Charles Manson ever again. Ever again. There are so many layers to this damn story. There is so much to this story. I am so...

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

It was said to be all like fun and innocent, they spent time play acting movie roles, kind of like summer camp with your friends. So it was said when they were there, it was like time didn't exist, there was no time. They were all just living in the moment, the now.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

They would pretend every day was Halloween and they would dress up in costumes, play different roles, and it was just a way for them to get out of themselves, let their ego go and their world views. And by removing their egos, it would allow Charlie in and change their views on the world.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

Charlie would tell family members that society was corrupt, and that they needed to forget everything they've ever learned. If I can talk. Charlie would tell them that he was the noble one, the one with all the answers, and only he knew the truth. So the family, they would drop acid all the time, and they would do different exercises together while tripping balls, you know?

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

He would make everyone sit around in a circle, and he would be in the middle, He would have everybody focus on him. He was the focal point. He would also tell them to get rid of their past, forget their mothers and fathers, and that they needed to die in order to be rebuilt. Some of the members said that, it's funny, we can laugh, but it's not funny.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

Well, it is funny because some of the members said that like he even reenacted the crucifixion while they were on LSD. And because they were tripping, it was like, oh my God, Jesus is melting. That's Jesus, bro. So this group, they're cut off from society in the middle of nowhere, doing drugs every day with the same people. Brainwashing seemed to happen.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

Charles, his philosophy was the notion of oneness and the power of love. But over time, he got more and more paranoid. His messaging would become darker. There was no right or wrong in life. Death and life were the same thing, not to fear it. Death was actually a welcoming to a better life. This is what he's telling them.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

It was said it got to a point where Charlie stopped letting anybody leave the compound without his permission. They weren't allowed to listen to any music except for the Beatles, the Moody Blues, or Charles' own music. In 1966, there was like a bunch of riots going on, protesting against the war in Vietnam.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

So Charlie was following this, but wouldn't allow his members to know about what was going on. But he seemed to be becoming paranoid that there was going to be a race war happening soon. Now this is where things get tricky, and people have different versions for what happened next. There's the Helter Skelter version, which I'll explain.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

And then there's like the drug deal gone wrong version that I personally think is what really happened. I don't think the Helter Skelter doomsday cult thing was a thing. I'll explain. I know, controversial. Oh my God. So July, 1969, one of the followers was Tex. His name was Tex, remember? Okay, cool. So he was also a drug dealer while living on the ranch.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

It was said that Tex went to go to a deal with another dealer named Bernard Crowe in Los Angeles. Tex was buying a lot of drugs from this guy, like $1,200 worth. Tex didn't have all of the money, but he told Bernard, hey, I'll take the drugs, get the rest of your money, and then come back and pay you. Because you know that always works. Bernard was like, how do I know you're gonna come back?

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

And Tex was like, here's my girlfriend, I'll have her stay with you, she'll stay here with you as collateral. He agrees, and then Tex takes off. Tex never comes back. Yeah, I know, what a douche. So his girlfriend is probably like,

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

And then like 12 hours go by and she's like, yeah, maybe he got sidetracked or something.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

So some time passes. Bernard still has the girlfriend hostage, mind you. And then he calls up Tex. Now Tex, his real name was also Charles, but everyone called him Tex. So Bernard calls the number to reach Tex at the compound or whatever. Bernard asked for Charles because he means Tex, but it was actually Charles Manson that was on the other end, yeah.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

I felt like I was losing my mind at some points, but I'm here. So I don't know how long this is gonna be. I'm gonna try and keep it short because editing is a bitch, but I did like simplify it as much as I could. There's a lot of names that are gonna be thrown your way. So get ready, get ready to catch them. You get it.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

So Bernard is like, I want my money, where's my money? Bernard then said that if he didn't get his money, he was going to burn down the ranch and rape all his women. So Charles Manson then decides to take Madison to his own hand, he goes down to meet with Bernard, walks in, they fight, Charles shoots him, Charles grabs the girl and then he leaves him behind.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

Bernard actually survives, but Charlie doesn't know that, he thinks he's dead. Charlie starts to get really paranoid because he believed that Bernard belonged to the group Black Panthers, and that they were going to come after him and his family for what he did. I mean, this guy Bernard was like a bigwig drug dealer. Once someone got word, it was like, it was gonna be over for him.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

So Charlie starts warning the family members that the Black Panthers are going to kill them, and that they need to learn how to fend for themselves. but he's just getting really paranoid and hopes that nobody finds out what he did. He decides that he needs to get the family members to commit crimes and then make them complicit in the crimes that he had committed.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

I feel like criminals always over complicate things. That's just a personal opinion though, but I feel like it's very true. Do you guys remember the, where in the world is Carmen Sandiego? The game and then also like the TV show. Oh, I loved it. It also made me feel really dumb because I could never figure out where she was.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

But I loved how fun it was to like follow Carmen on all of her like secretive journeys and kind of like solve the mystery. Constant theme in my life, it seems how I really like solving mysteries. Anywho, one of my favorite mobile games that gives me kind of that same feeling as like, you know, the whole Carmen Sandiego thing, it's called June's Journey.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

Now, if you've been a viewer of mine or a listener or whatever for a long time, you know that, man, I was all about June's Journey for a minute. Like really. Yeah. Yeah, and now I'm back in it, okay? So listen, this game, it's a mobile game, okay? And it's all about using your like observational skills to find hidden clues and uncover dark secrets.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

The main character of the game, her name's June, she's on a mission to uncover the truth behind her sister's mysterious death. You step into her shoes as you uncover like shocking family secrets at the sister's estate. Yeah, they got like money. And I'm like, what is going on here? The game is like said in the 1920s. So essentially you're looking for hidden objects in these really gorgeous scenes.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

Visually, this game is really beautiful. It's so fun. I love gathering clues along the way because each clue in the game actually brings you closer to the truth. Oh, June's journey, I get it. It is a journey. It's so fun. And each chapter reveals just like, ooh, juicy mysteries and interesting new characters. I sit on the toilet and I just play, baby. I really do.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

So in the game, you can like collect scraps of information to fill your photo album. And then you start learning about all the characters, you know, just to like solve the mystery. Plus I was a little late to this party, but there's like a whole community around the game.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

I had to simplify it a little bit as best as I could without losing the overall. Charles Maddox was born November 12th, 1934, so he's a Scorpio, in Cincinnati, Ohio, to his mother, Kathleen Maddox, who was just 15 at the time of his birth. Charles wouldn't have a relationship with his biological father. His mother, Kathleen, she ended up marrying a man by the name of William Manson,

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

So you can join a detective club within the game to chat and play with other people or compete in the detective league is what they call it to test your skills against, you know, fellow sleuths. Oh, it's so fun. I like to do it just to be like, I got it before you. I was right.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

June's Journey just lets you escape reality for a bit and join just a really visually exciting world of murder, mystery, and romance. Listen, can you unmask the truth? Well, download June's Journey for free today on iOS and Android.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

Due to his growing paranoia that the Black Panther group was coming after him, Charles enlisted a motorcycle gang called the Straight Satans for protection over the compound. In exchange for protection, Charlie promised him, or them, all the girls they wanted. Here's where I'm going to throw some names at you, but it's fine. Just follow it. So one day the biker guys wanted drugs.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

They want to do some drugs. And one of the family members, his name was Bobby, he said that there was a guy named Gary Hinman, who would be able to supply them with some goods. So the biker guys give Bobby some money, and he goes and he gets drugs from Gary. So the biker guys, they do the drugs, afterwards they're pissed.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

They're pissed because the guys from the Straight Satans said the drugs were bad, and they wanted their money back for being ripped off. These guys were growing more and more angry, threatening to kill people if they didn't get their money back, so Charlie told Bobby and two other family members, Mary Brunner and Susan Atkins, to go with Bobby.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

and get the money back from Gary Heineman because he didn't want any problems with the biker guys. Like you didn't wanna be on their bad side. Charlie already believed that the Black Panthers were after him. He didn't want the straight Satans after him either. So the three of them head out and when they get to Gary's house, they have like a gun and stuff. They're threatening him.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

They're like, we want our money back. The drugs were fake, whatever. Gary refused to give them the money back saying that the drugs were good and he didn't even have the money because he already spent it. And then things seemed to escalate, escalate? Things escalated and then Bobby, Mary and Susan stayed at Gary's house for like two days. They had him tied up.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

They're trying to reason with him to give up the money or give them something valuable that he could give to the straight saints in lieu of the money. At some point, there was like a bit of a struggle that happened, and one of the girls ends up calling Charlie Manson to let him know that Gary wasn't cooperating, and then Charles was like, okay, be right there.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

Bobby regained control, and then soon after, Gary agreed to sign over his cars, which were worth about a thousand dollars. He could use the cars and the little money, so they're making this agreement, cool. Then... This sounds like a cheesy movie, but this is, yes.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

Then Charlie comes busting through the door, he has a confederate knife, busts through the door, cuts Gary across the face, starts threatening him. Bobby was like, okay, that was really unnecessary, you know, but what do we do now? We can't just let him go, he'll rat us out. Bobby ends up killing Gary because that was really his only option. So he takes the knife and he just kills...

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

So before leaving Gary's house, Bobby wrote on the walls in Gary's blood, he drew a Black Panther paw print along with the words political piggy. And he did this because it was recommended to him by Charles Manson, because he wanted to throw off investigators and make them believe that the murder was related to the Black Panther.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

tying back to the Bernard Crowe shooting, like maybe they would tie those two together. Not long after though, Bobby was pulled over and arrested in one of Gary's cars, and he was being charged with the Murdy, Murdy? And he was being charged for the murder of Gary Hindman, because he did it, yeah, you know? So yeah, it makes sense. Bobby was a family member though, okay?

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

The group stood up for their family members. So when he was arrested, Charlie started getting really paranoid that things were gonna lead back to him. He knew that they had to get Bobby out. So the group decided to kill again. They would stage it to look like a copycat murder, leading investigators to believe whoever

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

did it also probably committed the Gary Hinman murder, which meant Bobby wasn't involved because he was in jail. So it would make them think that they had the wrong guy and then Bobby would be set free. Flawless plan, totally makes sense. Nobody will know. Again, criminals always overcomplicate things, but this is what they're thinking.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

So back at Spahn Ranch, Charlie and Tex, they were like trying to come up with a plan. Who do we hate that we can kill and create like this copycat scene? Hmm. Terry Melcher. Remember the music producer? Yeah. So Charlie had been to Terry's home at one point when they were living with the Beach Boy. So he knew where Terry lived. August 9th, 1969.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

In a big old house on Celio Drive in Los Angeles is where actress Sharon Tate, who was eight months pregnant, and her movie director husband, Roman Polanski, were renting Terry Melcher's home. Talk about wrong place, wrong damn time. Now on this night, Roman was in the UK and Sharon was at home with her friends having like a little get together, just hanging out.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

Along with Sharon was her ex-boyfriend or fiance and friend, hairstylist Jay Sebring, iconic hairstylist. Also coffee heiress, Abigail Folger was there. Yeah, Folgers in your cup, queen. Yeah, she's there. Abigail's boyfriend was also there, Wojciech Frykowski. He was there too. There was also a man named Steven Parent who was visiting the home, taking care of the property.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

about four months before she gave birth to Charles. So Charles took the name Manson. Then when the couple separated in 1937, Charles kept the last name. Tarnished that name. That's for sure. As a way to make money, Kathleen worked as a sex worker and participated in petty crimes. It was said that Charles' mother wanted nothing to do with him.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

So the family members, Tex, Pat, Linda, and Susan, get into the car and they drive out to the home. Charles tells them to do everything that Tex says, but doesn't tell them like what it is they're doing, except for Tex, he's the only one that knows.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

When they arrive late at night, Tex went onto the property first, that's when he came across Steven Parent, who was like literally in his car, like it looked like he was just put the keys in or something, because he was about to leave and go home. Poor Steven, he was shot by Tex four times.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

So then after that, Tex goes back to the car and told the girls like, come on, come with me, we're going inside now. Tex was able to get into the house through an unlocked door and let the others in. And then in the living room, Tex was trying to deal with Jay Sebring, who he came across first. And he had him on the floor, he was trying to tie him up.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

Tex asked Susan to go and check the back rooms and like bring everyone into the living room. So Tex and Jay are in the living room and they're starting to fight because Jay's trying to run away, escape, but sadly Tex shot him and killed him. It was said that Tex was the one who killed most that night, but like they all participated in their own ways. It was just a really gruesome scene.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

There was blood everywhere. Everyone was brutally murdered. It was just horrifying. Then in Sharon Tate's blood, there was the word pig written on the front door. They were trying to tie it back to the previous murder. In total, the victims had been stabbed 102 times and they had gunshot wounds. So it was like a little much, like they're dead. We get it.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

Now, many believe that this was some kind of satanic ritual type of killing, and when the media got a hold of it, it was a massive story. Hollywood was terrified. Celebrities were thinking that someone was gonna come to them and kill them next.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

It's believed Charlie had the family members involved in the Tate murders to prevent them from talking to police about the Bernard and Gary murder, because now their hands were dirty too. So they were hoping that back at the crime scene, the police would be making the connection between the two murders. Unfortunately, the police never made that connection. They didn't connect the two.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

So great plan, worked great. So the next night, another murder was in the works. This time it would be at the home of a grocery company executive named Leno and his wife, Rosemary LaBianca. Now this was being like a very different section of Los Angeles. This night though, Leslie Van Houten, she went along to like prove her loyalty to Charlie and the family.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

She said that before going, she knew people were gonna die, but she like wanted to prove herself. Charlie, Leslie, Pat, Tex, Linda, and Susan all crammed into a car and they drove around for a while before they stopped at the house that they were gonna hit next. Charles went in first and tied up the LaBiancas, then he left.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

So the rest of the gang, they came in, they're struggling with the LaBiancas. The two girls were going to kill the LaBiancas, but I think they chickened out and they asked Tex to come in, kill them. So he killed the husband and wife. And then the girls took the knives and stabbed them and like cut them up and carved in their body because Tex said that they needed to do something.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

Again, it was a pretty brutal and awful scene. Anything bad you can imagine, that was it, okay? That was the scene. It was not nice. The Lapiancas had been stabbed a total of 67 times. Once again, they used their blood and they wrote death to pigs, rise, and helter-skelter on the walls and the fridge. Helter-skelter, which they spelled wrong, first of all.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

was referencing the Beatles song Helter Skelter from the White album. The only thing that they were allowed to listen to on Spahn Ranch. Charles believed the music incited a race war and murder. Because the Beatles were huge, they thought that investigators would make this connection because they are trying to make it look like a copycat murder. So they wrote in the blood again.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

That at one point when he was a baby, his mom tried to sell him, as a baby, to a waitress in return for a pitcher of beer. To some people, that's considered a fair trade. In 1939, Kathleen was sent to prison for five years for armed robbery. And during this time, Charles was sent to live with his aunt and uncle in West Virginia. If I call him Charlie and Charles, just know it's the same person.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

They'll connect it with the Sharon Tate ones. Sharon Tate connects to the Gary ones. Gary one leads back. to the drug dealer. So it was said that the reason they killed again was because they didn't realize that the Tate murders were going to become so big, because it wasn't supposed to.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

It was just supposed to be Terry Melcher there, but it was all over the news and everybody was talking about it and that wasn't the plan, so they needed to hit again. The reason that Charlie picked the LaBiancas home, because it may seem super random, but it wasn't random, Not at all. Nay nay. Like mentioned earlier, Charlie, he held a grudge and he never forgot when you did him wrong.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

The LaBiancas, they lived next door to a guy named Harold True. We don't need to know him, but he was there. Harold was a friend to Charlie and the family. They actually stayed at Harold's house for a bit of time. The family, again, they like moved in to Harold's house and were living there for some time. But I guess they were causing a bit of a ruckus and the neighbors called the cops.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

which led to Charlie and the family having to move out. Who were the neighbors? The LaBiancas, of course. That's why he decided to kill them that night, because he remembered that, and because they needed another copycat murder. Also, Charlie remembered that the LaBiancas liked to gamble and had lots of money. Money that he needed to pay back the straight Satans. That's his plan. Thank you.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. These girls were like loyal to him, they were like, he is everything to us. And they just did everything that he said.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

Whatever. Charlie seemed to bounce around a lot. He didn't really have a stable home, but he would visit his off-the-grid uncle who lived in the Kentucky mountains from time to time. This uncle seemed to have like a lasting impression on Charles, okay? This uncle, he was an outcast and would tell Charles not to go to those schools because they brainwash kids and stuff. You know, that uncle.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

Now I want to reshare this with you guys because there's a new documentary that just came out on Netflix that offers some very intriguing theories on what could have been up with old Charlie and his followers. It's called Chaos, The Manson Murders. Did you watch? It's crazy how after five decades, people are still so fascinated by Manson and his cult.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

But Charlie said that he really liked him. He was different. He was off the grid, man. When Charlie was nine, he tried to set his school on fire, and that's when they sent him to reform school. Between 1942 and 1947, Charles' mom, she was out of prison, and he would stay with her, which he said was like one of the happiest times from his childhood.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

Then she couldn't and she wouldn't take care of him anymore. And then she was arrested again. She wasn't able to put him in a foster home. So the court stepped in and placed him in a school for boys in Indiana. The school was very strict and often abused the boys. And after about 10 months, he ran away to find his mom. But she really wanted nothing to do with him.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

I just don't want that to get lost, because I think that's very true. So they go to prison, goodbye. Now in 1972, the Supreme Court overturned the death penalty. So sentences were turned into life imprisonment. Charlie said at the end of the trial, all they really accomplished was sending him right back to where he started. And he really wasn't wrong there.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

Now, throughout the years, most of them have done interviews behind prison walls or whatever, where they have showed great remorse for what they've done. Except for that one girl, she was like really weird. Was it Susan? I think it was Susan. I think as they got older, they just kind of came to their senses. Not so much Charlie though.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

He never, never owned up to his part in the choices that they made. He would say over and over again until his dying day that he never told them what to do, that they made their choices on their own, and he had nothing to do with any of it. And I think that's why Charles Manson remains so infamous because he never actually did anything. He got these other people to commit the crimes for him.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

He never got his hands dirty, but he did shoot the Bernard guy. So he did technically. Sorry. Also the whole like Helter Skelter doomsday cult story added to it. People just love cults. So it just took him to this iconic, infamous being, I guess.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

In 1974, Vincent Bugloli, the prosecutor, well, he was now an author because he released his book, Helter Skelter, which was based off of the Manson case. And it became the best selling true crime book in, His story, history, selling over 7 million copies. So it brought him great success. Vincent was just riding the wave. A lot more things happened, but this video is already super long.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

So yeah, but everyone remained and some still to this day remain in prison. Leslie Van Houten, she was sentenced to life in prison. She's 68 now and she's been denied parole numerous times. Susan Atkins died in prison of brain cancer in 2009. Pat Krenwinkel is now 73 and still in prison. She's been denied parole numerous times as well. Tex Watson

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

And when Charles found her, she was like, shit, you found me, damn it. So as you can probably gather, pretty loveless childhood. Okay, great. He spent a lot of his childhood in different schools for boys. He went to the famous Boys Town, which we could do like a whole story on this place alone. Okay, but not today. But he went there and Charles would run away. He would commit a robbery.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

Tex was like the most fucked up out of all of them, okay? Like he was really crazy, but he's 75 now and he's still in prison. He's been denied parole numerous times as well, but he has become a born again Christian and runs a Christian outreach site from prison. Linda Kasabian, I didn't really talk about her that much, but she was involved.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

I'm assuming that she came from money because she got a good attorney, okay? She was charged with nothing. She was there the night of the Tate murders as the lookout. And then she also helped like clean and dispose of the weapons and whatnot. But she was charged with nothing because she was considered a star witness for the prosecutor's case against Charles Manson.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

She told them everything they wanted. And then afterwards she disappeared, changed her name. She was like, bye. Linda's done a couple of interviews since this whole thing, like later in life, and you can find them on YouTube, and her face is always like blacked out, because she doesn't want anyone to know what she looks like. She kind of has meth face, and that's not me trying to be a dick.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

I don't really blame her for doing meth. Like, come on, just tell your truth. It's been a hundred years. Bobby, remember Bobby in the very beginning? He killed Gary Hyndman. He's 71 now, and he's still in prison. Yeah, he was convicted for murder, for killing Gary, so he's still in prison.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

Another family member, Steve Grogan, we didn't talk about him, but he was charged for the murder of Donald Shea, the spawn ranch hand that went missing. Yeah, well, Steve was charged. But Steve was granted parole after serving 15 years for Donald's murder. He was allowed his freedom after telling authorities where Donald's body had been disposed. Lucky him, I guess, you know?

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

Charles Manson remained behind bars until the age of 83, and then he died on November 19th, 2017 in prison. Oh my God, not long after his birthday. Like a full circle, but he had a heart attack or something. I don't know, he needed to go. Goodbye. He was just, oh, exhausting. I watched so many interviews with this dude. He just talks in circles, but people find him absolutely fascinating.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

He says nothing, really. He just talks. I couldn't take it anymore. Charles Manson wasn't a God or Jesus-like figure. He was just an odd little man who was abandoned by his parents, who wanted attention and validation, and was just filled with hate and did terrible things. Charles Manson has so many fangirls and guys, or did.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

I mean, people love the guy and they believe that he was 100% innocent and didn't need to be in prison. But what I don't think these morons realize is that maybe he wanted to be in prison. Maybe it was his home. I mean, look what happens when he's out. Nothing good. Like they were fighting so hard for him to be proven innocent. It's like, babe, babe. No, we don't need that, no.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

There are so many people out there who idolize this guy. I just will never understand it. It's so bizarre. I've said this before and I will say it again. Get better idols. There are so many great people out there who have done amazing things. Why idolize someone who's just fucking weird with a swastika on their forehead, you fucking morons?

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

I think it is fair to say that Charles Manson had a very difficult life and now he's dead. The end. That is the story about Charles Manson. I told the other version, Drug Deal Gone Bad, but there's a lot of people and a lot of stories and versions about the Helter Skelter wherein It involves a doomsday cult.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

After this week of binge watching freaking everything that had to do with Charles, I just personally believe that the doomsday cult wasn't the thing. I think it was just the drug deal gone bad. Either way, they needed something to prosecute him on, and they had to create some kind of story to get him. Because if they didn't, then he would have been out. And they didn't want that.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

If they did do that, is that morally right? I don't know. Anyways, it's still all sad though because they were like really murdered. Like really, really murdered. If you made it all the way to the end, congratulations. I love you and appreciate you. You're the best. Wow, you're my best friend. I hope you guys have a wonderful rest of your day. My voice hurts. I think I lost it.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

But other than that, I hope you have a wonderful rest of your day. You make choices and I'll be seeing you next week. Bye. Hi friends, it's me Bailey popping in here again. Thank you for listening to today's podcast. What a wild ride, right? The Manson murders have become so ingrained in American culture. You almost forget that it's not just creepy legend and like this actually happened, okay?

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

Then he would be sent back. He would go to a different school for boys and repeat. Like it was just this cycle. Then he got sent to another terrible place. It was the Indiana Boys School where Charles said that he would be beat and raped by people in charge. He was heavily abused throughout these schools he attended. He tried to run away here, but same thing.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

Now this new documentary is based on Tom O'Neill's 2019 book. It's called Chaos. Charles Manson, the CIA, and the secret history of the 60s. Now, Tom wanted to find more potential answers to the age-old question when it comes to the Manson murders.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

Just how exactly did this little weirdo, who had broken dreams of making it big as a musician, manage to control the minds of so many people and get them to do his bidding? No questions asked.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

So I guess Tom did some digging and found out that when Charlie was living in San Francisco, he would repeatedly visit the same free health clinic, often because his wives, quote unquote wives, had a lot of pregnancies and, you know, different situations to take care of.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

Turns out that this clinic is where a psychiatrist named Louis Jolly West was recruiting hippies to study their lifestyle and observe their drug use. specifically LSD, and apparently this was all done for the CIA. Jolly described the office he and his researchers set up as a laboratory disguised as a hippie crash pad. Wow, groundbreaking.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

And what was the big government program that Jolly was most known for being closely tied to? MKUltra. Do you watch Dark History or listen to it at all? We did a whole episode on MKUltra, but the rundown. It's a secret government program where the CIA experimented with different drugs and mind control techniques in order to force like confessions from people.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

But also, I think they just wanted to see what it could do, you know? So in the documentary, Tom O'Neill poses the question, could Charles Manson have picked up some of his mind control techniques from the CIA?

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

I mean, he was living in that exact area where the experiments on the hippies were taking place and constantly in and out of the same medical clinic where they were finding their test subjects. You know, it could be possible he could have been recruited. I don't see why not.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

It's also interesting because Tom brings up how Charlie repeatedly violated his parole, and yet there were no consequences for him. And there were also multiple raids done at Spahn Ranch. But again, Charlie just always seemed to get by unscathed. Many believe, like, maybe he was getting this, like, get out of jail free card because he was still under, like, maybe government observation. Huh?

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

Maybe he was being protected and he didn't even like know it. I don't know. People like mysteries, huh? That's why we're here. So yeah, these are some interesting ideas, but is there any actual evidence? No, and at least Tom O'Neill seems pretty willing to admit that, that this is just a theory and there's no proof it really even happened.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

Maybe Charlie was just super paranoid about the loyalty of his followers and he wanted them to prove their devotion to him in the most extreme way possible. Also, everyone was on drugs, so period. I think that says a lot. Well, let me know your guys' thoughts, you know, but that's all I got today. Thank you so much for hanging out with me. I hope you have a good rest of your day.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

You make good choices. Please be safe out there. Don't fall for these long-haired bad boys who are going to take you down a bad path and ruin your life. Don't do it, okay? All right. I'll be seeing you guys later. Goodbye.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

He would run away, commit a crime, like armed robbery. theft, he robbed a gas station, he was caught a couple of times trying to rape or molest boys. Then he would get arrested and get sent back to a different school. It was just like a hot mess. When Charles reached 20 years old in 1955, he married a 17-year-old waitress named Rose. Not long after, she was pregnant.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

The two of them stole a car and drove to Los Angeles. When he was there, he was caught and he was sentenced to three years in prison. While Charlie sat in prison, Rose, she had her baby. She moved in with her family in Los Angeles. Then she met another man and moved on and they separated. Charles Manson had a baby, which is super sad because later on in life, I think he committed suicide.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

So when Charlie got out of prison, he just found odd jobs, like pimping 16-year-olds, stealing cars, forging checks, stealing where he could. He ended up getting another 10-year sentence for violating his probation. This time though, he would only serve seven and a half years. So this time though, when he was in prison, he learned how to play guitar, and that's when he started to become

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

really into playing music. Music is my passion. Prison was rough, but it was like a home to Charlie and he was raised in there and it's really where he formed his outlook on life. I mean, based off of what he said. He refused to be programmed by the world or go along with the expectations of what was considered being a functioning, normal adult.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

Instead, he would just sit in his jail cell, play his guitar, and write music. That's not me trying to make him sound all peaches and cream, nay nay. Rumor has it, prison is like super rough and you don't play around there, okay? There are rules to be followed. So growing up in prison and being in constant fight or flight mode, I think just really like made him freaking psycho, I'm sure.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

Something about Los Angeles in the 60s, the eeriness of his devoted followers, the brutal murder of a, you know, pregnant movie star. It's equally as captivating as it is terrifying.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

I mean, how do you come out normal in this... Situation. In 1967, Charles was released from prison, and he actually asked if he could stay. He didn't want to go, I mean, what the hell was he gonna do? But this time when he left prison, it was actually a lot different for him, okay? He was in San Francisco in the mid-1960s. Babe. Things had changed. Things had changed.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

It was the time of the flower child. Hippies were thriving in the Haight-Ashbury district of San Francisco. Tons of young adults were coming from all over the place, just coming out to the area to advocate for peace and love, grow their hair out long, join a commune, and just like go on a spiritual journey, man. But then, um, LSD...

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

was introduced to the scene, and now people were not only going on their spiritual journeys, but they were just straight up tripping balls. That's when it started to turn more aggressive, because drugs and money, and there was just like lots of journeys happening.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

Anywho, so Charles enters the scene, and he actually liked this, because these people were all about peace and love, we don't need the system, sleep on the streets, play music, do drugs. He had long hair and a guitar. It was just like Charles cup of tea. He fit right in. He would play music on the streets. People would gather around. Anyone who met him said that he had this charisma about him.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

He just knew how to talk to people and make them feel special, important, and like heard. I'm on a little bit of a vacation, you could call it. Now, I don't want to read anything like work-related or like true crime. I'm trying to like, you know, take a break from the true crime just for a little bit to clear my mind. But now it's got me kind of like, I still want something.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

So let's have a little refresh on the story of the Manson murders and then stick around to the end of the episode and I'll fill you in on the theories from this new documentary and if I think there could be any truth to them. No, sound good? Okay, circle back you guys, let's get into it. Hi friends, how are you today? I hope you're having a wonderful day so far.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

So I was like, what if I listen to some spicy audio romance pieces? Oh, Bailey, that could, ooh, that could be fun. That's a fun way to relax and enjoy some time off. Well, that's where Dipsy comes in. Oh, I've talked about Dipsy. Passionate about it, okay? Dipsy is an audio app made for romance lovers, with short, spicy stories that immerse you in the fantasies you've been craving.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

Dipsy is great because it was created by women for the female gaze. Their app has over 1,000 juicy audiobooks, all crafted by a team of professional writers and top-tier narrators. I want to narrate one of their stories. One of my goals in life.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

Anyways, so whether you're looking for a beefy god of the underworld or a sensual story about a menage a trois, then you'll find characters you love on Dipsy. With their easy-to-explore app, you can search for your favorite romance genres like contemporary, historical, dark, sports. Maybe you want some basketball fantasy. Western. Yeehaw. Yeehaw, cowboy. Romanticy. Ugh. They got everything.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

Any kind of fantasy you have thought of in your mind, they got it, okay? New chapters are released every week, so you'll always find something new to enjoy. Giddy up, cowboy. Right now, listeners of this show can get an extended 30-day free trial. Oh, you're going to love it. So you're just going to go to dipsystories.com slash makeup to start your free trial.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

That's dipsy, D-I-P-S-E-A stories.com slash makeup for 30 days of full access for free. free visit dipsystories.com makeup so charles he really just started making friends one of his first followers was lynette from and she met charlie early on and said that he was just easy to talk to and his mind just really intrigued her then soon after that he met pat krenwinkel at a mutual friend's house

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

Charlie was there playing guitar, people came over to hang out, and Pat and Charlie ended up like really hitting it off and involving in some sexual relations. She said that she just felt very loved by him, the way he gave her attention was fulfilling, she was young, she ran away from home, she was desperate for love and attention, and Charlie just gave that to her.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

And he seemed to do that with a lot of different women. So Charlie also had a man named Tex Watson who joined the growing family, a way to get a man to stay with the group and join in on the fun. Charlie would offer women to the men in hopes to gain their trust and get them to stay. Charlie would like round up more women, sell, trade them for sex.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

He was really good at manipulating people and he mentioned that it's just something he learned or like picked up in prison. The prettiest girls he called the front street girls and these were the ones that he thought were the most attractive out of the bunch and would lure others to join their group. Like, hey, you should come meet my friend Charlie.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

My name is Bailey Sarian and today is Monday, which means it's murder, mystery and makeup Monday. If you are new here, hi, welcome. My name is Bailey Sarian and on Mondays I sit down and I talk about true crime story that's been heavy on my noggin and I do my makeup at the same time.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

He's super cool and like you would really love it and then we can like do stuff. Over time, Charles was attracting more and more people into his group, or what he called his family. He gained their trust, gave them drugs, had sex, played music, it was just like somewhere all the lost kids wanted to be.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

Most of the followers left home, they had like nothing to their name, in search of a new life, anti-system, peace and love, so finding a family of people with similar interests really kept people there. I think that's how a cult starts. In the summer of 1967, Charles and his family, they left San Francisco. Got too much.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

They left San Francisco in a bus, and they drove up and down the coast, just going from place to place, which kept everybody entertained. You know, they weren't getting bored, because it was like new location. Cool. Haven't seen this rock before. Eventually, they made it to Los Angeles, where they spent most of their time. Plus, Charlie really wanted to like make a name for himself playing music.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

In March of 1968, two of the family members, two of the girls, they were walking along Sunset Boulevard in Los Angeles. I don't know what was going on, like what they were doing. Maybe they were trying to find new family members, but either way they're just walking. And they're hitchhiking because they're trying to find a ride to where they were all staying at.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

And Dennis Wilson ends up picking them up. He's from the Beach Boys, who were a very popular group, still pretty popular, right? You hear the Beach Boys everywhere sometimes, especially like when you're shopping, they always have the Beach Boys playing, but they were very popular. So yeah, small world, but he picks these two women up who belong to the Manson family.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

To make a long story short, the women tell him about the man that they're staying with, a spiritual guru of some sorts, you know? Spiritual guru, his name's Charlie. You should meet him. And then Charles actually ends up going over to Dennis Wilson's home. They really seem to hit it off. I mean, they became like BFFs. Okay, so then they end up spending like more and more time together.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

And then soon the whole Manson family ended up moving in with Dennis Wilson in like his nice ass place. They are living with him, doing drugs, playing music, writing music, work. It seemed like Charles Manson was on his way to becoming a Beach Boy. Dennis Wilson really wanted him to be a part of the group, but some of the other Beach Boys, they just didn't like him. They refused to work with him.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

Some members of the Beach Boys were telling Dennis, like, hey, you need to get rid of this guy. Like, he's not good. We're just getting all sorts of bad vibes. You need to drop him. All he wants to do is party, do drugs. Like, he's just not good for you. The Manson family ends up getting kicked out of Dennis's house and they end up cutting ties. with one another.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

It's more complicated than that, but for the most part, that is what happened. The Beach Boys' song, Bluebirds Over the Mountain was originally a song written by Charles Manson that the Beach Boys recorded and didn't credit him on. But Charles says that was his song, okay? And they didn't credit him on it. So Charles is pissed, obviously.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

While they were living together, Charlie met a well-known music producer named Terry Melcher. Charles knew that this producer had altered his music and honestly just hated him. He hated Charlie because he just didn't like him. They had issues and then he ended up stealing his music and altering it and using it and not crediting him.

Murder, Mystery & Makeup
Fan Favorite & **UPDATE** The Charles Manson Cult Killings

So Charlie is obviously very pissed off, and held a very nasty grudge against his producer, and there really wasn't anything he could do about it. Terry is important, so remember Terry. August of 1968, Susan Atkins, who was like a long time family member at this point, found the family a new home. It was an old western movie set which had been turned into a writing stable.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

Then they realized it wasn't this guy. Police also suspected a disgruntled employee thinking that Fred's employee must've just like hated him or something and you know, killed him. The police went as far as tapping his phone to see if he would confess or something, but that was proven unsuccessful. Police didn't check the attic because why would they, you know?

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

So Dolly took her next steps carefully. She disposed of the murder weapons with the help of a new lover. Oh yes. Oh yes. She had a new lover. His name was Roy Klum. So he takes the murder weapons and he threw them into the La Brea tar pits. It's in Los Angeles. It's these big tar pits where like, if you throw something in there, it'll get sucked down and then you'll never see it again.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

It's very bizarre. So- Great place to hide a murder weapon, really. When questioned by police, Dolly, you know, she played the role of like the grieving widow. She was like, oh my God, it was just like so traumatizing. I just didn't know what to do. You know, and she was able to collect her husband's fortune. It was like millions of dollars and any, the property.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

So with this new money, Dolly bought a new house with money. A spacious attic. I know, I was thinking, okay, once her husband was gone, wouldn't she just like allow Otto to like live in the house freely? No, he was still sent to live in the attic.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

so by this point the relationship between otto and dolly had evolved into an snm relationship dolly was the dom and otto was the sub very ahead of their time huh so they're into that and this is like their new arrangement and otto just continues his life in the shadows hidden away from the world and as Dolly's ghostly lover.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

I don't know if he's getting vitamin D, but things started to unravel when Dolly, in a fatal lapse of judgment, gave Fred's supposedly stolen watch to her lawyer, who is also now her new lover. His name was Herman Shapiro. So she gifted him Fred's watch that was stolen. So he grew suspicious because again, this watch, where'd it come from?

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

Dolly swore up and down that she had found the watch under the couch cushions. She's like, I swear it was in the couch cushions. That's crazy. But this was enough to raise some serious red flags. And then remember Dolly's other lover, Roy? So Roy came forward to the police about him disposing the guns in the tar pit.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

Though most would come to know her, they would call her Dolly, okay? And thank God, because Valbuga was like, it's a hard one for me. So she goes by Dolly. She's born in Germany in 1880. And Dolly's family soon left for the promise of America, the idea of America, where they settled on a modest farm in the rural Midwest. So little Dolly grew up on a quiet farm where she learned early on

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

I guess Dolly tried to end things with Roy and you know, she was like ready to move on with her lawyer and this made him very upset. So he went straight to the police and told them what he knew. I know Dolly must've had some like beer flavored nipples, right? These men just were loving her.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

So police, they end up going out to the tar pits and they were actually able to get the weapons out, but they were way too deteriorated to positively tell if they were the ones that had fired the bullets. But, Dolly's story was beginning to crack. The police, they had found out about the watch and they felt that they had enough evidence to arrest her.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

Now, mind you, at this point, they didn't even know about the guy in the attic. So as time is going on and the case is unfolding, they learned about Otto, living in her attic. They learned about him because while she was incarcerated, she's in prison, you know? So while she's incarcerated, she asked her lawyer to bring food to her vagabond half-brother to the house.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

And that's when her lawyer, Shapiro, he found out about Otto living in the frickin' attic. Years in the attic. And at... the time he revealed himself as Dolly's longtime lover and self-described sex slave. So the lawyer's like, what the F did I, am I involved in right now? So in 1930, Otto, he confessed to the murder, but claimed that he was under Dolly's control. Fair.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

The press was having a field day and they described Otto as living in the attic in his car, cave-like home, calling him the Batman. It kind of makes sense though. So the trial concluded with Otto being found guilty of manslaughter, but he was released nine days later due to the statute of limitations. The statute of limitations at this time when this story happened was not what it is today.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

So he was out really quick, okay? So he gets released. Otto, he finds a new wife. Her name's Matilda Klein. And he ended up like marrying her right after leaving Dolly. And honestly, like, I kind of think like, okay, he did kill someone, but that was fucked up. The whole situation, right? So... You know, I kind of don't, I don't know. I don't think he really should have been in prison that long.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

I don't know. But Dolly, she had faced her own trial in August of 1930. Now to be fair, they didn't really know what they were charging her with because they didn't have anything linking her to the crime. Nothing. They had nothing. Besides Otto's words of like, she made me do it. And that was about it. But Dolly, she stood on the witness stand. She was tearful. She was expressing regret.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

And then in the end, after three days of deliberations, the jury was deadlocked. The prosecution tried to get a retrial, but after much back and forth, the judge dismissed the charge on the grounds of insufficient evidence and Dolly was set free. Her charges were officially dropped in 1936. So. Fucked up, fucked up. Following the trials, Dolly and Otto, they went their separate ways for good.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

Dolly ended up marrying another man, His name was like Ray Hedrick. So she became Dolly Hedrick. And Ray Hedrick was 15 years younger than Dolly and just one year older than Otto. So she had a thing for just like young men. Dolly ended up passing away in 1961 at the age of 80, completely scot-free. She got to keep that her Fred's money and everything. And she had a little sex slave.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

Later on Otto, he ended up changing his name to Walter Klein because everyone knew him. Like it was all over the media and he was labeled the Batman. So he changed his name to like get away from that. He ended up passing away in 1948 at the age of 60 and is actually buried in Hollywood. Ah, yes, a man lived in an attic for 10 years, 10 years, consumed by love, lust, and loyalty.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

That life in the country could be unforgiving, isolated, and lonely. And perhaps in isolation, Dolly began dreaming of a different life. And you know, when I was reading this, you know what it reminded me of? Did you see the movie Pearl? You see Pearl? It was giving Pearl. Where Pearl's like, mama always told me I'm gonna be a real big star. You know? Did you see Pearl? Okay.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

A wife manipulated those around her, all to escape her, empty marriage, a husband died unaware that the secret of his death had been hidden in his own home for 10 years. Like what? In the end, Maybe Dolly's only true love was the power she held over those who thought they knew her. I think she just liked power, obviously. She was a dom.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

You know what was funny though, this is a side note, because I was reading some of the court stuff and they were saying in court, like a court reporter said that Dolly was like, they didn't say she was ugly, but they were like, she's nothing special. I don't know why she's getting all these men. It was really saucy and sassy.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

So the scandal of Dolly continued throughout the years to inspire various adaptations. Including there was a movie in 1968 called The Bliss of Miss Blossom. There was another adaptation that came in 1995. It was like a made for TV movie called The Man in the Attic. great title. And then finally, there was a more recent film in 2018 called The Lover in the Attic, A True Story. The end.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

Well, short and kind of sweet, huh? That, my friends, is the story of Dolly Osterreich. I hope I'm saying her last name correctly. I know it's kind of bare, but I found it very interesting because first of all, who keeps a lover in the attic? For 10 years. And like, do you even think Otto should have gotten like longer jail time? I don't think so.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

I mean, he killed someone, but like also he was young and like kept in a freaking attic away from people for a long time. Dolly for sure should have gotten prison time, but they couldn't link anything to her. So... Yeah. Talk about a psycho bitch. You know what I'm saying? Talk about a psycho. I hope you have a good rest of your day. You make good choices.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

Do your skincare because we're getting old. Okay. And I'll be seeing you guys later. Goodbye.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

That's what it was giving me. In her early twenties, Dolly left the farm and found what she thought was an escape. A man named Fred Osterich. Fred was a wealthy, respected businessman. And he was also like the owner of a successful apron factory in Milwaukee, Wisconsin. So the two meet, they fell in love, they got married.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

on the surface it seemed like dolly had found her perfect match he was wealthy he was well connected he was kind of charming, I hear. It was like, he wasn't that charming, he was kind of charming. But life inside the ostrich home was a different story. Fred, Mr. Fred, he loved drinking whiskey, which made him pretty gruff and unpredictable. And also, I guess it left Dolly sexually unsatisfied.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

I mean, she had her own desires. So there were rumors going around town that hinted that Dolly kept like a line of lovers to escape the unhappiness that she felt within the home. I'm not judging, but rumor had it she had like a lot of lovers. Good for her, but you know. She's married, so. But in 1913, Dolly's life took a fateful turn. So it was a quiet day in 1913.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

Dolly, home alone, asked Fred, on the phone, to send over one of his men to fix her sewing machine. It was broken and she needed some help with the repairs, you know? so that someone was Otto Sandhuber. And he was said to be a very like shy, lanky 17 year old with a soft spoken demeanor and downcast eyes. Now to most, Otto would be unremarkable, hardly noticeable. But Dolly saw him differently.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

When Otto arrived, he didn't just find a broken sewing machine. No, I think she would have done this for anyone who was going to show up. It just happened to be Otto, you know? But when she answered the door, she was wearing nothing but a silk robe and stockings. She's like, hello. So yeah, imagine young man, 17, face to face with like a wealthy woman in such a state. She's like, hello.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

Are you here to fix my sewing machine? It's over here. I could show you where it's at. Dolly and Otto, they began an affair that grew more intense with like every passing week. At first they were like meeting in hotels away from the small town prying eyes, but soon their meetings just moved straight into the Osterich home while Fred was away. Like they just were over it.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

They were over trying to be sneaky. So the neighbors, of course, You know how bored housewives, they're watching. They notice a strange young man coming to the couple's home and Dolly, ever resourceful, spun a tale saying that Otto was her vagabond half-brother. So she's telling everyone this and she's realizing like over time, it became clear that simply deflecting attention would not be enough.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

So Dolly decided to start a new plan. A odd, odd plan. She had Otto move into the attic and live in there. This was her plan. So they could be together. Yes. Oh, yes. You heard that right. Otto, the quiet 17-year-old lover, agreed to move into the Osterix Attic. As we grow up, we now have all these responsibilities, right? And that's okay. That's just part of the trade-off.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

We had to keep up with doctor's appointments, bills, do my hair, shower, sleep, plan for the future. What do you want to eat? So many, it's like so many questions every day. I'm like, can I just like not answer anything today? In my personal experience, I've learned that planning for the future is usually code for insurance.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

I know it's kind of like the last thing you want to think about, especially life insurance, because when someone says like, oh, life insurance, I'm like, well, what does it matter if I'm dead? Like, why do I need life insurance? Like I never, you know? Thankfully with SelectQuote, I know where to start.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

SelectQuote is one of America's leading insurance brokers with nearly 40 years of experience, helping over 2 million customers find over $700 billion in coverage since 1985. Other life insurance brokers offer one size fits all policies that may cost you more and cover you less. While SelectQuote can help find the right policy for you.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

Plus, they take the guesswork out of shopping for life insurance. I mean, let's be honest. Who has time to... What am I even looking for? You know? Well, in as little as 15 minutes, a select, quote, licensed insurance agent can tailor a life insurance policy to your family's needs. And...

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

I know the cost of life insurance can seem very high, but with SelectQuote, it's more affordable than you think with some policies costing less than a dollar a day. Get the right life insurance for you for less at SelectQuote.com slash makeup. Go to SelectQuote.com slash makeup today to get started. Yeah. That's SelectQuote.com slash makeup. Now there are some rules in place.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

Otto agreed to abandon all human contact except for having sex with Dolly. This is a real story. He agreed to this. It's not funny. It's just like, okay. And I was like, well, wouldn't people miss him? No, he didn't have any family. I guess he didn't really have any friends or anything. So like he personally didn't mind according to him. I mean, looking back, he's a child. He's only 17.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

So, you know. Not great. Now the attic, like, okay, it wasn't like a guest room or like a proper living space. It was an attic. It was cramped. It was musty. There was just enough room for like a cot, a dim light, and a stack of books that Dolly brought him from the library. It was said that he especially loved reading nautical adventure books. Fun fact.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

So during the day he would come down into Dolly's house. He would clean. He was like their housekeeper. Sometimes he would distill gin. And then of course he would engage in sexual relations with Dolly. So Otter later claimed that he loved Dolly as a boy loves his mother. Yeah. But like the relationship was far from motherly. I mean, they were having sex. Are you having sex with your mom?

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

I hope not. By 1918, he became pretty much like a ghost in the attic. He was hidden from Fred, lurking above without Fred having any idea. When I was reading this story, I was like, is this true? Is this real? This, this, what? Yes. Yes. Now it was said that Fred did notice like some strange things happening within the home.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

There would be times when like he would hear footsteps when he's home alone. He's like, what is that? You know? He also noticed that his cigars were mysteriously vanishing. Once he thought he saw a man's face in the window and he's thinking to himself, like, am I going crazy? Am I drinking too much? He had no idea that his wife's lover was living literally just above him.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

So in 1918, Fred's work took the family west to Los Angeles. So Dolly's like, that's fine. I don't mind going to Los Angeles, but there's one condition. This new house, wherever we live, has to have an attic. Fred didn't like question it. He's like, oh, okay. Yeah, sure. Like an attic. Sure. For your stuff or whatever. So he agreed, you know, and they found the place. They found a home on what was

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

Hi friends, how are you today? My name is Bailey Sarian, and today is Monday, which means it's Murder, Mystery, and Makeup Monday. If you're new here, hi, my name is Bailey Sarian, and on Mondays, I sit down and I talk about a true crime story that's been heavy on my... and I do my makeup at the same time.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

858 North Andrews Boulevard in Silver Lake, Los Angeles. And fun fact, the house still stands today. It's now like 858 North Lafayette Park Place. The street name changed at some point, but the house is still there. So I looked it up on Zillow and I was like, Ooh, I wonder if they knew what happened in this house. So they move and guess who came along? Otto. Bizarre, bizarre.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

So Otto, I guess, was sent ahead of everybody else. So he goes to Los Angeles and he already moves into the attic by the time that the Osterichs had moved into the house. So he's already all settled. So by this point, Otto was not just Dolly's lover, but also the housekeeper. And now he was...

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

considered he would even say this later he was considered like dolly's sex slave i know i was like what this poor guy but otto also thought of himself as dolly's protector literally watching over her from the attic willing to do anything to like keep her safe so after moving to los angeles the marriage between dolly and fred seemed to just Go to shit, okay?

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

Look, well, it was already bad, but I guess it got worse. Like Fred began drinking more and more, and then they would get into arguments all the time. And it was said that sometimes the arguments would become violent. So August 22nd, 1922, Dolly and Fred, I guess they were in another one of their heated arguments. And this like fight was fierce. Their voices, were rising in anger, filling the air.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

Okay, not great. So hearing the commotion, Otto decided that he had to protect his lover and he had had enough. He had had enough of this fighting and this bickering and he needed to step in. So he hears a fighting going on. He creeps down from the attic. Oh yes. He creeps down from the attic. He's like silent as a shadow. And with him, he was carrying two 25 caliber pistols.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

Now, without a word, Otto aimed and fired three shots into Fred's chest. So the sound of gunfire like shattered the house's silence and Fred fell dead. Dead before he hit the floor. Dead. Spring is springing. And without fail, I open my closet and I realize, hmm, I have sweaters, sweaters, long sleeve, and more sweaters. Maybe it's time I'd need a little refresh, huh?

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

I've been wearing the same stuff forever and it's fine. I don't like buying new clothes. I don't even like shopping. I know, unpopular opinion here. But look, I do need a little refresh. Thankfully, there's an easier way to get clothes that I kinda need with Stitch Fix. Stitch Fix is an online personal styling service that takes the stress out of shopping.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

So today's story, listen, we delve into like one of the strangest, most twisted stories of the 20th century. A tale that begins on a quiet farm, winds through secret lovers and ends with a murder that will leave you questioning the very essence of love, loyalty, and obsession. So our story begins over a hundred years ago with a girl named Valbuga Corchel.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

You get a stylist who is assigned to learn your style and budget. And once they have all that information, get to work figuring out personalized pieces for you in just the right size. And they do all the shopping for you. The stylist feature is such a huge help because they really go out of their way to find pieces that not only look great, but feel good too. Like they'll feel great, good quality.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

Plus, Stitch Fix doesn't force a subscription service on you. You can order boxes when you want and how you want. No subscription required. Plus, you can keep what you love and then send back the rest. It's so easy. They even send you outfit recommendations and styling tips as a bonus. No stores, no crowds, no stress, just personalized looks you'll love. Stitch Fix makes it all so easy.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

Personal styling for everyone. Get started today at stitchfix.com slash makeup. That's stitchfix.com slash makeup. So I guess, allegedly, we don't know, I wasn't there, but allegedly Otto quickly told Dolly to get into the closet and locked her in the closet. And he was gonna stage the scene. Then he climbed back up to the attic, guns still in hand.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

So when the police arrived, they found Dolly locked in the closet and Fred dead on the floor. So police, they suspected a robbery was the motive because Fred's gold watch, a very expensive gold watch was missing. It was taken by Otto, but it was missing. And Dolly was locked in the closet, which couldn't have been locked from the inside.

Murder, Mystery & Makeup
She kept her secret lover in the attic for 10 YEARS and no one knew?!

So they're like, oh, someone came in, stole some jewelry or whatever, and then locked her in there, shot him dead, whatever. Police end up arresting this guy named James Casey, who was found with a 25 caliber weapon, which was missing four rounds. the number of shots fired in the home. I'm not sure how they connected him to it, but they thought it was this guy for a while.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

Joseph's head was covered with a plastic bag, which he bound with ropes. But Joseph, I guess, ended up chewing a hole through the bag. So he was kind of able to like, you know, get out of the fucking bag. So he's able to like chew a hole through it. And he's like gasping for air. And unfortunately like Dennis realizes this.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

So he gets another bag and he puts it over his head, which caused Joseph to like slowly suffocate to death. Ugh, I know. Dennis tried strangling Julie. Okay, so he strangles her and then he thinks she's dead, but she's not dead. She wakes up and she's screaming, she's yelling, she's trying to get away. And then she starts begging with Dennis to please let her son, Joey, go, let him go, let him go.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

Dennis, not there. just like he's not there, okay? Because he just proceeds to strangle her to death with a rope in front of the kids. Once both parents were dead, he used a plastic bag stuffed with two t-shirts to suffocate Joey. And he just, it was said like, he just watched him die slowly. Like, ugh.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

Next, Dennis led Josie into the basement where he, I'm sorry, he hanged her with a noose from a pipe. I'm so sorry. I know. Ugh. The police, they found evidence of semen near Josie's partially clothed body. The bodies were ultimately discovered by the three older kids who had been at school during the time of the murders. So sad. No. I was gonna say, could you imagine? No. Couldn't imagine.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

Coming home. Mm-mm. Well, only a few months after the Otero murders, on April 4th, 1974, Dennis broke into the home of 21-year-old Catherine Doreen Bright. So he, Dennis, had like entered through the porch screen door and then he was like hiding in her bedroom just waiting for her. So at 2 p.m., She had come home with her 19 year old brother. His name was Kevin. They came home.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

Dennis was surprised. You know, he was like not expecting this brother to come, right? But he ends up surprising the two. Dennis like walks out. He has a gun in his hand and he's holding them at gunpoint. And then again, he's telling them that he's a wanted criminal.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

and that he needed a car food and money because he was on his way to new york dennis then forced the guy kevin to restrain his sister catherine with the rope and then he moved catherine into the bedroom where he like proceeded to tie her down so while in the bedroom Catherine was like fighting back obviously.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

He was like president of that. He was a Cub Scout leader. He had a wife and two kids. Yep. What else, Bailey? Well, he earned multiple degrees and like held a variety of different jobs. One of his jobs was actually installing ADT security systems. Yeah, he was installing security systems at the homes of people who were afraid of this BTK killer on the loose.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

She's fighting and fighting and like Dennis was trying to strangle her but then he gets really frustrated because Catherine was fighting back too much. She was pretty good. She was like really fighting him and I guess it made Dennis really upset because he could not seem to get her to stop. Dennis ended up you know stabbing her three times.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

like in her back and her lower stomach because she was putting up too much of a fight. I guess then Dennis and Kevin got into a fight because Kevin was trying to fight back, trying to fight this guy off. And then unfortunately Dennis shot him in the head twice and then strangled him. And then miraculously, Kevin got away by pretending to be dead. So he wasn't dead.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

He was just laying there pretending to be dead. And then when the coast was clear, Kevin got up and like fled the scene. I guess a few months later between the Catherine Bright murder and his next murder, Dennis had wrote a letter detailing the Otero killing that he ended up stashing in an engineering book that he left at the Wichita Public Library.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

So Dennis wouldn't murder again, I mean, as far as we know, until three years later on March 17th, 1977. This is when he would kill 25-year-old Shirley Ralford. So Dennis was actually pursuing a different potential victim at this time, and I guess that victim Luckily, she wasn't home that day. So then Dennis was like, eh, I'll pivot. Could you imagine? Holy shit.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

Well, Dennis saw Shirley's five-year-old son, Steve. He's walking home and Dennis was like, I'll just follow this kid home. So follows the kid home. Dennis knocks on the front door and little Steve answered. Dennis pretended to be a detective and little Steve let him in. And when Dennis got inside, that's when he discovered that there were two other children who were also inside.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

Well, once Dennis was inside, he turns off the TV and then he turns down the blinds. Shirley, she was in her bedroom. She comes out and she sees Dennis, you know, freaks her out. Dennis then pulls out his gun, holds her up at gunpoint. and then orders the children into the bathroom. He ties up all the kids in the bathroom and then locks them inside.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

He then gets Shirley, takes her into the back bedroom. It's unclear what Dennis did next and like whether he sexually assaulted Shirley or not. Detectives later, they would find semen next to Shirley's body. So, you know, it's safe to assume he probably did. But what we do know is that he tied her up or something and then they smoked a cigarette together or he smoked a cigarette.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

and must have like gave it to her at some point but there was like a cigarette put out at the scene and he had restrained her to the bed with rope you know and then at some point she had thrown up because there was vomit at the scene which understandable then he ended up strangling her with a rope and then putting a plastic bag over her head.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

Meanwhile, all of like the kids were like screaming in the bathroom. I guess Dennis, he had planned to kill the kids, but they had managed to escape before he could get to them. So like police come to the scene and stuff, but like there isn't much they can do. This is a time when there wasn't DNA and like, you know, all that jazz, like how they solved crimes. I don't freaking know. So wild.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

So months later on December 18th, 1977, Dennis murdered 25 year old Nancy Jo Fox. He entered her home when she wasn't home. Well, first, you know, like with all of his victims, he would like usually follow them and like learn their routines and stuff. So like he would know when they weren't home.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

And then when they weren't home, he would go inside and like cut the phone lines, which he did with Nancy. Like, I guess he had been stalking Nancy for quite some time. And when she returned home from her job, she was working at the jewelry store. Dennis jumped out and surprised her at gunpoint in her kitchen. He told her that he had a sexual issue and he needed to tie her up and rape her.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

Hey, I have a sexual issue. I'm sure those weren't the exact words, but it was something along those lines. So Dennis had allowed Nancy to like take off some of her clothes in the bathroom and then ordered her to get into the bedroom. And like, it was just different. He didn't really let anyone else do that. So, you know, something happened inside.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

Once they were in the bedroom, that's where he tied her up. And then he got undressed. Now while they're like in the bedroom together, he like starts to strangle her with his belt, but then he starts confessing to her. He's like, I killed the Otero family. He's confessing things to her. He just, obviously he's sick, but I guess he was so excited. He just needed to tell somebody. I don't know.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

Literally, the killer is inside the house. So this guy, he had a very deep and complex dark side, which involved, you know, pretty like vivid fantasies of domination, bondage, torture, murdering women. And these fantasies turned to reality when in 1973, Dennis was let go from his job at, I think it's Cessna. It's an aviation company.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

Well, Nancy would end up dying. And you know, when police came out to the scene and whatnot, Dennis' semen was found on Nancy Jo's nightgown, which was taken off at this point and was like found next to her. The next day on his way to work for ADT, the home security company he was working for them.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

Hi, friends. How are you today? I hope you're having a wonderful day so far. My name is Bailey Sarian, and today is Monday, which means it's murder, mystery, and makeup. Monday! theme song. If you're new here, hi, my name is Bailey Sarian and on Mondays I like to sit down and talk about a true crime story that's been heavy on my noggin and I do my makeup at the same time.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

He ended up calling the police from a pay phone and told them that they would find Nancy Fox's body at her home. I have this uncle who's obsessed with giving everyone advice about money. And every time he does one of his like long speeches, he ends it with that famous Benjamin Franklin saying, a penny saved is a penny earned. You know, just that classic line.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

Honestly, I never really got what it meant until I started using Acorns, the sponsor of today's episode. You guys have heard me talk about Acorns before. It's a financial wellness app that makes it easy to start saving and investing for your future. Saving money is a good thing to do, but if you wanna give that money a chance to grow, you have to start doing more with it.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

And that's where Acorns comes in. Acorns lets you get started with the spare money you've got right now, even if all you've got is spare change. You don't need to be rich and you don't need to be an expert. Acorns will recommend a diversified portfolio that matches you and your money goals. I personally like Acorns because they take the guesswork out of investing for me.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

Honestly, it's confusing, right? But I like that with the app, I was able to start investing within five minutes and I don't have to like drain my savings account to do it. Sign up now and join the over 13 million all-time customers who have already saved and invested over $22 billion with Acorns. Head to acorns.com slash makeup or download the Acorns app to get started.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

Paid non-client endorsement. Compensation provides incentive to positively promote Acorns. Tier one compensation provided. Investing involves risk. Acorns Advisors LLC and SEC registered investment advisor. View important disclosures at acorns.com slash makeup.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

A few months later in 1978, Dennis, I guess he wrote a sarcastic poem called Shirley Locks and he sent it to the Wichita Eagle newspaper and it was like describing Shirley's murder. Yeah, I guess he was a poet. So he sends that and then he sends another letter and it's titled, Oh Death to Nancy. I think it's mimicking the song Oh Death by Ralph Stanley, I think.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

But he was mocking, once again, Nancy's murder. So killer's on the loose and he's mocking everybody. So it's just like... Not great. It's not great. It's not ideal. This is not great. And then also like during this time he's murdering, but he's also really busy. Like, and I, he's just like really busy. Cause he's like working different jobs, Dennis is. And he also was receiving different degrees.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

For instance, in like 1979, he graduated from Wichita State University with a Bachelor of Science degree in Administration of Justice. I mean he's doing a lot. Dennis worked at Coleman company as an assembler and he worked at ADT installing security systems for many of the people who feared getting murdered by a serial killer who was on the loose.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

The media had called this serial killer the BTK killer. A lot of people were scared so they're calling up ADT to get the security systems installed.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

gosh and it's dennis it's literally dennis dennis also served as a census field operations supervisor yeah the census people oh god also he was a dog catcher a compliance officer a cub scout leader and the eventual president of the local chapter of the christ lutheran church in wichita Yeah. So he was just like very involved with the community, which gave him like all the leverage too.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

And I guess he had time on his hands and he was like, let's get down to business. With too much time on his hands, he fell deeper into his fantasies. In the following year, his killings began, which would continue all the way up to 1991. During his murder spree, he would sometimes leave clues in the form of like letters that he would like leave in library books.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

So then seven years go by, most likely because like Dennis was like raising his family, it's believed, but seven years go by. And on April 27th, 1985, Dennis murdered his 53 year old neighbor, Marin Hedge. Yeah, his neighbor. I guess the two of them, they had lived on the same block for over 30 years in Park City. And, um... He was like, I'm a killer.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

So Dennis was at a boy scout meeting the night that like this took place. And he told the scout people, the boy scouts like, I got to leave early. I got a headache, you know, and I got to go home and I got to get some medicine. He goes out, right? And he goes to a local bowling alley and he gets a beer.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

And while he's there, he's drinking beer and he like spills some of the beer on himself because he wants to appear drunk. Then he calls a cab pretending to be drunk. And he takes it back to Park City. So Dennis sees like Marin's car in her driveway. So he's assuming that she's home. Look, this is, hold on. I gotta go back to the drunk thing because I kind of got hung up on that for a minute.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

I was like, why is he trying to pretend that he's drunk? My assumption is like, it's an alibi, right? Like, oh, he was at the bowling alley and he was drunk. That's why he took a cab. I don't know. I'm kind of like, I kind of don't get it. I'm missing something, obviously. Anyways, he sees Maren's car's in the driveway. So he's like, she's home.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

So he goes and he cuts the phone lines and like, you know, outside of her house. And then he walks through the back door and realizes that she wasn't there. So he decides to just wait for her. And he waits for her in her bedroom until early in the morning. Like she ends up returning back to her home close to like 1 a.m., but she returns with a man.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

So Dennis is hiding in the bedroom closet all the way until 1 a.m. And he's waiting until this man leaves. And then she like goes to sleep. Once he thinks she's asleep, Dennis jumps on Marin and like chokes her to death. Once Marin is dead, Dennis then drags her body outside and then puts it in the trunk of her own car.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

He then drove her to the Christ Lutheran Church where he was the council president. He then covered the windows in black plastic so no one could see like what he was doing. And then he takes her body and puts it in the church basement. So when he's in there, in the basement all alone, he's now like taking photographs. Now he's a photographer.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

He's taking photographs of her body and like putting her body in different poses, taking pictures. And then when he was done, he puts her back into the trunk of the car and then dumps her body in a ditch along a dirt road near her home. This guy is beyond sick. Marin's body was found like a week later on May 5th. So Dennis's next victim was 28 year old Vicky Lynn Wiglerly. She was 28, right?

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

She was a mother of two and Dennis had been stalking her. He would walk by her house and like, I guess she would be playing the piano and he would just like listen to her playing the piano. He was just following her everywhere she went. Again, I was like, how did he have the time? He has his own family. He had a job, he was getting degrees.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

He was like doing all this shit and he fricking found the time. Okay, he did. Because he put a lot of thought into this murder. He referred to this murder as the PJ project. I don't know, I don't know. But this one was like a passion project of his, I guess. Dennis would show up at Vicky's door at 10 a.m. on September 16th, 1986.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

He once even sent a poem to the local paper mocking one of his victims. So like over 13 years, In 2004, Dennis hadn't been caught and the case had run cold. The local news had suggested that the killer must have been dead or was probably in prison. But Dennis didn't like this. You know, he didn't want to go unnoticed or forgotten.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

And when he shows up, he tells her that he's the telephone repairman. I hate it. I hate it because it's like, fuck, I would let them in. I mean, I'm not gonna now. I'm not gonna now. Nope, don't try it because I'm not gonna. But like, oh, you're the telephone repairman? Oh, great, you know? Anyways, so he tells her he's a telephone repairman. She lets him in.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

Once he's inside, I guess that's when he like cuts her phone line. So once he cuts her phone line, he then holds her up at gunpoint. And then, you know, he's able to get her, tie her up. she was able to like fight him off, but he's a big boy, big gross guy. So he takes a rope and he chokes her with it and he ends up choking her to death.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

So once she was dead, he took photographs and then he like rearranged her clothes. rearranged her body, took photos, then took photos of like her nude body, just all in different positions. And then he ends up leaving in Vicky's car. So he leaves in Vicky's car and while he's driving, Vicky's husband is like driving back to the house.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

So he spots Vicky's car and he's like, oh my God, is that my wife's car? And he couldn't make out who the driver was, but he's like, that's my wife's car. So Vicky's husband gets home. And that's where he finds his two-year-old son was alone in the living room. And he's like, what the fuck? And he's like searching the house.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

and he ends up finding Vicky on the floor behind the bed in their bedroom. So he rushes his wife to the hospital, but sadly, a few hours later, she was pronounced dead. So while this was happening, Dennis was like getting rid of, you know, any evidence and he parked the car a few blocks away from Vicky's home.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

Then he went to his house and he like changed his clothes, you know, got rid of any evidence on himself. So by 1991 Dennis decided that older women would be like better victims because to him they were more vulnerable than the younger women. So he's like I'm going to pivot now to more mature women. So on January 19th Dennis kills 62 year old Dee Davies.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

So this time Dennis like devised an intricate plan. He was on a weekend boy scout camping trip and came up with like an excuse to slip away. He then drove his car to his parents house to change into his hit clothes. Then

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

he left his car at the baptist church in park city and would then like carry out like the rest of his plan on foot so he went to dolores's house and waited outside until he could tell that she had fallen asleep then he used a cement block that he found you know he's like oh there's a cement block and he ends up breaking the glass on her back door because of this loud commotion Thank you.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

So he started communicating with media and police to let them know that like, hey, I'm still here. He wrote letters, sent photos and evidence from crime scenes. And, you know, he would send, like some would include driver's licenses of his victims. He even left random cereal boxes containing dolls bound with rope inside the cereal boxes. You know what I'm saying?

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. more concrete evidence to arrest Dennis. What'd they do Bailey? Well, hold on, let me tell you.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

And then finally though, his need for attention led cops to track him down, all thanks to a floppy disk and his daughter's pap smear. Oh, yes. So now let's like get into the nitty gritty of it all, shall we? So Dennis Lynn Rader was born on March 9th, 1945 in Pittsburgh, Kansas. But I guess he grew up in Wichita, Kansas. His middle name is Lynn. I was like, oh. Dennis Lin.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

He was the oldest of four boys and his mom worked at the local grocery store as a bookkeeper. His dad, his name was William, he was in the Marine Corps and then later he worked at the Kansas Gas Service Gas Distribution Center. But both of Dennis's parents worked long hours and I guess, you know, because they're working all the time, they didn't pay much attention to their kids. They're working.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

So police obtained a warrant to DNA test a pap smear that Dennis's daughter, her name's Carrie, she had done a pap smear at like Kansas State Medical Clinic. So they get her DNA and they test it and it reveals that there's a familial match to the DNA that was found under Vicky's fingernails, one of the victims. and this DNA match was enough to arrest Dennis Rader. Thank god she'd got a pap smear.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

I think I said this in one of my old videos but it's so true like if you ever get attacked and like which I hope never happens to any of us but if it does happen scratch the shit out of these people. Get as much DNA under your freaking fingernails as you possibly can. I'm paranoid as hell, but I'm always thinking about that. Like just scratch, just fucking scratch.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

I hope it never happens, but you know. So on February 25th, 2005, Dennis Rader was arrested while driving near his home in Park City. A police officer asked Dennis, like if he knew why he was being arrested. And Dennis responded with like, oh, I have a suspicion why. Oh yeah. Oh yeah, I hate him, he's gross.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

Various law enforcement agents, including Wichita Police, the Kansas Bureau of Investigation, the FBI, and ATF agents, They all searched his home, his vehicle, his church, his office at city hall and the main branch of the park city library. And there was a lot of evidence seized, but there were like, some of it was like black pantyhose, computer equipment, the trophies they found.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

And like the next morning police chief Norman Williams declared like to the public that the bottom line was that BTK was arrested. Little did they all know it was a guy that like everyone knew. Could you imagine? No, no. Couldn't imagine. It's like that guy? On February 28th, 2005, Dennis Rader was charged with 10 counts of first degree murder.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

And then a week later, news sources reported that Dennis had confessed to all 10 murders. His bail was set to $10 million. And there was like a public defender who was appointed to represent him. On May 3rd, Dennis was pleading not guilty. But then on June 27th, like the scheduled trial date, Dennis would end up changing his plea to guilty.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

Later in life, Dennis would say that growing up, he felt ignored by his mother specifically. And I guess he like really resented her for this. He attended Riverview Elementary School and Wichita Heights High School. I guess he wasn't like a really good student, you know? And it was said that he was more introverted and withdrawn, like his personality.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

And he would go on to like detail the murders, but he didn't apologize. Why would he, huh? Dennis's public defender had him evaluated by forensic psychologist Robert Mendoza to see if like an insanity defense was an option. Mendoza diagnosed Dennis with narcissistic... obsessive-compulsive, and antisocial personality disorders.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

He said that Dennis had a grandiose sense of self, believing that he was special and entitled to special treatment. Dennis had a pathological need for attention and admiration, a complete lack of empathy, and a preoccupation with maintaining rigid order. Dennis's evaluation by this Dr. Mendoza was filmed and that footage was like used actually in an episode of Dateline about Dennis.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

You can watch it on YouTube. During his trial, he made various comments and revelations about his victims. He said that the Otero family and Shirley Relford would serve him as sex slaves in the afterlife. Yeah, like really dude?

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

yeah really he also said that he would have killed um shirley's daughter but the phone ring and scared him off he was quoted as saying i probably would have hung the little girl okay cool thanks you know oh he also went on to say i'm pretty mean or could be but on the other hand i'm very you know i'm a nice guy what yeah That's why he said, I'm a nice guy. Okay, sure.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

Dennis went on to describe Nancy Jo Fox's murder as quote, perfect because she mostly cooperated and he had complete control over her.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

he also then revealed that he threw d davies was it d davies he threw her body under a bridge but returned to it later and when he did the body was like badly decomposed so because of this he placed a feminine mask over her face and then like photographed her body to use in like his scrapbook essentially he was like the face was ugly so i put a mask over it It's like, oh my God. Yeah. Yeah. Yeah.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

Dennis Rader was sentenced on August 18th. And at the sentencing, you know, the victim's families come up and they made statements pretty much saying like, F you dude. F you. How could you? And like, Dennis just like wasn't even bothered. And you know, then it was his turn, Dennis's time to like say something to address the court.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

And Dennis apologized kind of in like a rambling 30 minute speech, which like it's actually been described as an example of a phenomenon seen in psychopaths where they have an inability to understand the emotional content of language. Dennis Rader was sentenced to 10 life sentences with a minimum of 175 years.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

Now at this time, there was no death penalty in Kansas, but since they've actually reinstated it, put him down, I say, put him down. They reinstated it after like they caught the worst guy ever. So that's cool. Dennis is still alive, you know? Yeah, to this day, he's like in solitary confinement for his own protection.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

He gets one hour of exercise a day and he gets to shower at least three times a week. His cell is pretty small and he refers to his cell as his cave. And he has like no contact with other inmates because like, they most likely would kill him if they had access to him would we be mad is that up no come on no he's up we wouldn't be mad we wouldn't be mad We wouldn't mind. I'm sorry, that's mean.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

And while still in grade school, Dennis developed sadistic sexual fantasies that involved torturing, quote, trapped, and helpless women. Yeah, in grade school. Who the fuck? Forensic psychologist Dr. Tony Rourke, who evaluated Dennis after he was caught, believed that Dennis must have like had an early childhood experience that tied his sexuality to watching like a living creature suffer and die.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

Not really. So forensic psychologist, Dr. Catherine Ramsland, she actually was talking with Dennis for over six years while he was in prison. And together they created what she called a, quote, guided autobiography. It's titled, Confession of a Serial Killer, The Untold Story of Dennis Rader, the BTK Killer.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

And in their communication, they developed like a code, a codex is what he liked to call it, which allowed him to like write freely about his victims.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

And sure, okay, you know, and like it was said like when this doctor was like corresponding with Dennis, she said it was like really challenging because like at one point Dr. Ramsland had asked Dennis to describe one of his torture fantasies and in return like he didn't and said he sent her a 14 page letter along with like newspaper clippings, photographs and recipes.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

as well as like a key to help decipher clues. So he was like playing games with her. He was like, girl, what did you expect? That he was just gonna be like open and like tell you everything, you know? Like, of course he's gonna play games. He's bored as fuck. He's locked up all day and someone's interested in him. Someone's stroking his ego a little bit. Of course he's gonna be a dick.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

But anyways, Dr. Ramsland, she concluded that this was his way of like retaining control. She said she managed to like learn a great deal about his inner life. Like he apparently fixated on anything bound or knotted. And he loved abandoned silos, referring to them as castles. And he loved the number three. And his favorite color is purple.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

kidding i don't know that but like his favorite number is three wow you've learned so much she also said that he created an image of himself as a hunter or like a predator he even referred to the killer inside of himself as the minotaur so he said at times the minotaur would go quote dark he would say that all his violent crimes and his sexual tendencies were all because of this minotaur

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

And he claimed that he started out as like, like he referred to himself as like white hat, but then periodically would be dragged to the dark side. Such a fucking eye roll. Okay, sure. Apparently like as a child, the sight of chickens about to be slaughtered aroused him, he went on to say. He told the doctor that like he fantasized about tying women down onto train tracks.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

and like would masturbate to his father's book about the lonely hearts killer. And Dr. Ramsland explained like a lot of readers writing was often boring and like run of the mill, but then all of a sudden it would like slip into some really dark shit, which is like, sure, I could see that, right? Sure.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

As Dr. Ramsland put it, quote, and all of a sudden you feel like you're suddenly in minotaur territory. It's almost like you're paddling at the surface of the water and suddenly something pulls you down, end quote. Yeah, I could see that, sure. Okay, she also learned that he kept keepsakes from all of his victims and he would hide them all around like Wichita in what he called hidey holes.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

Apparently at every victim's home, he would like go through all their stuff. He would take jewelry, lingerie, IDs, and other items that he would keep for memories. Or like, you know, people refer to them as trophies. It was said that Dennis was motivated to work with Dr. Ramsland because he wanted to uncover what made him go dark. But Dr. Ramsland concluded it really wasn't anything that unique.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

Like he came off very desperate. Like he desperately wanted to be seen as someone who was very complex, special, and mysterious. But, you know, like he wasn't. He wasn't. She attributes his psychology to what she calls the trajectory toward violence, which is a combination of sexual impulses, desire for fame, delusions of a double life, intersecting with the opportunity to commit murders. Damn.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

And that my friends is today's case about Dennis Rader, the BTK killer. There's so much to this guy. And honestly, he terrifies me, which I hate giving him or any murderer, any type of credit or power over my psyche. But this type of guy like freaks the shit out of me because like no rhyme or reason, he would just spot you and be like, you, you're next. And that is scary. I don't like that.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

I don't like this guy. He was sick and he was living this full on double life. Like he had a family and everything and they swear they didn't know anything. And if you watch interviews and stuff, I believe it. I believe it. Like he seemed like this great loving dad who like liked his kids and shit. And he was doing some horrible stuff. I just like could not fucking imagine. Could you imagine? No.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

Uh... You think, maybe? Yeah, that's what they think. In this doctor's opinion, after whatever that first event was, he must have nurtured and encouraged those feelings in himself. I couldn't find anything like Dennis himself saying like what happened, but obviously I think it's safe to say he was introduced to something very young, right?

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

No, just one day you wake up and like everyone's telling you that your husband is like this absolute psychopath. What? Oh, I feel so bad for the family. What a mindfuck that would be. right? And then this dentist guy is just a loser. He's just a loser who wanted attention and was sick and is just a fucking loser. Scum on the bottom of our shoes. Sucks.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

Wish they killed him, which is like, oops, sorry, I shouldn't say that, but like, you know, they should have. So how do we end it, friends? I don't know. This is one of those stories that reminds me to be like aware, aware of your surroundings, lock your doors, be careful, snooping your husband's shit if you have to. He's alone in the basement or something. What are you doing? What are you doing?

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

Just make sure.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

She's like, damn, you can't trust anyone, huh? That's lame. So yeah, that's that, huh?

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

sheesh yeah yeah I know I kind of left out I'm sorry I did leave out a lot about like the family the personal life and stuff sometimes I just don't know if I include it or not I don't know it's about the guy I don't know well I hope you have a good day today you make good choices please be safe out there yeah I appreciate you guys so much and I hope to see you next time okay okay bye

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

By the time Dennis hit puberty, his fantasies became like more elaborate and explicit. He was quoted as saying they were quote, almost like a picture show that he wanted to direct and produce. There was this actress on the Mouseketeers. Well, do you remember the Mickey Mouse Club on TV? If you don't, that's okay. It was an old show.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

And there was this actress, her name was like Annette, but Dennis like would watch the show and he would see this Mouseketeer and would visualize, like she was the main character

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

person starring in his dark fantasies well when Dennis was young he participated in you know Boy Scouts and various activities through the Lutheran Church and as a Boy Scout unfortunately he learned how like how to tie different knots you know with rope which would like go on to be part of this process of torturing and murdering his victim. So that backfired.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

Today's story has been heavily recommended. I've been avoiding it because this guy scares the crap out of me. Crap out of me. Yes, but I'm doing it for you. Today we are talking about the notorious BTK killer. I learned too much about this guy.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

Dennis went to college for about a year, but then he dropped out. I don't know. He was over it. And then he ended up serving in the US Air Force from 1966 to 1970. And I guess like during that time, he was a perv. He would peek through like window blinds to watch women undress. and would even sometimes break into like their homes when they weren't there and steal their underwear. Yeah.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

After the Air Force, Dennis moved to Park City, which was like just outside of Wichita. And when he was there, he worked in the meat department of the IGA supermarket. And this is like where his mom had been working as the bookkeeper. Then in 1971, he married a woman named Paula. And they went on to have two children together, a daughter named Carrie and a son named Brian.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

So like, as all of these stories usually go, it's like from the outside, it's like, oh, this, you know, all American family working at the local supermarket, raising their kids. Nobody thinks a damn thing. You know what I hate? Figuring out what to eat for dinner. Every week it's a struggle, every day. I know, look, if you leave it up to me, I'll just eat cereal, okay?

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

After a long work day, I mean, I don't really wanna cook a big, complicated meal with measurements. And I know I'm not alone in this, but now you can get dinner done the easy way, thanks to HelloFresh. HelloFresh is America's number one meal kit. Their new ready-made meals goes from the fridge to your fork in just three minutes.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

I mean, that's less time than it takes for me to make myself a bowl of cereal, let's be real. Their ready-made meals offer the same high-quality ingredients and restaurant-worthy flavor you expect from HelloFresh, just with none of the work. You literally just heat, eat, and enjoy. It's like your favorite microwave meal from the grocery store, but better.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

Plus, it gets delivered to your house, so it's very convenient. My personal favorite ready-made meal is a Southwest inspired chicken bowl. It's almost like a chicken burrito with beans and corn and cheese. Oh, it's so delicious. Beep, beep, beep. I'm heating one up right now. Get up to 10 free meals and a free high-protein item for life at HelloFresh.com slash Makeup10FM.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

One item per box with active subscription. Free meals applied as discount on first box. New subscribers only. Varies by plan. That's up to 10 free HelloFresh meals. Just go to HelloFresh.com slash Makeup10FM. At some point, Dennis, he would enroll in the local community college. I mean, he's smart because he went to like Butler County Community College in El Dorado.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

And he earned an associate's degree in electrical engineering technology. So it seems like he wasn't dumb. You know what I'm saying? During this time, he was also continuing to act on his sexual fetishes of voyeurism. Voyeurism? autoerotic asphyxiation and cross-dressing, like low-key, you know, no one knew.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

And the reason like he grosses me out the most is because he's one of those killers that like just would find someone and be like, that's who I'm going to kill next. And like, that was it. You know, where a lot of the times when we talk here, it's kind of like people that the killer, like, knows or they're close with, where this guy was like, that person. I'm going to do that person.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

It was said that he would also spy on female neighbors while dressed in women's clothing and then would masturbate with ropes or other bindings around his arms and his neck. Yeah, he was a little extreme, huh? He also engaged in what's known as zoo sadism. It's bad. It's the torture and killing of small animals, like dogs and cats. Yeah, so he would like do that.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

He would strangle and hang animal victims. Ugh, this is like the worst of the worst. Dennis would later say that he was obsessed with pornography. Like in his free time, if he wasn't killing animals or peeking on the neighbors, he was looking at porn. And he even had like a special nickname for his penis. Yeah. He named him, his penis, Sparky. Sparky.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

And whenever he would get aroused, he would call it Big Sparky Time. So there's that. There's that. Sparky. All right. You know. All right. There was debate over like how others saw him. Some described him as well-mannered, polite, and normal. And others said that he was obsessive and like extremely strict. So it was like You know, I don't know.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

He was apparently known to like bully single women and he killed a neighbor's dog for no reason during his time as a dog catcher. Cause he was like a dog catcher for a little bit. I think it's safe to assume he just really liked control and power. In 1973, Dennis was working for that aviation company and then he got let go. And this event seemed to like give Dennis

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

a lot of free time it was said that this thrust him like deeper into his violent fantasy life with too much free time you know what they say the devil's got work for idle hands and boy He had some idle hands. Like, I guess he started to crave knowing what it would be like to act on his sadistic impulses. Like, I don't know, you guys. He must have hid this so well from his family.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

I mean, I watched interviews and stuff and like the kids were like, yeah, he did hide it really well. But it's like, I don't know why. I don't know why. I'm not trying to like say I don't believe them or anything, you know? But like, if you're married to someone, how do you not see little glimpses of like, he's fucked up. Something ain't right, you know? I don't know.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

It's just scary to think you can marry someone and they could be this fucking bimbo. So Dennis began to quote unquote troll women, which meant he was like casing neighborhoods and school campuses where he would find a prospect, stalk them, and then develop like an elaborate fantasy of sex, and murder around them. So Dennis had his thing.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

I mean, you'll see as we get into all of the different murders that he did. He had his thing. He would routinely bind, torture, and strangle his victims. And most of them, majority of them were women. He had, I guess, like a crime kit. And in this kit, it was a gun. There were knives, hoods, cords, tape. plastic bags, gloves, and like various tools that he would use to break into people's houses.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

And, like, it's scary, you know. Okay, so BTK killer. Between 1974 and 1991, Dennis Rader brutally murdered 10 people, including... two children, mostly by binding, torturing, and killing them, which gave him the name BTK. Bind, torture, kill. Yeah. Dennis Rader, he lived quite the, he lived a double life. Like on one hand, he was president of his local Lutheran church council.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

And again, I mean, I think it's obvious, but he really put a lot of thought into this. When he would arrive at victims' houses, he would cut the phone lines and either just knock on their door or break into their homes. he would often like hold his victims up at gunpoint and just kind of, well, yeah, he would force them to obey.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

He would often lie to the victims telling them that he was a quote unquote wanted man who was on the run. Sometimes he would leave evidence at the scene like semen, but at the time it was unclear like what kind of sexual acts were involved in his killings. And you know, there was no like DNA testing or anything like that yet. So the semen like,

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

They're like, there's semen, too bad we can't do anything with it. And then in some of his later murders, he would transport the body from the scene of the crimes. The Oteros were a Latin family who had just moved into Dennis's neighborhood. And the family compromised of Jose Otero, who's 38. his wife, Julie, she was 33.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

And then they had five children, including Josephine, who was 11 and Joey, who was nine. Now, Dennis, he was watching them for a little bit before deciding like to, you know, Murder them? Okay, great. Before the murders even took place, Dennis stalked Julie and Josephine for weeks to like learn their daily routines.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

What they were doing each day, where they were going, when they would come home, when no one was home, you know, all of that. Yeah. So once he like followed them for a while, figuring out what their routine was, he devised a plan to like surprise Julie and Josephine at their home. On the morning of January 15th, 1973 at 8.20 in the morning,

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

Dennis, he broke into the Otero, their home, but he was surprised because he saw that Mr. Otero and Joey were at the home, but the other three kids, they were at school. And like, normally they weren't gonna be there. You know, he had been following them. This was not their routine. So he was like, what the fuck are these people doing here? But it didn't matter.

Murder, Mystery & Makeup
Bind, Torture, Kill: Who was the BTK Killer?

He went ahead with the crime anyway. Dennis started off by telling the four Oteros that he was a quote, wanted man. and then led them into the bedroom at gunpoint, where he tied them all up with rope that he had prepared. Joseph and Joey were put on the floor while Julie and Josie were on the bed. Dennis restrained the wrists and the feet of the parents.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

Hi friends, how are you today? My name is Bailey Sarian and today is Monday, which means it's Murder, Mystery, and Makeup Monday! Okay. Hi, if you are new here, hi again. My name is Bailey Sarian and on Mondays I sit down and I talk about a true crime story that's been heavy on my... noggin, and I do my makeup at the same time, you know, to keep my hands busy.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

It was said that Phoebe had two phones. She had the iPhone, which she threw, whatever. And the iPhone, it technically belonged to aunt. Like it was his phone, but she was using it. I guess it's like a girlfriend perk. Like you can have my old phone. Like that was kind of the vibe I was getting. And then she had her old Nokia phone. I think that was like her main phone, whatever.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

Her Nokia phone has actually never been found. No one knows where that went. It was said that Phoebe didn't return to the apartment that night. She was really angry, you know, which is probably for the better. She ended up driving out to her mom's house.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

Her mom was out of town, but she hung out with her mom's partner and stayed up talking just about her crappy relationship and how unhappy she was. Then, based off of phone records, Phoebe had returned to her apartment by Tuesday morning after aunt had left for work. So Phoebe must have been feeling some type of way the next morning because on Tuesday,

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

She had made a couple of phone calls to a crisis line at Alfred Hospital. Then she called her psychiatrist. Her psychiatrist later testified that Phoebe told her on the phone that she was extremely distressed about her relationship issues, that she was drinking heavily and that she felt unsafe. This is what the psychiatrist said. And I was like, damn, like,

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

Shouldn't the psychiatrist have helped a little bit more? I guess, I don't know. I don't know. Maybe I'm expecting too much. Just feels like if a client of yours says like, I don't feel safe, that would be a red flag. But I don't know, it doesn't matter. So she makes these phone calls. I guess nothing really comes of it.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

Then before 4 p.m., Phoebe sent out a text to her grandmother, Jeanette, telling her that she would call her the next day. In a later interview, aunt said that when he got home Tuesday, he had taken Phoebe's iPhone and took it to like a repair shop that was close by because she had broken it from throwing it. But that's why she wasn't returning anyone's phone calls and stuff. That's what he said.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

So December 2nd, In the morning, it was like 8.30, nine o'clock, aunt had left the apartment for work. This is the day she passed away. This day she had plans to have dinner with her father. It was his birthday, like a couple days ago, and she wanted to have dinner with him, and they were gonna meet up at some restaurant. and have dinner together.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

It was noted that around 8.45 in the morning, she had sent out an email and used the computer inside the apartment a couple of times. And then again at 11.43 in the morning, that's when the fire alarm went off. So she had left the building, you know, She had returned to the building at like 1150. And once returning, she went back to the 12th floor apartment. Again, she used the computer.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

And they were able to like track like computer movement and stuff. Then between the hours of 12 p.m. to 7 p.m., Again, nobody knows what the hell was going on. It's very unclear. Ant had come home to the apartment at 6 p.m. He was driving a Range Rover. He pulled it into the building's basement garage. Ant then took the elevator and led himself into the apartment.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

Now, when he gets to the apartment, he couldn't remember if the front door was locked when he arrived or unlocked, but what he did remember was walking into the apartment and his dog, Yoshi, greeted him. But then he looks around and he notices that the apartment was just a hot mess. There were shards of broken glass on the floor.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

She was born May 9th, 1986 in Melbourne, Australia to her mother, Natalie, and her father, Len. Len was a psychiatrist and he had for a long time, he had been a psychiatrist for like 40 years now. She had two younger brothers named Nikolai and Tom. Yes. And the family lived in Richmond, which was like a suburb of Melbourne.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

He said it smelled like incense either were burning or had just been burning. The living room pillows were ripped. There were two wine glasses on the table. What was most concerning was that there was blood spattered across the keyboard and computer. It's like, uh, what?

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

Then he said he peeked into the bathroom and that's when he saw that on the floor was Phoebe's hair straightener and it was still plugged in. I know. If the hair straightener is plugged in and it's on the ground, you know something went down. So on the kitchen counter was Phoebe's purse, wallet and her keys, but Phoebe was nowhere to be found.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

Now, according to aunt, everything is according to aunt. There were several like post-it notes with strange scribbles all over the kitchen counter. He knew that this stuff was, the post-its were new because the house cleaner had combined, like cleaned everything the day before. So they were recent. Ant said he went into the bedroom and he found what he called a shrine on the bed.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

I don't know if I believe him on this one. There's no pics, but sure. He said there's a shrine. He said that on the bed, there was like a photo of himself and Phoebe and a photo of her cat. And what he later described as rambled notes, the notes she writes when she's smashed. They don't make a lot of sense. That's what he said.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

So the apartment was concerning and Phoebe was gone, but, and he carried on with his night. Like everything was normal. Listen, he got some beer. He made a couple of phone calls to like friends and coworkers. And then he ordered some food delivery, you know, which is so weird, right? Like even if everything was totally fine, let's say nothing bad even happened.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

When you get home, wouldn't, like, the first thing you do if you see broken glass on the floor, you would clean up the broken glass. Right? You got a dog. Your dog might walk in it, spread it around everywhere. It's going to get in your feet. Ugh, that's the worst when you get some glass in your foot. He didn't. He just, like, leaved everything as is and went on with his night.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

I think it was intentional, but... I don't know. Then at 6.51 p.m., it was like 40 minutes had gone by, okay, since aunt had come home. So Phoebe's father is calling Phoebe's iPhone. Len and aunt have different memories as to what happened next. So according to Len, Phoebe's father, Ant answered his call on Phoebe's iPhone.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

Len said that he was calling Phoebe's phone to let her know that he was running late for dinner, but it went to voicemail. Within one minute of her dad's call, Ant, for the first time ever, called Phoebe's dad. So Ant tells Len that Phoebe's phone was not in the apartment, but he just so happened to call her dad the same minute he called her. Does that make sense?

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

Ant said like it was just like an odd coincidence. It's a weird one though. So on the other hand, Ant said that he called Len from his own phone a minute later because he thought Phoebe might've like gone to meet Len and that he didn't know it was a minute later because he didn't have the phone. It was just a weird coincidence. That's crazy. Wow. The universe is so weird, right, everyone?

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

Regardless of who called who, when the both of them talked on the phone, Len had explained that he was trying to call Phoebe because, you know, they made plans to have dinner to celebrate his birthday. And they were supposed to meet at one of Phoebe's favorite restaurants. It's called the Golden Triangle. And Len was calling to say again that he was running late. But Ant told Len over the phone,

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

Now, growing up, it was said that Phoebe was known to be a free spirit, a wild child. She had a really active imagination. She loved being active herself, like going outside in nature or going to the ocean. She was also an avid climber and a martial artist. I know, she's doing a lot. On top of all of this, she was artistically gifted and very creative. In school, she was very popular.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

she's not here. And then he goes on to say her bag and her keys are here. So like, she can't be too far away. So Len was worried when aunt said Phoebe wasn't in the apartment and Len tells aunt that maybe he should report her missing. And aunt again on the phone, he's like, mm-hmm. He tells Len, no, I'm not gonna report her missing. Like it's not necessary.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

They don't listen until 48 hours have passed and she'll be back by then. Everyone seems to always believe, I don't even know if that's true anymore, the 48 hours thing. Anyways, but he was like, no, no, it's fine. Meanwhile, between 7.04 and 7.11 PM,

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

a concierge at the valencia apartments downstairs main lobby were there concierge was like i need a broom they gotta do some cleaning duties okay so they go looking for a broom and they try to open the door the door that's gonna lead them to the room and this door was stuck right stuck not moving so then after a couple attempts to open the door

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

That's when this person comes across Phoebe lying in a pool of her own blood besides the garbage bin. Oh, horrible. Could you imagine? No. I was gonna say, could you imagine? No, I couldn't imagine. That'd be awful. I'm going out of town, which means it's time to pack. And let's be honest, you know, my old t-shirt from 2005 and like my jeans and stuff are the most comfortable.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

But sometimes I have to dress to impress people. Not my specialty. Stitch Fix is an online personal styling service. So when you sign up for an account, you get assigned a stylist who learns all about your style and your budget.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

And once they have all of that information, they go out to work figuring out personalized pieces for you in just the right size, your needs, your concerns, whatever, and they do all the shopping for you. I love that. The stylist feature is such a huge help for me personally because they really go out of their way to find pieces that not only look great but feel great for me, you know?

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

Plus Stitch Fix doesn't force a subscription service on you. You can order boxes when you want and how you want. So there's no subscription required. You can keep what you love and then you send back the rest. I mean, it's so easy. They even send you like outfit recommendations and styling tips. And that helps me a lot. I'm a visual person.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

Sometimes I just need someone to tell me like what to wear. Now maybe you're like me a little. I know it's a rare thing to say, but I actually hate shopping. I hate shopping, okay? So that's why I love Stitch Fix. Because no stores, no crowds, no bad dressing room lighting. Ugh, you know? Just personalized looks that you can try on at home.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

And again, keep what you love, send back the rest if you don't. Personal styling for everyone. Get started today at stitchfix.com slash makeup. That's stitchfix.com slash makeup. Obviously, the first thing they did was dial 000, which is equivalent to 911. 000 makes way more sense. It's easy. It's right there, 000. I don't know why they make us do 911. Like, it's not 000 makes more sense.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

Thank you. So the police end up showing up and they were given the keys to the garbage room where again, it appears Phoebe had just plummeted 40 meters to the ground floor. She must have like landed in the garbage compactor, leaving her with several injuries and almost a severed foot. They came to the conclusion that like

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

Phoebe, when she landed, she was still alive because around the garbage bins, there were blood smears where she must have gotten her strength to get up and crawl out of the bin. And then she was bleeding to death while she struggled to find the exit. Poor thing. It's so sad. So an ambulance was called at 7.20 p.m., which was like 20 minutes after Phoebe was initially found.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

So the paramedics arrived seven minutes later. And... The presence just seemed to add like chaos in this relatively small foyer and the corridor area that led to the garbage room. So one of the paramedics, her name was Christy and she was told by police that the room was a crime scene and she was not like allowed to enter the area.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

Now this went against like all of Christie's training and instincts, but still like there was nothing she could do. I mean, the police were in charge and they wouldn't let her enter. Christie wasn't happy about being prevented from trying to help. And it was said like, well, she later said she lost a lot of sleep over it.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

She loved socializing. She liked being around her peers and people just overall really seemed to like her. She played on like a basketball team with some of her friends and she was very competitive. She was really good too. She would like zip from one side of the court to the other and like she was unstoppable on the court.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

and that there were like no reports that anyone laid hands on Phoebe to see if she was still warm or to check like if she was actually dead, which is fucked up. But the room was considered a crime scene. So police didn't allow anyone in until the crime scene specialist arrived, which was like hours later. So not long after one of the managers of the apartments shows up, his name was Eric.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

So this Eric guy, he goes up to police and he's like, hey, you know, we have CCTV footage. You know, maybe you guys want to get that or I can give that to you and it would help with like the situation. Eric also told the officers that they would have to act quickly because the camera footage operated on a two day loop, meaning that it would record over previous footage every two days.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

So Eric said in an interview, Quote, I suggested to the police that if they needed any CCTV, they should start downloading. He also said, quote, they didn't really respond to me suggesting this. Thank you, Eric. So the cameras kept running. Police told Eric, like, we'll let you know if we need the footage. We'll call you pretty much.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

So then two days go by and of course the police are like, hey, can we get that CCTV footage? It's not funny. It's just stupid, right? Yeah. Obviously the tapes had filmed over. Some of them had at this point. So they were able to get like three or four of the camera footage from like the 16 cameras. Yeah, the rest had been filmed over with like new footage.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

Meanwhile, all this is going on downstairs and was just completely unaware, living in his own little world, you know? So again, he ordered some takeout. He actually ordered takeout from the Golden Triangle, which was like the restaurant Phoebe and her dad were supposed to go to that evening. Don't you think that's a little weird? I thought that was a little weird.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

Like, why wouldn't he just go with them? Or was he trying to make it seem like he didn't go with them? I don't know. I might be overthinking it. I just thought that was weird. So he ordered delivery just for himself and the food arrived just after like 8 p.m. The food was delivered to his apartment. knock, knock, knock, your food's here.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

So Ant answers his door and the food delivery man asked Ant like, hey, what's going on here? And Ant was like, what are you talking about? Like, what do you mean what's going on? And then delivery man was like, out front, like the front of the building is swarming with cops, there are police cars, ambulance, like I had to prop my bike up on the street.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

And then he left it with like, I hope your food isn't cold. So Ant takes the food, he brings it inside, he puts it down, he had said downstairs, where he sees a bunch of police officers and stuff. And he goes up to one of the detectives and he's like, what's going on? So this is when the senior sergeant told aunt that a woman's body had been found in the trash compactor room.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

Apparently aunt had followed that with, oh no, my girlfriend is missing. Could it be her? My acting kind of sucks. Oh no. So aunt like starts to ramble. I think he's in a panic, you know, because his girlfriend is missing. But he tells the sergeant like, oh, my girlfriend's been missing all day. I've been at work. I was trying to call her every couple hours. I got no response.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

It was also said that Phoebe was quite cheeky and playful, and she had a really funny sense of humor. But on the other hand, she could be extremely sensitive, compassionate, and also quick-tempered. Phoebe was known to feel things pretty deeply. I was trying to think, what do you call that? an empath, right? I think she would like feel deeply. Okay.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

He also tells the sergeant like she's suffering from depression and taking medication and that she wasn't home when I got home. I tried calling her, no answer. Sometimes she disappears. Like, I don't know, maybe she'll turn up. Just list of things. Like, okay. He even tells the sergeant about the post-it notes. He's like, yeah, and then she left some post-it notes.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

I have no idea, like, where she went. Anthony goes back up to the apartment to grab, like, a recent photo of Phoebe so, you know, they could ID her. So when Ant shows the image to the sergeant, that's when they confirm, like, we think... This is Phoebe. So the sergeant and another detective, they go up to Anne and Phoebe's apartment to examine the area and the surrounding area.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

This is where the police completely flopped. The detectives noted that there were several interesting factors. There was some broken glass and some blood on the floor. The post-it notes were strange, allegedly left by Phoebe. And it was also strange that the dog was in the process of ripping up another cushion. They were like, noted.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

The two detectives also searched the entire 12th floor and found blood on the floor of the refuse room where the garbage chute was located. They also found a mixture of DNA from at least two people who was in the bloodstains. on the inside door of the ground floor refuse room. So they find all this like blood and stuff. And like, I don't know, they didn't test any of it. I don't know. None of it.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

So again, they also found blood around the apartment itself, like near the computer. Now, the police, they took some photos, but for some reason, they didn't take pictures of everything. They took like three photos, it seemed like. Also, they didn't test for DNA on that blood either. Police didn't take any of Phoebe's or Anne's devices. None of the laptops... or cell phones were examined.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

There were also large shoe prints that were leading away from the apartment that was noted, pointed out, but no photos and no samples were taken. Okay. I mean, it could have been hers, but like based off of what I was reading, didn't seem like it was hers. It seemed like they were like questionable shoe prints. So again, it was noted that there were two glasses on the kitchen counter area.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

One appeared to have wine in it. The other one looked like it was kind of empty, but there were two glasses. So a lot of people think there were two people. Honestly, when looking at the glasses, I was thinking one kind of looked like it would have hard liquor in it. And the other one was like a chaser. That's what kind of reminded me of, but like either way, Thank you. Thank you. Thank you.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

Thank you. Thank you. Thank you. Thank you. Thank you.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

And I think a lot of the times when you are a person like that, who just feels a lot, it can lead to depression, you know? So Phoebe, she really struggled with that too. It just seemed like Phoebe had a lot of emotions as we all do, but you know, she felt a lot.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

cle cleacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacac cle Athletacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacac cleac cleac cleac cleac cleac cleac cleac cleac cleac cleac cleac cleac cleac cleac cleacacacketacaceni����������������������������������������������������������������������eniket

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. and his stepmom was a county court judge. So yeah. Then in August, 2013, a coroner's inquest into Phoebe's death was launched. They finally decided, okay, fine, we'll look into this.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

Well, when Phoebe became a teenager, things got a little funky as they do with like, you know, a lot of teenagers, they go through that phase. She started experimenting with drugs and alcohol at 15. And, you know, to her parents, it was very troubling. She was acting out. It wasn't good. At one point, I guess she had like run away from home and she went to go live with this guy.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

If you're interested in true crime and you like makeup, I would say subscribe. So today's story is definitely one that's been heavy on my noggin because, I mean, jeez, this story is so weird. So weird, oh my god. Has kept me up so many nights because it's like you're trying to piece it all together to make it make sense, and none of it makes sense.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

Unsure how they met and stuff. So it doesn't matter. But she went to go live with this guy who was like an ex-convict. and he was living with his kid and she went to go live with him for like eight weeks

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

teenagers um again not sure how she met this guy but like that happened i guess eventually phoebe had she came home and then she got onto some antidepressants in hopes just to get her back on track and whatnot and um she did she like she seemed to get back on track but then not long after she met another guy this guy was like twice her age and worked as a teacher and i guess they started dating for a while

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

So obviously like Anthony's attorney objected to the notion that Phoebe was murdered. He was like, no, look at what everyone else said. And during the inquest, coroner Peter White had testified Once again, that Phoebe sleepwalked herself right into that shoe. But there's a detective, his name is Detective O'Brien. He was actually with Aunt the night of Phoebe's death.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

And he testified saying that Anthony's demeanor at the time was strange. I was like, go on, yes, what about it, what? In a statement to the court, Detective O'Brien said that he remembered Aunt cried, but that there were no tears running down his face. nor did it appear that there had been any at all. He added that Ant was sniffling, yet there was no sign of mucus or snot coming from his nose.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

He also said that his eyes were not bloodshot or red and his face appeared quite normal. Mm hmm. Again, that night, like police officers went to Ant and they were like, hey, we need to like get your statement. And Ant Tripp told the officer, oh, I can type the statement up myself. He told the officer, like, I'm a really fast typist. I could just type it for you really quick.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

And the officer was like, okay. And he said, the officer said that as soon as Ant started typing his statement, he immediately stopped crying and appeared calm and composed. There was someone else who like came forward and said Ant was being weird. One of his longtime friends, her name was Vanessa Levin. She was shocked at his unusual behavior after Phoebe's death.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

She said that he appeared to enjoy all of the people that were coming by his apartment, saying that he was lapping up the attention. This friend also said that while she was visiting aunt, he would be totally fine, normal. Everything was great. He was scrolling on Facebook, answering emails.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

But still, regardless, I mean, she was very protective of her family. She loved her brothers. And she had a very special and close relationship with her grandmother. And I guess she would confide in her grandmother pretty often. Well, despite like these rocky years, Phoebe, you know, she still had like bigger plans for her future, goals in life.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

But then as soon as like a visitor came by, he would go to the couch, grab a pillow, go into the fetal position and just cry. Do we expect him to be crying all day, every day? No. But this friend was saying that, it seemed like he was turning on and off his emotions. You know what I'm saying? It seemed like a performance a little bit.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

Now, when Phoebe's grandmother, Jeanette, came over to the apartment, she said something was off. She looked around the apartment and she was like, there is nothing around this apartment that even belongs to Phoebe or shows Phoebe's personality, which you would assume there would be traces of your existence in your apartment that you live in, right? She said there was nothing around the apartment

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

that was a Phoebe's except for carefully arranged photographs of aunt and Phoebe that were like laid out on the table. She was like, this is weird. Cause Phoebe liked to paint. She was a colorful person. Like, you know? So she was just like, this is weird. So there was another friend. This one's weird. It was aunt's friend. His name was Christo.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

I guess they were, they were like work colleagues and it was said that their relationship was only professional, but many disagree that it was only professional, they seemed extra friendly. Like there was many photos of them on Facebook that made them seem like they were really good personal friends.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

Like there's photos of them on a yacht in Europe and the two of them would like engage in some banter in the comment section. People were like, okay, but that's not the point. The point is that Christo would go to Ant's apartment concierge office and go speak with the lady who initially found Phoebe's body. Why?

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

Well, Christo had showed up with like a bottle of wine and some chocolate for the woman and then started talking with her about Phoebe's death and how she struggled with depression and that aunt tried to help her, but that Phoebe didn't want to be saved. Like going on and on about it. Yes, this guy, this random ass guy. Huh? This friend was telling the concierge lady like all of this.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

Now, I guess it was said that Christo had visited the concierge like every second or third day for about two weeks and was like having the same conversation. Weird, right? So after so many visits, the concierge pretty much told him like, don't come back because you're upsetting me. Like, I don't want to talk about this with you. So they told him not to come back. Isn't that weird though? Right?

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

Like, what was that about? What was that? I mean, it's not illegal to do that, but like, you know. When Ant was like asked directly whether he had any involvement with Phoebe's death, he said, absolutely not. Just had to throw that out there. He did deny it. He told everyone that Phoebe was depressed. She was drinking a lot. She was borrowing money from him. And like, maybe it was suicide.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

Like maybe she was over it. Like Ant mentioned though, that before her death, he had bought tickets for them, for him and Phoebe to go to Paris together. Like the next month, it was like three weeks.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

and that it was something that she was looking forward to and like this was confirmed by phoebe's family that aunt had purchased tickets to go to paris with her so she had told one of her family members that she wanted out of the relationship but she was gonna like suck it up until after the trip I say that only because it was kind of like part of their defense.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

Like, see, she didn't want to have killed herself. She was making plans. You know, I don't know. Because Phoebe's death was initially listed as a suicide, this prevented further investigation or investigations, like trying to access and analyze Phoebe's computer and emails.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

And Phoebe's parents were finally able to like access her Gmail account, only to find out that all of Phoebe's sent emails had been wiped out and deleted. So aunt had a sister. Her name was Chrissy, but apparently she had a pretty close bond with Phoebe. Like they're close. So Chrissy is a hample, meaning she has powerful parents, but Chrissy was like a bad egg. She would sell drugs.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

Like one of her goals was to travel and go to India and like do aid work. So life carried on, you know, and Phoebe, when she was 23 years old, she got a job working as a receptionist at Lindley Godfrey Hair Salon in South Yara. While she was there, she was working there, you know, and like that's where she met 39-year-old Antony Hample. Everyone called him Ant for short, so I'm gonna call him Ant.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

She would get into trouble, you know, but she would sell like drugs to aunt's friends and like some people in Australia's high society. And Phoebe was aware of this, you know, I think everyone maybe was. But after Phoebe's death, Chrissy, she got arrested and was facing drug trafficking charges.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

But because of her family, they had a lot of power and a lot of influence and they were able to evade a conviction. So she was let go. But then in 2016, Chrissy went on Facebook and I love when people go on Facebook and just say wild shit. But she went on Facebook and she posted a picture of herself and Phoebe.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

And then she wrote in the caption, like, in loving memory, I stumbled across my favorite pic of beautiful Phoebe. I miss you, darling. You were a fragile little flower that no one watered. You and your family were let down by the justice system and those who represent it. I only hope that one day the truth will come out so that they will have some peace. Ooh, the truth, the truth will come out.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

Interesting. So, you know, after a year and a half into like their investigation called an inquest, they came to the same conclusion that, Phoebe had either committed suicide or it was a freak accident and Anthony was off the hook. So nothing came of it. Anthony was never charged or even considered a suspect. To this day, the case remains unsolved. The courts and all that will say it's solved.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

They'll say, yeah, it was a suicide or whatever. But to many, it's unsolved. And to her family as well, they continue to search for answers. Because it's all so weird, right? But then it leads us into one other little situation. So there's this girl named Bailey. She's 25 years old. She lives in Melbourne, Melbourne, Melbourne, Australia. There's some similarities to Phoebe's story.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

Bailey was known for like being outgoing, fun, beautiful. She was a model. She did, she did stuff. So then this leads us into our, like our little other mini story we got going on right now. 25 year old Bailey Schneider. She was kind of similar to Phoebe in some ways. She had an active social life. She was very popular. She was gorgeous. And people seemed to really love her.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

And then on June 24th, 2018, she was at home with her parents. She was like on her phone and her parents are like, okay, we're gonna go outside the supermarket or something. And she's like, okay, like she stays behind.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

i guess bailey had like a bad day before her and her boyfriend had gotten into a fight at like a barbecue so she's kind of just like bumming out over it right so parents take off go to the grocery store and when they come back that's when they find bailey They return home and they find Bailey's lifeless body slumped against the baseboards by a cupboard in the kitchen.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

She had a gold cord tied around her neck as if she had hanged herself. but she didn't hang herself. It was odd. It was odd because one, there was no place in the kitchen where the 178 centimeter tall Bailey could have hanged herself. Despite this, police concluded that her death was a suicide. Her parents strongly disagreed. Over a year later, an investigation was opened regarding her death.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

And at this point, police obtained her two mobile phones, searched them, And they came to the conclusion that it was self-inflicted. The connection here is that Bailey also dated Anthony Hample. Now, what are the odds of that? A guy has two girlfriends who kill themselves? Like, hmm, that's weird, man. That's random. He's got a lot of weird coincidences going on, doesn't he?

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

He worked as like an events promoter, and he worked with like a lot of celebrity clientele, people who had money, you know what I'm saying? He could like, well, he would come into the hair salon and get his hair done, and that's how he met Phoebe. Many people said or thought that Ant was quite handsome, and he had come from like a really good family. His dad was a Supreme Court judge. Oh, yes.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

So I guess like Bailey, it was on again, off again. It was very toxic. This is just based off of what I read. There's like not that much information out there about her. I'm gonna make an assumption here. I don't really know too much, but I think because her background was a little... She's like a party girl. I think she worked at a strip club and stuff.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

So it's like, they didn't really report just about her and like her relationship or anything like that. Couldn't find anything.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

really except for surface stuff and the fact that like she was a stripper and whatnot so okay but like there's more to her than that what was i even getting at i don't remember but they both dated aunt at the time uh what's her name bailey was 25 and aunt was like 49 or some shit and like in his 50s maybe i can't even remember but it was something massive but both phoebe and bailey were kind of similar like a lot of people said after dating aunt both of them became socially withdrawn secretive and reserved

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

I mean, that's it really, the end. Yeah, I wish I could have found out more about Bailey Schneider. There were so many like conflicting stories, but we do know that she dated Ant. Like, come on. I didn't do like a where is he now with Ant. I did come across, I know, why didn't I? I don't know. It was like, I don't want to know where this guy's at.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

But I do, I did read that he's like married and whatnot. Does the wife know? How do you marry someone and they're like, oh yeah, I had two girlfriends who died. Wouldn't you be like, eh, I'm okay. I think I'm okay. Like that's kind of weird. Anywho, that is the case of Phoebe Handstruck and Bailey Schneider, a little bit there.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

You know, for Phoebe's family, moving on from like their loss remains pretty much a lifelong struggle. With these stories, you always hope for the best. I guess, like some closure, some answers. Maybe they'll find like a diary that belonged to Ant or something. It's just like, I don't know. What do you think? You think Ant did it? Or he just has really bad luck, huh? I don't know.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

There's so many things that like point to Ant. I don't know how he did it though. That's the thing. Because there's many people who say like he was at work all day when Phoebe had died, that he was at work all day. Like a lot of eyewitnesses and stuff. So if he was at work all day, How'd he do it? You know? Maybe it wasn't him.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

Maybe it was like one of the construction workers who was working at the building. I don't know. Well, thank you for hanging out with me today. Today was a little long, wasn't it? I hope you have a good day. You make good choices. And I'll be talking to you later. Goodbye.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

His name was George Hample, and his stepmom was a county court judge. Not good, but we'll get into it. Anyways, she was named Felicity Hample. Well, Phoebe and Ant, they meet each other, they hit it off, and they decide to start dating. And the two of them end up dating for like five months, and then they decide to move in together. Phoebe moves into his place, his apartment. It's on St.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

Gilda Road, and they move in together in October of 2009. So again, this was in that luxury apartment. It was on the 12th floor. luxury apartment building called Valencia. It's a nice apartment building, big windows, beautiful views, lots of fancy amenities. It was money. So just like this, like on the surface, seemed like this glamorous, cute couple. It's like beauty and business.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

Just living this fancy life. But you and I both know that it's never like that, is it, huh? Appearances are always deceiving. So it was said that, especially during this time, but Phoebe had an on-again, off-again relationship with alcohol. And at this time, she was drinking a lot. I guess Aunt and Phoebe had a pretty rocky relationship.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

They would break up, they would get back together, break up, repeat, you know? She started seeing a psychiatrist, or she was seeing a psychiatrist, but Phoebe would tell her psychiatrist lots of things about her relationship with Aunt, like that he was verbally abusive, that he was aggressive,

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

So if you're ever curious to know what I'm using, I'll list it in the description box down below. But other than that, I will shut up and tell you about today's story. So. takes place December 2nd, 2010 in the heart of Melbourne, Australia. So the story takes place at the Balencia Apartments.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

and mainly that she was upset in the relationship it was said that her psychiatrist her psychiatrist later like kind of testified or whatever but she said that like she was working with phoebe to like get out of this relationship or help her see that she needed to get out of this relationship like it wasn't good for her but phoebe would always end up kind of going back phoebe had left aunt like

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

four different times in the six weeks before her death. And Phoebe's boss at the hair salon said that Aunt always managed to lure Phoebe back in. One of those, you know? Unfortunately, Phoebe's fourth return to Aunt would be her last. Everyone at the office is talking about this new true crime documentary and everyone's like, Bailey, you gotta watch it. It's so good.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

And I'm like kind of rolling my eyes because I'm like, yeah, girl, like you're a little late to that party. I already knew about that. You know, but I love that for them. But because I want to play along, it's like, okay, yeah, I'll watch this like true crime documentary. What's it on? What's it streaming on? It's like something that I don't have.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

Now I got to sign up for this so I can watch it, you know, free trial, binge that documentary really quick. And then hopefully I remember to cancel. Well, a lot of the times I forget to cancel. And the next thing you know, you're paying, you're paying months and months worth of fees for something that you don't even use. But never again. Because I've got Rocket Money.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

Rocket Money is a personal finance app that helps find and cancel your unwanted subscriptions, monitors your spending, and helps lower your bills so you can grow your savings. With Rocket Money, you can see all of your subscriptions in one place. So you know exactly what you're paying for and know exactly where your money is going.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

And if you want to cancel one of your subscriptions, Rocket Money can help you do that too. I personally appreciate the alerts Rocket Money sends you. If you input your bills, you can get an alert if any, there's like a price increase, if there's any unusual spending activity, or if you're close to going over a personal like budget you set.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

Rocket Money has over 5 million users and has saved a total of 500 million in canceled subscriptions, saving members up to $740 a year when using all of the app's premium features. Cancel your unwanted subscriptions and reach your financial goals faster. With Rocket Money. Go to rocketmoney.com slash makeup today. That's rocketmoney.com slash makeup. rocketmoney.com slash makeup.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

So December 1st, 2010, this was the day before her death. Phoebe had sent a really strange text message to her brothers, her parents, and her grandmother. Oh, and her boss. And the text message said, quote, Hi, family. I'm in bed and about to sleep. And when I wake, I will transform into the most incredible human being you've ever seen. Dot, dot, dot. Not. I will go to hospital.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

It's safer there, and I hear the special tonight is tomato soup. Delicious. Nutritious. Nutritious. Nutritious. Nutritious. There we go. I love you all very much, but not enough to send an individual text. Sorry about that, but time is sleep, and I must be on my way. Merrily, merrily, merrily. Life is but a dream. XO. I know. If you got that text message, what would you do?

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

You know, they stand tall, they're a luxury high rise that promises like safety and sophistication, but something, something unthinkable happens. Phoebe Handstuck, a 24-year-old woman, is found dead at the bottom of a garbage chute. Yes, you heard that right. A garbage chute. Now, it appeared she had fallen through the garbage disposal chute from the 12th floor,

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

I'd be like, uh, K, send. I don't know. You know, I don't know what I would say to that. But obviously, it was concerning, right? Phoebe's mother, Natalie, she received the text message, like, as she was boarding onto an airplane. So she knew she wasn't going to get a response. So she reaches out to, like, her mom, who is Phoebe's grandma, and she...

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

asked her, Jeanette is her name, Phoebe's grandma's name is Jeanette. So she asked Jeanette like, hey, can you check on Phoebe? Cause she kind of lived close by. Well, Jeanette tried to call Phoebe, no answer. So she calls aunt, no answer. So the next day on December 2nd, at like 1035 in the morning, Jeanette, Phoebe's grandma, she reaches out again to see if she can get an answer, right?

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

but this time she's able to reach Aunt. And the first thing she asked Aunt was like, is Phoebe okay? And I guess Aunt was confused a little bit because he didn't know about Phoebe's bizarre text message. Allegedly, we don't know. He told Jeanette that he had left Phoebe sleeping peacefully that morning. but that he would swing by the apartment and check on her since his office wasn't that far.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

So on this day, Phoebe was just back at the apartment. At 1144 a.m., there was CCTV footage of her leaving the apartment because there was a fire alarm. I guess the fire alarm inside the building had accidentally been set off, so everyone had to get out. So you can see Phoebe on camera leaving with her dog, and then she takes him for a little walk.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

And then it's not even that long, she's caught back on camera, returning to the apartment complex, and then she goes to the 12th floor residence. Now... Nobody knows what happened in the hours that followed. It's very bizarre. What we do know for sure is that Phoebe was drinking heavily. And that sounds kind of douchey to say, but like she was. She had a lot of alcohol in her system.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

So at some point, Phoebe had left her apartment before 7 o'clock p.m. because she leaves the apartment and she like somehow plunged down the garbage chute.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

it's so weird the garbage chute was like right outside the apartment you know on the wall you know you go to it you open it and then you drop garbage into it i hope you know what i'm talking about you know what i'm talking about it's like with that thing that you open up when you drop off mail trying to explain this i i think you get it but sure but it's pretty small like it measured just 14.5 by 8.6 inches

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

So not huge, but somehow she got in there and she fell nearly 40 meters or 131 feet down from the 12th floor. She gets in there and falls. Now she survived the fall, And I guess she was in the garbage room place. She was like desperately trying to get out. She's trying to get out of the garbage bin that she fell in.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

Because she fell feet first, the garbage compactor at the bottom of the bin had essentially severed her right foot. Oy, I know. Sadly, Phoebe bled out in the dark alone. And when she was found, her jeans were below her knees, kind of closer to her ankles. They were undone at the waist and her belt was only threaded through the first two of like five belt loops.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

So just a very odd, weird, what happened kind of scene. Okay, so let me tell you the days leading up to Phoebe's death. So... Things leading up to her death, I mean, they seemed really off. That Monday morning, Phoebe had an appointment with her psychologist who would later say that her mood was like very low. She seemed to be distressed regarding her relationship. And on that same Monday night,

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

Phoebe and aunt, I guess had gone out with some friends to get dinner, but things didn't go so well. It was said that Phoebe was just like trying to open up and have a conversation with her friend, you know, fucking talk. And when she spoke, aunt kept like shutting her down, preventing her from sharing. her thoughts or emotions, anything.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

The friends from dinner that night said that their evening had ended abruptly. Phoebe and aunt had left. Things were kind of tense, I guess. But when Phoebe and aunt had left, they drove back to the apartment and then they got into like a heated argument in the car park. It was said that Phoebe had like left the car park in tears.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

where Phoebe had shared an apartment with her boyfriend. I know, already weird. Though the police had ruled her death as a suicide and the coroner had determined her death was a freak accident, many, many, many, many did not accept this as her cause of death. No. So let's not get ahead of ourselves. Let's rewind and get to know Phoebe a little bit. Phoebe sounded like a wonderful person.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

Then she called up an old party friend asking if they would meet with her for a drink at a bar nearby. So this friend agrees. I guess they go to like a bar, whatever. They have a few drinks and they stayed for like about an hour. The friend had noted that her phone was ringing nonstop, call after call after call.

Murder, Mystery & Makeup
A "freak accident" or pure evil?? Unraveling the death of Phoebe Handsjuk

And later phone records revealed that Phoebe had missed 27 missed calls from aunt during that hour she was at the bar. The friend from the dinner said like the nonstop calls from aunt had made her like really upset, obviously, you know? So when they were leaving the bar, I guess Phoebe was so annoyed that she like just threw her phone across the street and it broke.

Two Hot Takes
194: Makeup Possible Here? Ft. Bailey Sarian

I wonder.

Two Hot Takes
194: Makeup Possible Here? Ft. Bailey Sarian

Hmm.

Two Hot Takes
194: Makeup Possible Here? Ft. Bailey Sarian

Oh, my gosh.

Two Hot Takes
194: Makeup Possible Here? Ft. Bailey Sarian

100%.

Two Hot Takes
194: Makeup Possible Here? Ft. Bailey Sarian

Bye.

Two Hot Takes
194: Makeup Possible Here? Ft. Bailey Sarian

Okay.

Two Hot Takes
194: Makeup Possible Here? Ft. Bailey Sarian

Mm-hmm.

Two Hot Takes
194: Makeup Possible Here? Ft. Bailey Sarian

God.

Two Hot Takes
194: Makeup Possible Here? Ft. Bailey Sarian

God.

Two Hot Takes
194: Makeup Possible Here? Ft. Bailey Sarian

2019.

Two Hot Takes
194: Makeup Possible Here? Ft. Bailey Sarian

Mm-hmm.

Two Hot Takes
194: Makeup Possible Here? Ft. Bailey Sarian

TikTok.