Fuentes
👤 PersonPodcast Appearances
Er ist der gleiche Junge. Ja. Er bricht mich als Hintergrund.
Er ist der gleiche Junge. Ja. Er bricht mich als Hintergrund.
Er ist der gleiche Junge. Ja. Er bricht mich als Hintergrund.
Oh, they dropped it to 59.5. He's in. He's eligible.
Oh, they dropped it to 59.5. He's in. He's eligible.
Oh, they dropped it to 59.5. He's in. He's eligible.
All right, coming up next, blind rankings.
All right, coming up next, blind rankings.
All right, coming up next, blind rankings.
Du musst das tun, Forrest, weil ich dir jetzt sage, wenn du es nicht tust, werden keine unserer Kinder essen.
Du musst das tun, Forrest, weil ich dir jetzt sage, wenn du es nicht tust, werden keine unserer Kinder essen.
Du musst das tun, Forrest, weil ich dir jetzt sage, wenn du es nicht tust, werden keine unserer Kinder essen.
Oh, Mikey C. No, no, no, no, no, no, no. What if we existed in a world where both Mike Fuentes and Mikey C could be on the show? But then he'd be Mikey F also. Mikey F, Mikey C, Mikey A. I'm gonna start calling you Mikey.
Oh, Mikey C. No, no, no, no, no, no, no. What if we existed in a world where both Mike Fuentes and Mikey C could be on the show? But then he'd be Mikey F also. Mikey F, Mikey C, Mikey A. I'm gonna start calling you Mikey.
Oh, Mikey C. No, no, no, no, no, no, no. What if we existed in a world where both Mike Fuentes and Mikey C could be on the show? But then he'd be Mikey F also. Mikey F, Mikey C, Mikey A. I'm gonna start calling you Mikey.
Man, that's a good coach right there.
Man, that's a good coach right there.
Man, that's a good coach right there.
I mean, that guy almost got the one seed in the NFC with Sam Darnold. Kevin O'Connell, number two. Wow. He's a good coach, Billy. I don't know what other names are there.
I mean, that guy almost got the one seed in the NFC with Sam Darnold. Kevin O'Connell, number two. Wow. He's a good coach, Billy. I don't know what other names are there.
I mean, that guy almost got the one seed in the NFC with Sam Darnold. Kevin O'Connell, number two. Wow. He's a good coach, Billy. I don't know what other names are there.
He doesn't have six better coaches on his list than Kevin O'Connell. It's impossible.
He doesn't have six better coaches on his list than Kevin O'Connell. It's impossible.
He doesn't have six better coaches on his list than Kevin O'Connell. It's impossible.
Oh, wow. He's on the hot seat, I'll tell you that much. Seven. Seven, get it done. I'm gonna put him at eight.
Oh, wow. He's on the hot seat, I'll tell you that much. Seven. Seven, get it done. I'm gonna put him at eight.
Oh, wow. He's on the hot seat, I'll tell you that much. Seven. Seven, get it done. I'm gonna put him at eight.
If he didn't have Josh Allen, he would have been fired five years ago. Fuentes, what do you want me to respect? He hasn't made a Super Bowl with a quarterback that most coaches would make a Super Bowl with, and he fires his coordinators every year.
If he didn't have Josh Allen, he would have been fired five years ago. Fuentes, what do you want me to respect? He hasn't made a Super Bowl with a quarterback that most coaches would make a Super Bowl with, and he fires his coordinators every year.
If he didn't have Josh Allen, he would have been fired five years ago. Fuentes, what do you want me to respect? He hasn't made a Super Bowl with a quarterback that most coaches would make a Super Bowl with, and he fires his coordinators every year.
Once he's gone, then it's like, uh, Josh? Uh-huh. Anyway.
Once he's gone, then it's like, uh, Josh? Uh-huh. Anyway.
Once he's gone, then it's like, uh, Josh? Uh-huh. Anyway.
Let's do it this way. If Sean McDermott got fired, the first call the Bills would make would be to Kevin O'Connell. Darn right.
Let's do it this way. If Sean McDermott got fired, the first call the Bills would make would be to Kevin O'Connell. Darn right.
Let's do it this way. If Sean McDermott got fired, the first call the Bills would make would be to Kevin O'Connell. Darn right.
Dan Quinn? Six. I'll put him seven.
Dan Quinn? Six. I'll put him seven.
Dan Quinn? Six. I'll put him seven.
We'll have news for you regarding God bless football coming up in the next week or so. So, Billy, we have one but not two blind rankings. This is very exciting. Fuentes has one and Mikey A has one. No, so then we do have two. Ja, wir haben zwei. Ich sollte nur sagen, wir haben zwei. Du hast recht. Wir haben zwei blinde Ranking. Fuentes hat einen, Mikey A. hat einen.
We'll have news for you regarding God bless football coming up in the next week or so. So, Billy, we have one but not two blind rankings. This is very exciting. Fuentes has one and Mikey A has one. No, so then we do have two. Ja, wir haben zwei. Ich sollte nur sagen, wir haben zwei. Du hast recht. Wir haben zwei blinde Ranking. Fuentes hat einen, Mikey A. hat einen.
We'll have news for you regarding God bless football coming up in the next week or so. So, Billy, we have one but not two blind rankings. This is very exciting. Fuentes has one and Mikey A has one. No, so then we do have two. Ja, wir haben zwei. Ich sollte nur sagen, wir haben zwei. Du hast recht. Wir haben zwei blinde Ranking. Fuentes hat einen, Mikey A. hat einen.
So here's the deal, he's at number 9 on my list now, but if Cam Ward's good and we play this game again next year, and Fuentes is still part of the show as Mikey F. wearing a mustache, then perhaps, perhaps, if Cam Ward's good, Callaghan will be top 3. Exactly.
So here's the deal, he's at number 9 on my list now, but if Cam Ward's good and we play this game again next year, and Fuentes is still part of the show as Mikey F. wearing a mustache, then perhaps, perhaps, if Cam Ward's good, Callaghan will be top 3. Exactly.
So here's the deal, he's at number 9 on my list now, but if Cam Ward's good and we play this game again next year, and Fuentes is still part of the show as Mikey F. wearing a mustache, then perhaps, perhaps, if Cam Ward's good, Callaghan will be top 3. Exactly.
Wir gehen alle bei 5. Ich stelle D'Amico bei 5. Er fühlt sich bei 5 an.
Wir gehen alle bei 5. Ich stelle D'Amico bei 5. Er fühlt sich bei 5 an.
Wir gehen alle bei 5. Ich stelle D'Amico bei 5. Er fühlt sich bei 5 an.
Are you some sort of big outdoorsman?
Are you some sort of big outdoorsman?
Are you some sort of big outdoorsman?
Wir haben Headlines, wir haben mehr Mike Lee. Und ich frage mich, wo will Billy Gill auf unserem letzten Episode bei Metal Ark Media, wo will er zuerst?
Wir haben Headlines, wir haben mehr Mike Lee. Und ich frage mich, wo will Billy Gill auf unserem letzten Episode bei Metal Ark Media, wo will er zuerst?
Wir haben Headlines, wir haben mehr Mike Lee. Und ich frage mich, wo will Billy Gill auf unserem letzten Episode bei Metal Ark Media, wo will er zuerst?
You're probably right. It's clearly John.
You're probably right. It's clearly John.
You're probably right. It's clearly John.
I have number one and number two still left, so I'm feeling pretty good. I put Jim Harbaugh at four. Where did Billy put him?
I have number one and number two still left, so I'm feeling pretty good. I put Jim Harbaugh at four. Where did Billy put him?
I have number one and number two still left, so I'm feeling pretty good. I put Jim Harbaugh at four. Where did Billy put him?
It's really not a sexy name. It's a common name, Ben Johnson, but I understand what you're saying. No experience as a head coach.
It's really not a sexy name. It's a common name, Ben Johnson, but I understand what you're saying. No experience as a head coach.
It's really not a sexy name. It's a common name, Ben Johnson, but I understand what you're saying. No experience as a head coach.
He's got a better face.
He's got a better face.
He's got a better face.
You've been working on that for a while?
You've been working on that for a while?
You've been working on that for a while?
That was a thing. I buy a house in the mountains in Arizona.
That was a thing. I buy a house in the mountains in Arizona.
That was a thing. I buy a house in the mountains in Arizona.
Es würde sich herausstellen. Denkst du, dass der Dolphins-Head Coach hier sein wird? Denkst du, dass McDaniel hier sein wird? Denkst du, dass der Jets-Head Coach hier sein wird? Ich versuche, mit diesem Coach was zu tun.
Es würde sich herausstellen. Denkst du, dass der Dolphins-Head Coach hier sein wird? Denkst du, dass McDaniel hier sein wird? Denkst du, dass der Jets-Head Coach hier sein wird? Ich versuche, mit diesem Coach was zu tun.
Es würde sich herausstellen. Denkst du, dass der Dolphins-Head Coach hier sein wird? Denkst du, dass McDaniel hier sein wird? Denkst du, dass der Jets-Head Coach hier sein wird? Ich versuche, mit diesem Coach was zu tun.
I'm putting Ben Johnson at 10. I have him at 8.
I'm putting Ben Johnson at 10. I have him at 8.
I'm putting Ben Johnson at 10. I have him at 8.
Das ist, was Mikey sagte. Kevin O'Connell, er sieht aus wie ein Hauptcoach. Er hat einen viel besser aussehenden Gesicht. Es gibt keine Frage darüber.
Das ist, was Mikey sagte. Kevin O'Connell, er sieht aus wie ein Hauptcoach. Er hat einen viel besser aussehenden Gesicht. Es gibt keine Frage darüber.
Das ist, was Mikey sagte. Kevin O'Connell, er sieht aus wie ein Hauptcoach. Er hat einen viel besser aussehenden Gesicht. Es gibt keine Frage darüber.
I'm okay. I'm being forced to put him ahead of Dan Quinn and Sean McDermott, but I'm okay with that. Like it might be Daniel had Josh Allen. Forget it. Yeah, probably not. Anyway, I have no choice.
I'm okay. I'm being forced to put him ahead of Dan Quinn and Sean McDermott, but I'm okay with that. Like it might be Daniel had Josh Allen. Forget it. Yeah, probably not. Anyway, I have no choice.
I'm okay. I'm being forced to put him ahead of Dan Quinn and Sean McDermott, but I'm okay with that. Like it might be Daniel had Josh Allen. Forget it. Yeah, probably not. Anyway, I have no choice.
What slots do you have left, Mike? One and four.
What slots do you have left, Mike? One and four.
What slots do you have left, Mike? One and four.
Yep, no doubt. All right, go ahead, Fuentes.
Yep, no doubt. All right, go ahead, Fuentes.
Yep, no doubt. All right, go ahead, Fuentes.
Gibt es einen besseren Trainer als Andy Reid, den er da rausnehmen kann?
Gibt es einen besseren Trainer als Andy Reid, den er da rausnehmen kann?
Gibt es einen besseren Trainer als Andy Reid, den er da rausnehmen kann?
Ja, weil wenn es Nick Sirianni ist, möchte ich ihn als Nummer eins. Ich liebe diesen Mann. Was? Was ist mit Tomlin? Er ist großartig. Du bist verrückt. Tomlin, John Harbaugh. I'm workshopping a take about Jalen Hurts being better than Patrick Mahomes. Tease. Tease for a future show.
Ja, weil wenn es Nick Sirianni ist, möchte ich ihn als Nummer eins. Ich liebe diesen Mann. Was? Was ist mit Tomlin? Er ist großartig. Du bist verrückt. Tomlin, John Harbaugh. I'm workshopping a take about Jalen Hurts being better than Patrick Mahomes. Tease. Tease for a future show.
Ja, weil wenn es Nick Sirianni ist, möchte ich ihn als Nummer eins. Ich liebe diesen Mann. Was? Was ist mit Tomlin? Er ist großartig. Du bist verrückt. Tomlin, John Harbaugh. I'm workshopping a take about Jalen Hurts being better than Patrick Mahomes. Tease. Tease for a future show.
One or two? One.
One or two? One.
One or two? One.
Ich muss sagen, dieser Bulls-Mann lebt in einem so großartigen Weltraum, in dem niemand um Tampa, um ihn, um ihn kümmert und er wird nie verabschiedet. Ich mag ihn. Ich auch. Er hat immer das gleiche Gesicht auf der Seite, egal ob die Situation. Du weißt nicht, ob er gewinnt oder verliert. Genau.
Ich muss sagen, dieser Bulls-Mann lebt in einem so großartigen Weltraum, in dem niemand um Tampa, um ihn, um ihn kümmert und er wird nie verabschiedet. Ich mag ihn. Ich auch. Er hat immer das gleiche Gesicht auf der Seite, egal ob die Situation. Du weißt nicht, ob er gewinnt oder verliert. Genau.
Ich muss sagen, dieser Bulls-Mann lebt in einem so großartigen Weltraum, in dem niemand um Tampa, um ihn, um ihn kümmert und er wird nie verabschiedet. Ich mag ihn. Ich auch. Er hat immer das gleiche Gesicht auf der Seite, egal ob die Situation. Du weißt nicht, ob er gewinnt oder verliert. Genau.
All right. We have another blind ranking coming up, plus more Mike Lee. So I'm excited. And I think Billy and Mikey are going to embarrass me somehow. That's coming up next.
All right. We have another blind ranking coming up, plus more Mike Lee. So I'm excited. And I think Billy and Mikey are going to embarrass me somehow. That's coming up next.
All right. We have another blind ranking coming up, plus more Mike Lee. So I'm excited. And I think Billy and Mikey are going to embarrass me somehow. That's coming up next.
What are we laughing at? Just you. You're in rare form today, man. I'm here, man. I'm just doing my thing. You know what it is? Football's getting close. That's what it is.
What are we laughing at? Just you. You're in rare form today, man. I'm here, man. I'm just doing my thing. You know what it is? Football's getting close. That's what it is.
What are we laughing at? Just you. You're in rare form today, man. I'm here, man. I'm just doing my thing. You know what it is? Football's getting close. That's what it is.
You want to do a little training camp tour this year?
You want to do a little training camp tour this year?
You want to do a little training camp tour this year?
Ich mag die Idee von Jets, Giants, Buffalo, Philadelphia, das ganze Gebiet. Ich denke, das ist ein guter Ort für uns.
Ich mag die Idee von Jets, Giants, Buffalo, Philadelphia, das ganze Gebiet. Ich denke, das ist ein guter Ort für uns.
Ich mag die Idee von Jets, Giants, Buffalo, Philadelphia, das ganze Gebiet. Ich denke, das ist ein guter Ort für uns.
anyway the rv tour still lives on maybe one day we'll go on an rv tour yes okay blind rankings or mike more michael why don't we take an rv to the uh i think we have another blind ranking for guests here guests on the show at the lark on the draft kings network we're gonna get to that in just a second let's take an rv3 to uh to training camp why not you love camp rv3 rv3 you like that rv3 we'll call it the rv3
anyway the rv tour still lives on maybe one day we'll go on an rv tour yes okay blind rankings or mike more michael why don't we take an rv to the uh i think we have another blind ranking for guests here guests on the show at the lark on the draft kings network we're gonna get to that in just a second let's take an rv3 to uh to training camp why not you love camp rv3 rv3 you like that rv3 we'll call it the rv3
anyway the rv tour still lives on maybe one day we'll go on an rv tour yes okay blind rankings or mike more michael why don't we take an rv to the uh i think we have another blind ranking for guests here guests on the show at the lark on the draft kings network we're gonna get to that in just a second let's take an rv3 to uh to training camp why not you love camp rv3 rv3 you like that rv3 we'll call it the rv3
I don't know why, but we will. Blind Rankings, what are we doing here, Mikey? Fuentes has to play along here. This is great. I like this.
I don't know why, but we will. Blind Rankings, what are we doing here, Mikey? Fuentes has to play along here. This is great. I like this.
I don't know why, but we will. Blind Rankings, what are we doing here, Mikey? Fuentes has to play along here. This is great. I like this.
Explain to the audience what it is we're doing. We're blind ranking the guests in the history of this show.
Explain to the audience what it is we're doing. We're blind ranking the guests in the history of this show.
Explain to the audience what it is we're doing. We're blind ranking the guests in the history of this show.
Less than three.
Less than three.
Less than three.
Do you think if given the choice, kids graduation or record the final episode on the lark of God bless football, if they were conflicting times, do you think Kay Funk would have chosen to record with us? I mean, what do you think?
Do you think if given the choice, kids graduation or record the final episode on the lark of God bless football, if they were conflicting times, do you think Kay Funk would have chosen to record with us? I mean, what do you think?
Do you think if given the choice, kids graduation or record the final episode on the lark of God bless football, if they were conflicting times, do you think Kay Funk would have chosen to record with us? I mean, what do you think?
Gojo missed the cut, huh? Yes, it will be told. All stories.
Gojo missed the cut, huh? Yes, it will be told. All stories.
Gojo missed the cut, huh? Yes, it will be told. All stories.
Das wird... Nitro war mehr als drei Mal. Ich meine... Ich gehe mit drei mit Nitro. Einmal fühlte es sich wie tausendmal an. Ja, es geht ein bisschen lang. Wo hast du ihn? Ich gehe mit drei. I put them at five for Nitro.
Das wird... Nitro war mehr als drei Mal. Ich meine... Ich gehe mit drei mit Nitro. Einmal fühlte es sich wie tausendmal an. Ja, es geht ein bisschen lang. Wo hast du ihn? Ich gehe mit drei. I put them at five for Nitro.
Das wird... Nitro war mehr als drei Mal. Ich meine... Ich gehe mit drei mit Nitro. Einmal fühlte es sich wie tausendmal an. Ja, es geht ein bisschen lang. Wo hast du ihn? Ich gehe mit drei. I put them at five for Nitro.
Just to remind the audience, Billy met Adam Schefter's mom on a cruise. In an elevator.
Just to remind the audience, Billy met Adam Schefter's mom on a cruise. In an elevator.
Just to remind the audience, Billy met Adam Schefter's mom on a cruise. In an elevator.
I'm gonna put her at number two.
I'm gonna put her at number two.
I'm gonna put her at number two.
I know. And I take her to lunch in Boynton Beach somewhere. Yeah, we gotta follow up on that.
I know. And I take her to lunch in Boynton Beach somewhere. Yeah, we gotta follow up on that.
I know. And I take her to lunch in Boynton Beach somewhere. Yeah, we gotta follow up on that.
Oh, ja. Ja, ich liebe das. Wir haben so viele Pläne. Ich meine, wir werden sie alle bekommen.
Oh, ja. Ja, ich liebe das. Wir haben so viele Pläne. Ich meine, wir werden sie alle bekommen.
Oh, ja. Ja, ich liebe das. Wir haben so viele Pläne. Ich meine, wir werden sie alle bekommen.
I'm going to put him at nine. I'm going to put Matt Sims at...
I'm going to put him at nine. I'm going to put Matt Sims at...
I'm going to put him at nine. I'm going to put Matt Sims at...
Oh, wow. Das war ein guter.
Oh, wow. Das war ein guter.
Oh, wow. Das war ein guter.
So I thought I was I was on the driving range at Lake Tahoe thinking I was speaking to Aaron Rodgers. I was speaking to a country music singer, Jake Owen, who thanked him for being our quarterback, who really just played along, played along beautifully. He made the whole week for us at Lake Tahoe. I can't wait to go back to that place. I love it. I mean, it is.
So I thought I was I was on the driving range at Lake Tahoe thinking I was speaking to Aaron Rodgers. I was speaking to a country music singer, Jake Owen, who thanked him for being our quarterback, who really just played along, played along beautifully. He made the whole week for us at Lake Tahoe. I can't wait to go back to that place. I love it. I mean, it is.
So I thought I was I was on the driving range at Lake Tahoe thinking I was speaking to Aaron Rodgers. I was speaking to a country music singer, Jake Owen, who thanked him for being our quarterback, who really just played along, played along beautifully. He made the whole week for us at Lake Tahoe. I can't wait to go back to that place. I love it. I mean, it is.
Those are mountains, by the way, Fontes. I can't wait to go back there. I thought it was Aaron Rodgers. It wasn't. It was Jake Owen. They all made fun of me for the remainder of the weekend. It became a thing at Tahoe. Jake Owen was on the show. I'm going to put him at number one, man. What? 10 für mich. Billy, es hat für uns eine Lücke geschlossen diese Woche. Es war so wichtig, ihn anzunehmen.
Those are mountains, by the way, Fontes. I can't wait to go back there. I thought it was Aaron Rodgers. It wasn't. It was Jake Owen. They all made fun of me for the remainder of the weekend. It became a thing at Tahoe. Jake Owen was on the show. I'm going to put him at number one, man. What? 10 für mich. Billy, es hat für uns eine Lücke geschlossen diese Woche. Es war so wichtig, ihn anzunehmen.
Those are mountains, by the way, Fontes. I can't wait to go back there. I thought it was Aaron Rodgers. It wasn't. It was Jake Owen. They all made fun of me for the remainder of the weekend. It became a thing at Tahoe. Jake Owen was on the show. I'm going to put him at number one, man. What? 10 für mich. Billy, es hat für uns eine Lücke geschlossen diese Woche. Es war so wichtig, ihn anzunehmen.
Ich habe ihn wahrscheinlich zu hoch gesetzt. Dein Witz über das Verlangen von dem, wer er war, ist besser als er.
Ich habe ihn wahrscheinlich zu hoch gesetzt. Dein Witz über das Verlangen von dem, wer er war, ist besser als er.
Ich habe ihn wahrscheinlich zu hoch gesetzt. Dein Witz über das Verlangen von dem, wer er war, ist besser als er.
Oh, Scott Seiler. He should be number one. He was great. You do not remember him.
Oh, Scott Seiler. He should be number one. He was great. You do not remember him.
Oh, Scott Seiler. He should be number one. He was great. You do not remember him.
Seiler was on. He made pics with Kay Funk. He had a book to promote. I think he went 0-5. I don't know. I'm going to put Seiler at 7. Listen, here's what I do know, Billy. I don't want to piss off Brandon Seiler. That is true.
Seiler was on. He made pics with Kay Funk. He had a book to promote. I think he went 0-5. I don't know. I'm going to put Seiler at 7. Listen, here's what I do know, Billy. I don't want to piss off Brandon Seiler. That is true.
Seiler was on. He made pics with Kay Funk. He had a book to promote. I think he went 0-5. I don't know. I'm going to put Seiler at 7. Listen, here's what I do know, Billy. I don't want to piss off Brandon Seiler. That is true.
Hey, Billy, what did you do yesterday? I got out of the pool with Kay Funk and Brandon Seiler. Oh, ShareBear. Oh, ShareBear.
Hey, Billy, what did you do yesterday? I got out of the pool with Kay Funk and Brandon Seiler. Oh, ShareBear. Oh, ShareBear.
Hey, Billy, what did you do yesterday? I got out of the pool with Kay Funk and Brandon Seiler. Oh, ShareBear. Oh, ShareBear.
No protection on whatsoever. Kay Funk just...
No protection on whatsoever. Kay Funk just...
No protection on whatsoever. Kay Funk just...
Lacey's a two. I can't believe I put Shirley Schefter at two.
Lacey's a two. I can't believe I put Shirley Schefter at two.
Lacey's a two. I can't believe I put Shirley Schefter at two.
Number three for me. She was a bartender who owned an air conditioning company.
Number three for me. She was a bartender who owned an air conditioning company.
Number three for me. She was a bartender who owned an air conditioning company.
I'm putting her at three. Yeah. Puts a smile on my face.
I'm putting her at three. Yeah. Puts a smile on my face.
I'm putting her at three. Yeah. Puts a smile on my face.
This is the last Super Bowl, just a few months ago.
This is the last Super Bowl, just a few months ago.
This is the last Super Bowl, just a few months ago.
He was so good, Billy.
He was so good, Billy.
He was so good, Billy.
It's better that way. I put the Old Spice guy at one because he made my job easy that week.
It's better that way. I put the Old Spice guy at one because he made my job easy that week.
It's better that way. I put the Old Spice guy at one because he made my job easy that week.
You put Jake Owen at one.
You put Jake Owen at one.
You put Jake Owen at one.
Okay, Old Spice Guy's at one. Alright, I'll put him at six.
Okay, Old Spice Guy's at one. Alright, I'll put him at six.
Okay, Old Spice Guy's at one. Alright, I'll put him at six.
Es ist unglaublich. Alright, so I have three slots left, right? I have one, eight, and ten. I'm doomed.
Es ist unglaublich. Alright, so I have three slots left, right? I have one, eight, and ten. I'm doomed.
Es ist unglaublich. Alright, so I have three slots left, right? I have one, eight, and ten. I'm doomed.
I forgot about it.
I forgot about it.
I forgot about it.
Wir hatten Spags im Studio, es war fantastisch. Ein bloßes Freundeskreis. Man, wir könnten auch mit Spags reisen.
Wir hatten Spags im Studio, es war fantastisch. Ein bloßes Freundeskreis. Man, wir könnten auch mit Spags reisen.
Wir hatten Spags im Studio, es war fantastisch. Ein bloßes Freundeskreis. Man, wir könnten auch mit Spags reisen.
Das ist ein fairer Punkt. Also von all den letzten Gästen, es war nicht Chris Sims, den du ausgesprochen hast, es war nicht Mike Golick, den du ausgesprochen hast, es war K-Funk.
Das ist ein fairer Punkt. Also von all den letzten Gästen, es war nicht Chris Sims, den du ausgesprochen hast, es war nicht Mike Golick, den du ausgesprochen hast, es war K-Funk.
Das ist ein fairer Punkt. Also von all den letzten Gästen, es war nicht Chris Sims, den du ausgesprochen hast, es war nicht Mike Golick, den du ausgesprochen hast, es war K-Funk.
God bless football, Billy Gill.
God bless football, Billy Gill.
God bless football, Billy Gill.
Sie war für uns ein Halloween-Stapel.
Sie war für uns ein Halloween-Stapel.
Sie war für uns ein Halloween-Stapel.
Sie hat wahrscheinlich gesagt, ich kann nicht glauben, dass das mein Leben ist. Ich bin eine immediate Beziehungsperson für eine echte Schwester.
Sie hat wahrscheinlich gesagt, ich kann nicht glauben, dass das mein Leben ist. Ich bin eine immediate Beziehungsperson für eine echte Schwester.
Sie hat wahrscheinlich gesagt, ich kann nicht glauben, dass das mein Leben ist. Ich bin eine immediate Beziehungsperson für eine echte Schwester.
Ich muss sagen, wir sollten sie hiren.
Ich muss sagen, wir sollten sie hiren.
Ich muss sagen, wir sollten sie hiren.
Du musst ihr aber Kredit geben, oder? Für das, dass sie sich in den Charakter gesinkt hat, aus Leid.
Du musst ihr aber Kredit geben, oder? Für das, dass sie sich in den Charakter gesinkt hat, aus Leid.
Du musst ihr aber Kredit geben, oder? Für das, dass sie sich in den Charakter gesinkt hat, aus Leid.
Was ist passiert? Also, die echte Schwester ist einfach geflogen? Sie wollte es nicht machen? Ja.
Was ist passiert? Also, die echte Schwester ist einfach geflogen? Sie wollte es nicht machen? Ja.
Was ist passiert? Also, die echte Schwester ist einfach geflogen? Sie wollte es nicht machen? Ja.
Ja, ich bin enttäuscht.
Ja, ich bin enttäuscht.
Ja, ich bin enttäuscht.
Right, if she just said, hey, the witch can't do it, Stanzik would have been like, okay, see you later.
Right, if she just said, hey, the witch can't do it, Stanzik would have been like, okay, see you later.
Right, if she just said, hey, the witch can't do it, Stanzik would have been like, okay, see you later.
Yeah, this is our kind of PR person, Billy. I'm telling you, listen, Billy and I are going to get into business, hopefully together. We're going to do some shows together moving forward. And I'm telling you, Roslyn. Person I thought was Rosalind will be running said business. Okay. Because that's the kind of person you need, Billy. Someone who's willing to do anything. Anything.
Yeah, this is our kind of PR person, Billy. I'm telling you, listen, Billy and I are going to get into business, hopefully together. We're going to do some shows together moving forward. And I'm telling you, Roslyn. Person I thought was Rosalind will be running said business. Okay. Because that's the kind of person you need, Billy. Someone who's willing to do anything. Anything.
Yeah, this is our kind of PR person, Billy. I'm telling you, listen, Billy and I are going to get into business, hopefully together. We're going to do some shows together moving forward. And I'm telling you, Roslyn. Person I thought was Rosalind will be running said business. Okay. Because that's the kind of person you need, Billy. Someone who's willing to do anything. Anything.
Including acting like a witch when she's not. Imagine what you do for us. It was odd. Any final thoughts here as we wrap up or anything? You got a more Mike Lee or anything?
Including acting like a witch when she's not. Imagine what you do for us. It was odd. Any final thoughts here as we wrap up or anything? You got a more Mike Lee or anything?
Including acting like a witch when she's not. Imagine what you do for us. It was odd. Any final thoughts here as we wrap up or anything? You got a more Mike Lee or anything?
Du hast sie auf einem Kurs getroffen.
Du hast sie auf einem Kurs getroffen.
Du hast sie auf einem Kurs getroffen.
We have fun doing it, though. It's a celebration of football. That's what it is. It's a celebration of the sport that all of us have fallen in love with. Just a couple more people to thank. Chris Sims, Mike Golick, who have been great to us over the four years, joined us just about every single week. Incredible. Mojo, Kay Funk, all those guys. Chris Gronkowski as well.
We have fun doing it, though. It's a celebration of football. That's what it is. It's a celebration of the sport that all of us have fallen in love with. Just a couple more people to thank. Chris Sims, Mike Golick, who have been great to us over the four years, joined us just about every single week. Incredible. Mojo, Kay Funk, all those guys. Chris Gronkowski as well.
We have fun doing it, though. It's a celebration of football. That's what it is. It's a celebration of the sport that all of us have fallen in love with. Just a couple more people to thank. Chris Sims, Mike Golick, who have been great to us over the four years, joined us just about every single week. Incredible. Mojo, Kay Funk, all those guys. Chris Gronkowski as well.
ein paar Jahre.
ein paar Jahre.
ein paar Jahre.
Ja, wir werden nie alle erwähnen. And whenever we have events in other cities, those events are packed and those events are tight and done well. So thank you to Smirnoff, man. And Mikey A. And Fuentes.
Ja, wir werden nie alle erwähnen. And whenever we have events in other cities, those events are packed and those events are tight and done well. So thank you to Smirnoff, man. And Mikey A. And Fuentes.
Ja, wir werden nie alle erwähnen. And whenever we have events in other cities, those events are packed and those events are tight and done well. So thank you to Smirnoff, man. And Mikey A. And Fuentes.
Es gibt eine Chance, dass das Show noch auf der DraftKings-Network bleibt. Das hat nichts mit DraftKings zu tun. Wir lieben sie. Sie waren tolle Partner.
Es gibt eine Chance, dass das Show noch auf der DraftKings-Network bleibt. Das hat nichts mit DraftKings zu tun. Wir lieben sie. Sie waren tolle Partner.
Es gibt eine Chance, dass das Show noch auf der DraftKings-Network bleibt. Das hat nichts mit DraftKings zu tun. Wir lieben sie. Sie waren tolle Partner.
Genau. Wenn Sie sich über das interessieren, werden Sie von The Lark wütend. Im Wesentlichen von Levitard und David Sampson. Auf jeden Fall. Bereit für die Headline?
Genau. Wenn Sie sich über das interessieren, werden Sie von The Lark wütend. Im Wesentlichen von Levitard und David Sampson. Auf jeden Fall. Bereit für die Headline?
Genau. Wenn Sie sich über das interessieren, werden Sie von The Lark wütend. Im Wesentlichen von Levitard und David Sampson. Auf jeden Fall. Bereit für die Headline?
Er will nie ein Mentor sein.
Er will nie ein Mentor sein.
Er will nie ein Mentor sein.
Richtig, ja. Wie tut er das? Er schaut den Film des Anfangs-Querterbacks und sagt dem QB-Koach, ich würde das nicht machen.
Richtig, ja. Wie tut er das? Er schaut den Film des Anfangs-Querterbacks und sagt dem QB-Koach, ich würde das nicht machen.
Richtig, ja. Wie tut er das? Er schaut den Film des Anfangs-Querterbacks und sagt dem QB-Koach, ich würde das nicht machen.
Es wäre sehr komfortabel, wenn Joe Flacco mein Backup-Quartier wäre. Er war unser Backup-Quartier, Mikey.
Es wäre sehr komfortabel, wenn Joe Flacco mein Backup-Quartier wäre. Er war unser Backup-Quartier, Mikey.
Es wäre sehr komfortabel, wenn Joe Flacco mein Backup-Quartier wäre. Er war unser Backup-Quartier, Mikey.
Richtig. Ich glaube, das ist, was Mikey sagt. Mit einem Anfangs-Job kommen die Erwartungen. Der Backup-Job ist immer der populärste Typ im Stadion. Er erzeugt Hoffnung. Er ist der nächste Typ.
Richtig. Ich glaube, das ist, was Mikey sagt. Mit einem Anfangs-Job kommen die Erwartungen. Der Backup-Job ist immer der populärste Typ im Stadion. Er erzeugt Hoffnung. Er ist der nächste Typ.
Richtig. Ich glaube, das ist, was Mikey sagt. Mit einem Anfangs-Job kommen die Erwartungen. Der Backup-Job ist immer der populärste Typ im Stadion. Er erzeugt Hoffnung. Er ist der nächste Typ.
Billy, here's a headline. Caleb Williams swears he wants to be in Chicago.
Billy, here's a headline. Caleb Williams swears he wants to be in Chicago.
Billy, here's a headline. Caleb Williams swears he wants to be in Chicago.
Thank you, Fuentes. A very exciting day. Billy already wants to say something. We have not one, but two blind rankings. We have headlines. We have more Mike Lee, but first we go to Billy, because Billy has something to say.
Thank you, Fuentes. A very exciting day. Billy already wants to say something. We have not one, but two blind rankings. We have headlines. We have more Mike Lee, but first we go to Billy, because Billy has something to say.
Thank you, Fuentes. A very exciting day. Billy already wants to say something. We have not one, but two blind rankings. We have headlines. We have more Mike Lee, but first we go to Billy, because Billy has something to say.
You're saying make a mess of it like Eli did when he came out in the draft, right?
You're saying make a mess of it like Eli did when he came out in the draft, right?
You're saying make a mess of it like Eli did when he came out in the draft, right?
On the front end, probably not. He was hyped enough. He was not good enough, Mike. He was the number one or number two pick?
On the front end, probably not. He was hyped enough. He was not good enough, Mike. He was the number one or number two pick?
On the front end, probably not. He was hyped enough. He was not good enough, Mike. He was the number one or number two pick?
Und er hatte Archie, seinen Vater, die Arbeit und die Gespräche für ihn.
Und er hatte Archie, seinen Vater, die Arbeit und die Gespräche für ihn.
Und er hatte Archie, seinen Vater, die Arbeit und die Gespräche für ihn.
Der Mist hat gekostet, Billy. Er hat zwei Superbowl gewonnen als New York Giants Quarterback und beide kamen gegen Tom Brady.
Der Mist hat gekostet, Billy. Er hat zwei Superbowl gewonnen als New York Giants Quarterback und beide kamen gegen Tom Brady.
Der Mist hat gekostet, Billy. Er hat zwei Superbowl gewonnen als New York Giants Quarterback und beide kamen gegen Tom Brady.
Just asking here. Just asking here. Alright, that's a good question. Mikey, do you have a headline for us?
Just asking here. Just asking here. Alright, that's a good question. Mikey, do you have a headline for us?
Just asking here. Just asking here. Alright, that's a good question. Mikey, do you have a headline for us?
I don't know. So Diggs was not at practice after this video surfaced, because Mike Rabel is the coach, Patriot Way, all that.
I don't know. So Diggs was not at practice after this video surfaced, because Mike Rabel is the coach, Patriot Way, all that.
I don't know. So Diggs was not at practice after this video surfaced, because Mike Rabel is the coach, Patriot Way, all that.
Ich meine, ich habe nur ein Wochenende in Foxborough verbracht. Ich würde auf einem Boot gehen. Ich würde alles tun, außer einen Tag in Foxborough verbringen. Wenn ich ganz ehrlich bin. Es ist so seltsam, dass das Stadion so weit von Boston ist.
Ich meine, ich habe nur ein Wochenende in Foxborough verbracht. Ich würde auf einem Boot gehen. Ich würde alles tun, außer einen Tag in Foxborough verbringen. Wenn ich ganz ehrlich bin. Es ist so seltsam, dass das Stadion so weit von Boston ist.
Ich meine, ich habe nur ein Wochenende in Foxborough verbracht. Ich würde auf einem Boot gehen. Ich würde alles tun, außer einen Tag in Foxborough verbringen. Wenn ich ganz ehrlich bin. Es ist so seltsam, dass das Stadion so weit von Boston ist.
Level one to ten, ten being the highest, like he takes no nonsense?
Level one to ten, ten being the highest, like he takes no nonsense?
Level one to ten, ten being the highest, like he takes no nonsense?
Ich werde dir sagen, dass ich für Golik bei dem Lake Tahoe Golf-Tournament gekaddet habe. Ray Romano war Teil seines Dreisamens. Der andere war Mike Vrabel. Ich, Golik und Ray Romano hatten einen Blast. Lachen es auf, jucken es auf. Vrabel nicht so viel. Echt? Ein sehr seriöser Golfler.
Ich werde dir sagen, dass ich für Golik bei dem Lake Tahoe Golf-Tournament gekaddet habe. Ray Romano war Teil seines Dreisamens. Der andere war Mike Vrabel. Ich, Golik und Ray Romano hatten einen Blast. Lachen es auf, jucken es auf. Vrabel nicht so viel. Echt? Ein sehr seriöser Golfler.
Ich werde dir sagen, dass ich für Golik bei dem Lake Tahoe Golf-Tournament gekaddet habe. Ray Romano war Teil seines Dreisamens. Der andere war Mike Vrabel. Ich, Golik und Ray Romano hatten einen Blast. Lachen es auf, jucken es auf. Vrabel nicht so viel. Echt? Ein sehr seriöser Golfler.
So at Sajo, just the way they have it laid out, they do. So for the Pro-Am, which I participate in every year and actually play golf, it's foursomes. For the actual tournament itself, they go threesomes. Three celebrities per...
So at Sajo, just the way they have it laid out, they do. So for the Pro-Am, which I participate in every year and actually play golf, it's foursomes. For the actual tournament itself, they go threesomes. Three celebrities per...
So at Sajo, just the way they have it laid out, they do. So for the Pro-Am, which I participate in every year and actually play golf, it's foursomes. For the actual tournament itself, they go threesomes. Three celebrities per...
Vrabes just took he was taking the golf very, very seriously. He didn't want to be bothered. He didn't want, you know, he didn't want me asking questions. I was trying to mess around. I was doing a thing. I was going to go. It's caddy. And like he didn't he didn't want anything of it. I would say that Vrabel is he's pretty high on the no BS meter.
Vrabes just took he was taking the golf very, very seriously. He didn't want to be bothered. He didn't want, you know, he didn't want me asking questions. I was trying to mess around. I was doing a thing. I was going to go. It's caddy. And like he didn't he didn't want anything of it. I would say that Vrabel is he's pretty high on the no BS meter.
Vrabes just took he was taking the golf very, very seriously. He didn't want to be bothered. He didn't want, you know, he didn't want me asking questions. I was trying to mess around. I was doing a thing. I was going to go. It's caddy. And like he didn't he didn't want anything of it. I would say that Vrabel is he's pretty high on the no BS meter.
Wir werden sehen, wie es geht. Okay. Letzte Episode auf MetalArk Media, aber nicht die letzte Episode. In der Tat, wir werden die Fußballspiele erweitern. Also, wenn du dich um Billy und seine Familie interessierst, dann abonniere es. Wenn du dich um Mike Yeh und seine Familie interessierst, abonniere es und rate es. Wenn du dich um Fuentes und seine Familie interessierst, dann abonniere es. Okay?
Wir werden sehen, wie es geht. Okay. Letzte Episode auf MetalArk Media, aber nicht die letzte Episode. In der Tat, wir werden die Fußballspiele erweitern. Also, wenn du dich um Billy und seine Familie interessierst, dann abonniere es. Wenn du dich um Mike Yeh und seine Familie interessierst, abonniere es und rate es. Wenn du dich um Fuentes und seine Familie interessierst, dann abonniere es. Okay?
Wir werden sehen, wie es geht. Okay. Letzte Episode auf MetalArk Media, aber nicht die letzte Episode. In der Tat, wir werden die Fußballspiele erweitern. Also, wenn du dich um Billy und seine Familie interessierst, dann abonniere es. Wenn du dich um Mike Yeh und seine Familie interessierst, abonniere es und rate es. Wenn du dich um Fuentes und seine Familie interessierst, dann abonniere es. Okay?
Well, that's a nice tease, but I think it's the last show and Fuentes has a headline. And so I want to get to Mike Fuentes as well. Fuentes, do you have a headline for us?
Well, that's a nice tease, but I think it's the last show and Fuentes has a headline. And so I want to get to Mike Fuentes as well. Fuentes, do you have a headline for us?
Well, that's a nice tease, but I think it's the last show and Fuentes has a headline. And so I want to get to Mike Fuentes as well. Fuentes, do you have a headline for us?
That's your problem.
That's your problem.
That's your problem.
Yeah, try a different dude. Wait, Will Levis is still in Tennessee, right? Correct. Yes. Ja, nein, nein. Will Levis ging von der meisten... Zurück zu unserer ursprünglichen Gespräche über Joe Flacco, okay? Will Levis ging von einem Jungen, den die Tennessee Titans-Fans bescheiden, zu einem Jungen, der der populärste Jungen im Haus sein wird, wenn Cam Ward schlecht spielt. Was macht er?
Yeah, try a different dude. Wait, Will Levis is still in Tennessee, right? Correct. Yes. Ja, nein, nein. Will Levis ging von der meisten... Zurück zu unserer ursprünglichen Gespräche über Joe Flacco, okay? Will Levis ging von einem Jungen, den die Tennessee Titans-Fans bescheiden, zu einem Jungen, der der populärste Jungen im Haus sein wird, wenn Cam Ward schlecht spielt. Was macht er?
Yeah, try a different dude. Wait, Will Levis is still in Tennessee, right? Correct. Yes. Ja, nein, nein. Will Levis ging von der meisten... Zurück zu unserer ursprünglichen Gespräche über Joe Flacco, okay? Will Levis ging von einem Jungen, den die Tennessee Titans-Fans bescheiden, zu einem Jungen, der der populärste Jungen im Haus sein wird, wenn Cam Ward schlecht spielt. Was macht er?
Bad arm day. It happens.
Bad arm day. It happens.
Bad arm day. It happens.
10.
10.
10.
What are we doing?
What are we doing?
What are we doing?
We checked the videotape. Must have been thinking about something else. Seems like you enjoyed asking that question.
We checked the videotape. Must have been thinking about something else. Seems like you enjoyed asking that question.
We checked the videotape. Must have been thinking about something else. Seems like you enjoyed asking that question.
There's your hint.
There's your hint.
There's your hint.
Bears. Bears.
Bears. Bears.
Bears. Bears.
I'm going to say the... Who did Fuentes say? He said the Carolina Panthers. I'm saying Bears. You're saying Bears, huh? Yeah. I'm saying Raiders.
I'm going to say the... Who did Fuentes say? He said the Carolina Panthers. I'm saying Bears. You're saying Bears, huh? Yeah. I'm saying Raiders.
I'm going to say the... Who did Fuentes say? He said the Carolina Panthers. I'm saying Bears. You're saying Bears, huh? Yeah. I'm saying Raiders.
I'm going to put him at six for me.
I'm going to put him at six for me.
I'm going to put him at six for me.
Thursday night. It's a game. Thursday night. It's a game. It's a solid. Good start to the week.
Thursday night. It's a game. Thursday night. It's a game. It's a solid. Good start to the week.
Thursday night. It's a game. Thursday night. It's a game. It's a solid. Good start to the week.
What a cop-out answer.
What a cop-out answer.
What a cop-out answer.
And I was like, not at 17. I didn't say it was a good pick. I didn't say it was a good pick. I said, he did what he was supposed to do. He's a kicker. He kicks the field goals. It's not his fault he got drafted by Terrible. Was that Al Davis?
And I was like, not at 17. I didn't say it was a good pick. I didn't say it was a good pick. I said, he did what he was supposed to do. He's a kicker. He kicks the field goals. It's not his fault he got drafted by Terrible. Was that Al Davis?
And I was like, not at 17. I didn't say it was a good pick. I didn't say it was a good pick. I said, he did what he was supposed to do. He's a kicker. He kicks the field goals. It's not his fault he got drafted by Terrible. Was that Al Davis?
Exactly. But that's the Raiders' fault. That's not his fault. You could have taken him like that. You know what? It's only his fault.
Exactly. But that's the Raiders' fault. That's not his fault. You could have taken him like that. You know what? It's only his fault.
Exactly. But that's the Raiders' fault. That's not his fault. You could have taken him like that. You know what? It's only his fault.
You think the Jets were like, damn, we missed out on Janikowski? Who had a better career?
You think the Jets were like, damn, we missed out on Janikowski? Who had a better career?
You think the Jets were like, damn, we missed out on Janikowski? Who had a better career?
I mean, that's all.
I mean, that's all.
I mean, that's all.
I was about to say, he rode that season for years. He rode that season for years. He did his job.
I was about to say, he rode that season for years. He rode that season for years. He did his job.
I was about to say, he rode that season for years. He rode that season for years. He did his job.
That's my pick. I think they'd be good enough to not get the number one pick, but that's it.
That's my pick. I think they'd be good enough to not get the number one pick, but that's it.
That's my pick. I think they'd be good enough to not get the number one pick, but that's it.
I don't think Russell Wilson is a 14-loss guy yet. Alright, so I'm taking the Saints here. Who are you going with, Billy?
I don't think Russell Wilson is a 14-loss guy yet. Alright, so I'm taking the Saints here. Who are you going with, Billy?
I don't think Russell Wilson is a 14-loss guy yet. Alright, so I'm taking the Saints here. Who are you going with, Billy?
Ich würde sagen, dass die Buckeyes die Chancen haben. Wirklich? Ja, die Buckeyes. Sie garantieren die Playoffs jedes Jahr. Sie müssen nicht durch Patrick Mahomes gehen. Oder Josh Allen oder wer auch immer sie in der Superbowl sind. Aber die Eagles sind schon durch Patrick Mahomes gegangen. Sie sind fast zweimal durchgegangen. Ja, aber sie hatten einen wunderschönen, perfekten Sturm im Gegensatz.
Ich würde sagen, dass die Buckeyes die Chancen haben. Wirklich? Ja, die Buckeyes. Sie garantieren die Playoffs jedes Jahr. Sie müssen nicht durch Patrick Mahomes gehen. Oder Josh Allen oder wer auch immer sie in der Superbowl sind. Aber die Eagles sind schon durch Patrick Mahomes gegangen. Sie sind fast zweimal durchgegangen. Ja, aber sie hatten einen wunderschönen, perfekten Sturm im Gegensatz.
Ich würde sagen, dass die Buckeyes die Chancen haben. Wirklich? Ja, die Buckeyes. Sie garantieren die Playoffs jedes Jahr. Sie müssen nicht durch Patrick Mahomes gehen. Oder Josh Allen oder wer auch immer sie in der Superbowl sind. Aber die Eagles sind schon durch Patrick Mahomes gegangen. Sie sind fast zweimal durchgegangen. Ja, aber sie hatten einen wunderschönen, perfekten Sturm im Gegensatz.
Ich weiß nicht, ob man das jedes Jahr replizieren kann.
Ich weiß nicht, ob man das jedes Jahr replizieren kann.
Ich weiß nicht, ob man das jedes Jahr replizieren kann.
God bless football, Fuentes. God bless football, Stugatz.
God bless football, Fuentes. God bless football, Stugatz.
God bless football, Fuentes. God bless football, Stugatz.
The Jacksonville Jaguars released wide receiver Gabe Davis one year after signing him to a $39 million contract.
The Jacksonville Jaguars released wide receiver Gabe Davis one year after signing him to a $39 million contract.
The Jacksonville Jaguars released wide receiver Gabe Davis one year after signing him to a $39 million contract.
He'll always have that four-touchdown game.
He'll always have that four-touchdown game.
He'll always have that four-touchdown game.
I don't blame Gabe Davis at all. I don't blame him.
I don't blame Gabe Davis at all. I don't blame him.
I don't blame Gabe Davis at all. I don't blame him.
He didn't do anything. That's the problem.
He didn't do anything. That's the problem.
He didn't do anything. That's the problem.
In 10 games he had 20 catches, 239 yards, 10 touchdowns. No, 2 touchdowns, sorry. I got excited. I saw 10 there in 10 games. 10, he'd still be a Jaguar.
In 10 games he had 20 catches, 239 yards, 10 touchdowns. No, 2 touchdowns, sorry. I got excited. I saw 10 there in 10 games. 10, he'd still be a Jaguar.
In 10 games he had 20 catches, 239 yards, 10 touchdowns. No, 2 touchdowns, sorry. I got excited. I saw 10 there in 10 games. 10, he'd still be a Jaguar.
Es ist immer noch das eine kleine Video. Ja. Das Bild. Ja. Wie lange hat das gespielt?
Es ist immer noch das eine kleine Video. Ja. Das Bild. Ja. Wie lange hat das gespielt?
Es ist immer noch das eine kleine Video. Ja. Das Bild. Ja. Wie lange hat das gespielt?
Slightly older than I felt five seconds ago.
Slightly older than I felt five seconds ago.
When was Shador Sanders born?
When was Shador Sanders born?
You're looking it up right now.
You're looking it up right now.
By the way, I think I could eat the appropriate amount of McDonald's in 36 hours to get a million dollars. I could do it.
By the way, I think I could eat the appropriate amount of McDonald's in 36 hours to get a million dollars. I could do it.
I think I could. But Billy, there's a million dollars waiting for you at the end of the rainbow.
I think I could. But Billy, there's a million dollars waiting for you at the end of the rainbow.
He has a lawyer. That's right. Someone's going to eat this, okay, over 36 hours and not win any money because of legalities. Billy's right about this. Yes. Mr. Beast has no intention of giving this million dollars away.
He has a lawyer. That's right. Someone's going to eat this, okay, over 36 hours and not win any money because of legalities. Billy's right about this. Yes. Mr. Beast has no intention of giving this million dollars away.
He gives away a million dollars all the time? All the time. It's crazy how much money he gives away.
He gives away a million dollars all the time? All the time. It's crazy how much money he gives away.
To make pics with the kid. Okay. We're back after this.
To make pics with the kid. Okay. We're back after this.
All right. So the games that we have on the table today are more Mike Lee. You're familiar with that one.
All right. So the games that we have on the table today are more Mike Lee. You're familiar with that one.
Love that one. Anonymous sources. You're familiar with that one.
Love that one. Anonymous sources. You're familiar with that one.
Okay. The final game on the table, I'm leaning towards anonymous sources right now, just so you know, because you're very excited about it.
Okay. The final game on the table, I'm leaning towards anonymous sources right now, just so you know, because you're very excited about it.
I know. Is Fuentes' blind rankings.
I know. Is Fuentes' blind rankings.
You're not familiar with this game, Billy. So now I'm tempted to go there first because you're not familiar. Fuentes, explain your game to Billy and see if he understands.
You're not familiar with this game, Billy. So now I'm tempted to go there first because you're not familiar. Fuentes, explain your game to Billy and see if he understands.
Oh, my God, and a couch.
Oh, my God, and a couch.
Yeah, the couch show up here? I don't know.
Yeah, the couch show up here? I don't know.
Wait, so Fontes, tell Billy where Mikey A had Justin Fields ranked in his quarterback rankings.
Wait, so Fontes, tell Billy where Mikey A had Justin Fields ranked in his quarterback rankings.
But there's a lesson to be learned from last week's game. When you hear Josh Allen, just rank him number one.
But there's a lesson to be learned from last week's game. When you hear Josh Allen, just rank him number one.
Yeah, we all do blind rankings. So, Billy, you decide here on the game. More Mike Lee, anonymous sources, Fuentes' blind rankings, or a bone to pick?
Yeah, we all do blind rankings. So, Billy, you decide here on the game. More Mike Lee, anonymous sources, Fuentes' blind rankings, or a bone to pick?
We're getting 10, right?
We're getting 10, right?
I had Josh Allen, man. Don't complain to him. I had Josh Allen.
I had Josh Allen, man. Don't complain to him. I had Josh Allen.
A.J. Brown, I'm going to rank him third on my list. Third. Third.
A.J. Brown, I'm going to rank him third on my list. Third. Third.
I'm going to put him at six. Wow, Billy. I like that. That could work in your favor or it could embarrass you. It could be a disaster.
I'm going to put him at six. Wow, Billy. I like that. That could work in your favor or it could embarrass you. It could be a disaster.
I'll put Puka four. I can't believe I'm putting Puka four.
I'll put Puka four. I can't believe I'm putting Puka four.
I have to write them down.
I have to write them down.
That's a great point, Billy.
That's a great point, Billy.
Jesus Christ. Um... God, he's good. Underrated, in my opinion. I'm going to put... I'm hesitant to do this. Nico at five.
Jesus Christ. Um... God, he's good. Underrated, in my opinion. I'm going to put... I'm hesitant to do this. Nico at five.
I mean, Billy, I'll tell you this. I probably would put, had I not put AJ at three and Pook at four, I'd probably put Nico at three.
I mean, Billy, I'll tell you this. I probably would put, had I not put AJ at three and Pook at four, I'd probably put Nico at three.
I'll put Diggs at eight. Stefan digs at eight.
I'll put Diggs at eight. Stefan digs at eight.
I'm outraged by this. If I knew it was wide receiver ones, I would have changed my order. Yeah, I thought we had some wide receiver threes coming our way. I fully thought Berrios was coming up at some point. Malik neighbors. Neighbors at eight. Neighbors at eight. I'll put neighbors at six, I guess.
I'm outraged by this. If I knew it was wide receiver ones, I would have changed my order. Yeah, I thought we had some wide receiver threes coming our way. I fully thought Berrios was coming up at some point. Malik neighbors. Neighbors at eight. Neighbors at eight. I'll put neighbors at six, I guess.
God bless football, Billy Gill. God bless football, Mikey A. God bless football, Fuentes.
God bless football, Billy Gill. God bless football, Mikey A. God bless football, Fuentes.
I have neighbors at six. Yes.
I have neighbors at six. Yes.
10 oh come on that's not a number one he's not a number one that's not a number one good job saving your 10 good job watching read anyone he's better he's better than all those guys all right good job saving your 10 stugats yeah thank you thank you save my 10 for golden i have golden at nine and you seven you have now lied to us about how this game works multiple times okay mikey mikey you have matt golden where
10 oh come on that's not a number one he's not a number one that's not a number one good job saving your 10 good job watching read anyone he's better he's better than all those guys all right good job saving your 10 stugats yeah thank you thank you save my 10 for golden i have golden at nine and you seven you have now lied to us about how this game works multiple times okay mikey mikey you have matt golden where
DJ Moore. I will put DJ Moore at seven on my list.
DJ Moore. I will put DJ Moore at seven on my list.
Please. According to you, Golden's going to be the rookie of the year. He might be the MVP.
Please. According to you, Golden's going to be the rookie of the year. He might be the MVP.
It's going to be Matt Golden or Justin Fields.
It's going to be Matt Golden or Justin Fields.
I'm playing well, too. You are? Yes. Mikey? I already said three.
I'm playing well, too. You are? Yes. Mikey? I already said three.
All right, but we're outside that window right now, correct? They're late. But we're getting close.
All right, but we're outside that window right now, correct? They're late. But we're getting close.
Yeah, but he's probably not in this game. You can make the argument.
Yeah, but he's probably not in this game. You can make the argument.
All right, I'll put Chase at one. Because I have no issue putting Justin in if he is in this game.
All right, I'll put Chase at one. Because I have no issue putting Justin in if he is in this game.
I got to tell you, if I was asked to rank these guys, this is the way I would probably rank them.
I got to tell you, if I was asked to rank these guys, this is the way I would probably rank them.
Are we? Okay. So there's a chance that someone might deliver a couch to your house while we're on the air doing the show here.
Are we? Okay. So there's a chance that someone might deliver a couch to your house while we're on the air doing the show here.
You're an idiot.
You're an idiot.
No, but if you told us 32 number ones, perhaps we would have adjusted our list accordingly.
No, but if you told us 32 number ones, perhaps we would have adjusted our list accordingly.
Everybody somehow had to open. Just to be clear, we all have Ladd-McConkie being better than A.J. Brown, Puka Nakua, Nico Collins, and Malik Neighbors.
Everybody somehow had to open. Just to be clear, we all have Ladd-McConkie being better than A.J. Brown, Puka Nakua, Nico Collins, and Malik Neighbors.
If I could redo the entire list, I'd throw Golden off the list. Thank you for this information.
If I could redo the entire list, I'd throw Golden off the list. Thank you for this information.
Oh, yeah, but they're touchdowns all the time. Yes.
Oh, yeah, but they're touchdowns all the time. Yes.
Anonymous sources, and we pick a boat. Next. The debate continued during the break as to whether Matt Golden should have been included in Fuentes' list. I am with Billy. It is blasphemy. How is Matt Golden a number one wide receiver? He hasn't played a game in the NFL yet.
Anonymous sources, and we pick a boat. Next. The debate continued during the break as to whether Matt Golden should have been included in Fuentes' list. I am with Billy. It is blasphemy. How is Matt Golden a number one wide receiver? He hasn't played a game in the NFL yet.
Are we, Billy?
Are we, Billy?
What if someone said the couch is coming? No one looks forward to the couch coming. Nobody. I do. I'm looking forward to the couch. You look forward to getting the new couch and sitting in the comfortable new couch, but no one looks forward to the delivery of said couch, right?
What if someone said the couch is coming? No one looks forward to the couch coming. Nobody. I do. I'm looking forward to the couch. You look forward to getting the new couch and sitting in the comfortable new couch, but no one looks forward to the delivery of said couch, right?
I so badly want this to happen while we're on. on the air recording here. Please let it happen. Stop four right now. You're stop five. Yeah.
I so badly want this to happen while we're on. on the air recording here. Please let it happen. Stop four right now. You're stop five. Yeah.
Those stops are a tricky game though. I mean, sometimes, you know, some stops could take 15 minutes. Some stops could take, you know, an hour.
Those stops are a tricky game though. I mean, sometimes, you know, some stops could take 15 minutes. Some stops could take, you know, an hour.
Yeah. Billy, what do you want to do here? Anonymous sources, more Mike Lee, or you want to, you have a bone to pick.
Yeah. Billy, what do you want to do here? Anonymous sources, more Mike Lee, or you want to, you have a bone to pick.
I thought you were going to clobber Fuentes for Matt Golden. I was about to say, if you guys bring up that damn game.
I thought you were going to clobber Fuentes for Matt Golden. I was about to say, if you guys bring up that damn game.
What? Yeah. I knew it.
What? Yeah. I knew it.
I thought Michigan would have been better. That's what I said on Greg Cody's show. I had three picks in the top 12, and how were they so bad last year? That's what I said. I mean, that and I was not surprised Shador Sanders did not get selected in the first round. I didn't think he'd last until the fifth round, but I was not surprised he was not drafted in the first round, so...
I thought Michigan would have been better. That's what I said on Greg Cody's show. I had three picks in the top 12, and how were they so bad last year? That's what I said. I mean, that and I was not surprised Shador Sanders did not get selected in the first round. I didn't think he'd last until the fifth round, but I was not surprised he was not drafted in the first round, so...
I think a lot of media people boosted his value because they didn't want to piss off Deion Sanders. Seriously. Like, they have relationships with him, and they didn't want to upset Deion, and they probably knew he wasn't that good all along.
I think a lot of media people boosted his value because they didn't want to piss off Deion Sanders. Seriously. Like, they have relationships with him, and they didn't want to upset Deion, and they probably knew he wasn't that good all along.
On the way from where? On the way from where, though?
On the way from where? On the way from where, though?
That was a quick delivery. I got to be honest.
That was a quick delivery. I got to be honest.
Billy, you want more Mike Lee? By the way, you picked your bone. It's a fair bone to pick. Bone picked. I apologize. Bone picked. I'll do better moving forward. I want to say I'll do better, but I probably won't.
Billy, you want more Mike Lee? By the way, you picked your bone. It's a fair bone to pick. Bone picked. I apologize. Bone picked. I'll do better moving forward. I want to say I'll do better, but I probably won't.
Say what? But listen, you and I both have an allegiance to Greg Cody. We love him. And so when he asked me to do something, I don't want to say no to Greg.
Say what? But listen, you and I both have an allegiance to Greg Cody. We love him. And so when he asked me to do something, I don't want to say no to Greg.
OK, you're right. You're right about that. More Mike Lee or anonymous sources. Which one? Where do you want to go here, Billy? Let's do.
OK, you're right. You're right about that. More Mike Lee or anonymous sources. Which one? Where do you want to go here, Billy? Let's do.
I'm going to stay with Fuentes. I think it's Jackson. I think it is the obvious choice this time. And Buscelli with analytics, get the hell out of here.
I'm going to stay with Fuentes. I think it's Jackson. I think it is the obvious choice this time. And Buscelli with analytics, get the hell out of here.
When that young GM goes to Buscelli and shows him the analytics, what do you think Buscelli says to that kid?
When that young GM goes to Buscelli and shows him the analytics, what do you think Buscelli says to that kid?
I'm going to say I like this game so much I want more.
I'm going to say I like this game so much I want more.
I love the game Anonymous Sources so much. I want to play more. I do. Billy, do we have a quick update on the couch here? What's going on there?
I love the game Anonymous Sources so much. I want to play more. I do. Billy, do we have a quick update on the couch here? What's going on there?
Thank you, Mikey A. Thank you, Fuentes. Sorry about that. No, you're welcome. I got my mics mixed. Listen, I got them mixed up. I'm sorry about that. We have a brand new segment that we're going to debut this week. I'm very excited for it. A bone to pick. Billy has a bone to pick. Yes, now we're going to get to that. We have a lot of things to get to. More Mike Lee. Hey, here's a headline.
Thank you, Mikey A. Thank you, Fuentes. Sorry about that. No, you're welcome. I got my mics mixed. Listen, I got them mixed up. I'm sorry about that. We have a brand new segment that we're going to debut this week. I'm very excited for it. A bone to pick. Billy has a bone to pick. Yes, now we're going to get to that. We have a lot of things to get to. More Mike Lee. Hey, here's a headline.
Why, Billy, do you want to go more Mike Lee? Like, I'll do whatever you want here.
Why, Billy, do you want to go more Mike Lee? Like, I'll do whatever you want here.
Right. I'm going to say Arizona.
Right. I'm going to say Arizona.
I'm like Fuentes. You set it up correctly.
I'm like Fuentes. You set it up correctly.
AFC. This is a tough one. AFC. It's got to be Jacksonville then, no?
AFC. This is a tough one. AFC. It's got to be Jacksonville then, no?
Who is it? Drats. Who is it?
Who is it? Drats. Who is it?
Nico Collins. Man, fifth best wide receiver on my list.
Nico Collins. Man, fifth best wide receiver on my list.
Wow. I'm going to say the Kansas City Chiefs.
Wow. I'm going to say the Kansas City Chiefs.
I love this game. I could play this game all night. Good job, Stu Goss.
I love this game. I could play this game all night. Good job, Stu Goss.
Thank you, Billy. Oh, my God. It's a great game. More Mike Lee? Like, give me one. Just give me one.
Thank you, Billy. Oh, my God. It's a great game. More Mike Lee? Like, give me one. Just give me one.
It was the Dolphin Mall appearance that we did, and Billy gave away five books and gave away all the money in my pocket.
It was the Dolphin Mall appearance that we did, and Billy gave away five books and gave away all the money in my pocket.
It was a fun day.
It was a fun day.
Was it? Was it really?
Was it? Was it really?
Subscribe, please. Download, subscribe, rate, review, all those fun things. Do it for Billy. Do it for Mikey A. Do it for me because we own this property now.
Subscribe, please. Download, subscribe, rate, review, all those fun things. Do it for Billy. Do it for Mikey A. Do it for me because we own this property now.
Right. I feel like it's been you know, I feel like it was sooner than that. Mikey and I did a couple episodes last week of some stuff.
Right. I feel like it's been you know, I feel like it was sooner than that. Mikey and I did a couple episodes last week of some stuff.
Mel Kiper on. We had Todd McShay on. to get people ready for the draft. But you're right. We have not been together for quite some time.
Mel Kiper on. We had Todd McShay on. to get people ready for the draft. But you're right. We have not been together for quite some time.
So I'm not going to, oh, I react.
So I'm not going to, oh, I react.
Oh, I see. I thought we were doing headline or not a headline.
Oh, I see. I thought we were doing headline or not a headline.
Well, I thought that was the game. You were trying to see if I could figure out the game on the fly here. I've never played the game before. You guys invented the game while I was away, and I was trying to see if I could keep up with the game. That's all I was trying to do.
Well, I thought that was the game. You were trying to see if I could figure out the game on the fly here. I've never played the game before. You guys invented the game while I was away, and I was trying to see if I could keep up with the game. That's all I was trying to do.
No, I do think it happened, and I don't really think it's a newsworthy story, but I'm happy to give my thoughts on it if that's part of the game.
No, I do think it happened, and I don't really think it's a newsworthy story, but I'm happy to give my thoughts on it if that's part of the game.
But Mikey, you would agree we need to start with what's going on in Billy's house, right?
But Mikey, you would agree we need to start with what's going on in Billy's house, right?
So your son or your daughter did something. They don't have the money to pay for it. You didn't give them permission to do it. It's going to cost you $100,000.
So your son or your daughter did something. They don't have the money to pay for it. You didn't give them permission to do it. It's going to cost you $100,000.
The 21-year-old...
The 21-year-old...
I don't care. He could drink. He can go to a bar. He could serve our military. He could do whatever he wants. That should not be on dad. That should be on a 21-year-old making a bad decision. Well, a good decision, depending on how you look at it. Or a bad decision. Making a prank call that cost him $100,000. It should not cost his parents anything. Not a penny.
I don't care. He could drink. He can go to a bar. He could serve our military. He could do whatever he wants. That should not be on dad. That should be on a 21-year-old making a bad decision. Well, a good decision, depending on how you look at it. Or a bad decision. Making a prank call that cost him $100,000. It should not cost his parents anything. Not a penny.
So Billy, explain to the audience what is going on at your house right now.
So Billy, explain to the audience what is going on at your house right now.
So, Billy, I just want to be clear here. You're blaming dad for leaving his phone just laying around the house. He's supposed to have that locked up at all times.
So, Billy, I just want to be clear here. You're blaming dad for leaving his phone just laying around the house. He's supposed to have that locked up at all times.
That's a terrible job by this kid. I mean, seriously, dad should make the kid work and pay off the $100,000.
That's a terrible job by this kid. I mean, seriously, dad should make the kid work and pay off the $100,000.
One dish at a time, yes.
One dish at a time, yes.
Right. Yeah. But this kid graduated college, it seems like. I mean, he's already back home living with dad.
Right. Yeah. But this kid graduated college, it seems like. I mean, he's already back home living with dad.
Yeah, but dad has to pay it. Kid has to pay him back. To Billy's point, assign these chores a very low dollar amount and have them do a million of them.
Yeah, but dad has to pay it. Kid has to pay him back. To Billy's point, assign these chores a very low dollar amount and have them do a million of them.
Well, yeah, I mean, he deserves it.
Well, yeah, I mean, he deserves it.
And I mean, the audacity of this kid to blame his dad for having a lot of contacts in his phone and leaving his phone laying around the house. Who would do that? What kind of son is this?
And I mean, the audacity of this kid to blame his dad for having a lot of contacts in his phone and leaving his phone laying around the house. Who would do that? What kind of son is this?
It's been an interesting few weeks. I got to say like a bunch of new games. Mikey had some new games. Billy had some new games. This is my first new game. Still got to wait for you to come back for this one. Wow. Because you would appreciate this game has a little bit of a twist because
It's been an interesting few weeks. I got to say like a bunch of new games. Mikey had some new games. Billy had some new games. This is my first new game. Still got to wait for you to come back for this one. Wow. Because you would appreciate this game has a little bit of a twist because
There's one thing I know about- Yeah, well, there's one thing I know about Stu is he likes talking quarterbacks and ranking quarterbacks. I do. He loves doing that. I mean, who doesn't? Let's be honest. Exactly. Sure. We're doing a little bit of a twist on this one. It's gonna be called Blind Rankings, and we're gonna blind rank some quarterbacks coming up.
There's one thing I know about- Yeah, well, there's one thing I know about Stu is he likes talking quarterbacks and ranking quarterbacks. I do. He loves doing that. I mean, who doesn't? Let's be honest. Exactly. Sure. We're doing a little bit of a twist on this one. It's gonna be called Blind Rankings, and we're gonna blind rank some quarterbacks coming up.
And this game is presented by Smirnoff, the world's number one vodka. Please drink responsibly. Now, how it's gonna work, Stu, is we're gonna do 34 quarterbacks.
And this game is presented by Smirnoff, the world's number one vodka. Please drink responsibly. Now, how it's gonna work, Stu, is we're gonna do 34 quarterbacks.
all the starting quarterbacks in the league plus Cam Ward plus Aaron Rodgers but you're only going to rank 10 of them and you don't know who's coming back I mean who's coming next and here's the thing I'm going to cover this real quick so you don't see it I've already randomized the quarterbacks so that way I'm not pulling any tricks on you I'm not you know just saying good guys after you're already ranked trying to catch you in something
all the starting quarterbacks in the league plus Cam Ward plus Aaron Rodgers but you're only going to rank 10 of them and you don't know who's coming back I mean who's coming next and here's the thing I'm going to cover this real quick so you don't see it I've already randomized the quarterbacks so that way I'm not pulling any tricks on you I'm not you know just saying good guys after you're already ranked trying to catch you in something
So that's how it starts. So I'm going to name a quarterback. You rank them 1 through 10 without knowing the next quarterback in the sequence.
So that's how it starts. So I'm going to name a quarterback. You rank them 1 through 10 without knowing the next quarterback in the sequence.
All right. Go ahead. So remember, it's the starting – 32 starting quarterbacks plus Cam Ward because, obviously, after next week he'll be in the league. And Aaron Rodgers because we don't know where he is, but he might –
All right. Go ahead. So remember, it's the starting – 32 starting quarterbacks plus Cam Ward because, obviously, after next week he'll be in the league. And Aaron Rodgers because we don't know where he is, but he might –
in the league okay yeah okay so we're gonna start totally all these games by the way again are brought to you by smirnoff and also brought to you by the offseason yeah exactly brought to you by by by april football talk okay ready okay quarterback number one okay funny it came up this way cam ward the has been finalist from the university of miami cam ward where do you rank them one through ten blindly cam ward one through ten i'm gonna put them 10th how about that that's fine
in the league okay yeah okay so we're gonna start totally all these games by the way again are brought to you by smirnoff and also brought to you by the offseason yeah exactly brought to you by by by april football talk okay ready okay quarterback number one okay funny it came up this way cam ward the has been finalist from the university of miami cam ward where do you rank them one through ten blindly cam ward one through ten i'm gonna put them 10th how about that that's fine
Number two. Yes. Mikey's favorite quarterback, Aaron Rodgers. Where do you rank Aaron Rodgers in the blind ranking top 10? Eighth. Mikey is jumping with eighth. A little bit above Cam Ward. Interesting.
Number two. Yes. Mikey's favorite quarterback, Aaron Rodgers. Where do you rank Aaron Rodgers in the blind ranking top 10? Eighth. Mikey is jumping with eighth. A little bit above Cam Ward. Interesting.
I love that Cam Ward's never played a game before. The Super Bowl champion, multiple-time MVP.
I love that Cam Ward's never played a game before. The Super Bowl champion, multiple-time MVP.
In front. In front. No, Aaron Rodgers in front.
In front. In front. No, Aaron Rodgers in front.
Currently, no. He's in the league, just not signed.
Currently, no. He's in the league, just not signed.
I don't know. So this is a godless football favorite. Washington Commanders quarterback, Jaden Daniels. Oh, wow. I'm guessing he's cracking the top five for both of you.
I don't know. So this is a godless football favorite. Washington Commanders quarterback, Jaden Daniels. Oh, wow. I'm guessing he's cracking the top five for both of you.
Well, technically, it's going to be a sophomore slump either way, right? Unless he wins a Super Bowl.
Well, technically, it's going to be a sophomore slump either way, right? Unless he wins a Super Bowl.
You're right.
You're right.
I got you, Stu.
I got you, Stu.
Okay. Number five. Very exciting. Detroit Lions quarterback, Jared Goff.
Okay. Number five. Very exciting. Detroit Lions quarterback, Jared Goff.
Jared Goff, number six. Jared Goff, number six for Mikey A.
Jared Goff, number six. Jared Goff, number six for Mikey A.
I know it.
I know it.
Go ahead. Okay, the next one up is newly acquired Seattle Seahawks quarterback, Sam Darnold.
Go ahead. Okay, the next one up is newly acquired Seattle Seahawks quarterback, Sam Darnold.
You have Jaden Daniels at 4, Jared Goff at 5, Aaron Rodgers is 8, Cam Ward at 10. So you have 1, 2, 3, 6, 7, and 9 available.
You have Jaden Daniels at 4, Jared Goff at 5, Aaron Rodgers is 8, Cam Ward at 10. So you have 1, 2, 3, 6, 7, and 9 available.
Seven for Sam Darnold.
Seven for Sam Darnold.
Yes, Aaron Rodgers at eight. If he hit me with a bunch of MVPs right now, I'm going to have to put one of them at ten. Well, here you go. Next one on the list, Buffalo Bills quarterback Josh Allen. Where do you rank Josh Allen? On our blind quarterbacks ranking list. Number two. Number two for Mikey A., Josh Allen.
Yes, Aaron Rodgers at eight. If he hit me with a bunch of MVPs right now, I'm going to have to put one of them at ten. Well, here you go. Next one on the list, Buffalo Bills quarterback Josh Allen. Where do you rank Josh Allen? On our blind quarterbacks ranking list. Number two. Number two for Mikey A., Josh Allen.
Number one, Josh Allen.
Number one, Josh Allen.
He randomized it. I'm being true to the game. I like Mr. Steinfeld at number one. I do like him because you can make an argument, Stu can, that that's the right pick no matter who comes after.
He randomized it. I'm being true to the game. I like Mr. Steinfeld at number one. I do like him because you can make an argument, Stu can, that that's the right pick no matter who comes after.
No, no. I'm staying true to the list, but I like Josh Allen.
No, no. I'm staying true to the list, but I like Josh Allen.
Okay. I got it. The next name on our list. Chicago Bears quarterback, Caleb Williams. Do you believe? Ten. Wow. Ten. Ten. Ten.
Okay. I got it. The next name on our list. Chicago Bears quarterback, Caleb Williams. Do you believe? Ten. Wow. Ten. Ten. Ten.
What slots do I have left? You have two, three, six, and nine. Nine for Caleb Williams. Nine for Caleb Williams. I have two, three, and six left. Okay.
What slots do I have left? You have two, three, six, and nine. Nine for Caleb Williams. Nine for Caleb Williams. I have two, three, and six left. Okay.
okay so nine for caleb williams next on the list another young struggling quarterback small in stature but showed some signs last year no bryce young bryce young oh wow wow i mean you have no choice i have no choice i still have the sixth slot left so i'm okay yep i'll put him at six yeah mikey rough bryce young currently better than jayden daniels and jericho
okay so nine for caleb williams next on the list another young struggling quarterback small in stature but showed some signs last year no bryce young bryce young oh wow wow i mean you have no choice i have no choice i still have the sixth slot left so i'm okay yep i'll put him at six yeah mikey rough bryce young currently better than jayden daniels and jericho
And Aaron Rodgers, yeah. I'm winning the game. Oddly, Stu is. Oddly, Stu is. We'll see. Okay, next up on our list, newly acquired overpaid quarterback, Russell Wilson.
And Aaron Rodgers, yeah. I'm winning the game. Oddly, Stu is. Oddly, Stu is. We'll see. Okay, next up on our list, newly acquired overpaid quarterback, Russell Wilson.
Sam Darnold.
Sam Darnold.
Russell Wilson is your number two.
Russell Wilson is your number two.
He did. Who's my number one quarterback? Mikey's number one quarterback. Stu's number two quarterback in the league. It's really funny this worked out that way. Justin Fields.
He did. Who's my number one quarterback? Mikey's number one quarterback. Stu's number two quarterback in the league. It's really funny this worked out that way. Justin Fields.
As you can see here, the list was printed out. I did make one mistake. I said Jared Goff before Sam Darnold, so I had to switch those. Either way, irrelevant. Justin Fields, Mikey A's number one quarterback.
As you can see here, the list was printed out. I did make one mistake. I said Jared Goff before Sam Darnold, so I had to switch those. Either way, irrelevant. Justin Fields, Mikey A's number one quarterback.
Oh, another thing I did that I see here that if you could see, Deshaun Watson made it on this list by accident, so I crossed him out because he's not going to be a starting quarterback next season.
Oh, another thing I did that I see here that if you could see, Deshaun Watson made it on this list by accident, so I crossed him out because he's not going to be a starting quarterback next season.
If you put him back – yeah, well, if he would have been the sixth guy, so he would have been right before Josh Allen. He would have been before Josh Allen, so he would have been Mikey Ace 10 because he would have been before Caleb Williams. So that would have worked out for Mikey. And it would have been your nine. So that would have worked out.
If you put him back – yeah, well, if he would have been the sixth guy, so he would have been right before Josh Allen. He would have been before Josh Allen, so he would have been Mikey Ace 10 because he would have been before Caleb Williams. So that would have worked out for Mikey. And it would have been your nine. So that would have worked out.
He did. He really did.
He did. He really did.
Well, you know what it was? Mikey was so scared of Patrick Mahomes coming up that he was like, I'm going to say Josh Allen. No, honestly, I was hoping for a Joe Burrow.
Well, you know what it was? Mikey was so scared of Patrick Mahomes coming up that he was like, I'm going to say Josh Allen. No, honestly, I was hoping for a Joe Burrow.
Yeah, Tua would have come up. So let me give you the next three quarterbacks that would have came if I would have just extended the list three more people. The next person on my list was Dak Prescott. Okay. Then you would have had Patrick Mahomes, Matt Stafford. And then would have been Drake May and Lamar Jackson after that.
Yeah, Tua would have come up. So let me give you the next three quarterbacks that would have came if I would have just extended the list three more people. The next person on my list was Dak Prescott. Okay. Then you would have had Patrick Mahomes, Matt Stafford. And then would have been Drake May and Lamar Jackson after that.
Oh, man.
Oh, man.
I'm better than that guy. Talking about the draft, I remember working up to the draft last year. He was like a projected third rounder. And then all of a sudden he shot up the boards and luckily for the commanders, they believe the hype took him and then NFC Championship.
I'm better than that guy. Talking about the draft, I remember working up to the draft last year. He was like a projected third rounder. And then all of a sudden he shot up the boards and luckily for the commanders, they believe the hype took him and then NFC Championship.
Sure, that was the only guy I was going to say that you're LeBron James 100%. Yeah, maybe Kevin Durant. I was staying in football, yeah.
Sure, that was the only guy I was going to say that you're LeBron James 100%. Yeah, maybe Kevin Durant. I was staying in football, yeah.
This episode of God Bless Football is presented by Smirnoff. We do game days. Please drink responsibly. The Smirnoff Company, New York, New York.
This episode of God Bless Football is presented by Smirnoff. We do game days. Please drink responsibly. The Smirnoff Company, New York, New York.
You knew the rules. You knew the rules. Like, you know, if you want to protect against Justin Fields coming up, you got to know. You know what you did.
You knew the rules. You knew the rules. Like, you know, if you want to protect against Justin Fields coming up, you got to know. You know what you did.
Very short-lived game.
Very short-lived game.
Can't throw an interception when you're retired.
Can't throw an interception when you're retired.
Yeah, just a reminder. More Mike Lee. Just a reminder. Mikey A. ranked Justin Fields number one on his quarterbacks in the NFL. That's why I'm saying Justin Fields. He had Aaron Rodgers number nine. Aaron Rodgers number eight. Just to remind you of that.
Yeah, just a reminder. More Mike Lee. Just a reminder. Mikey A. ranked Justin Fields number one on his quarterbacks in the NFL. That's why I'm saying Justin Fields. He had Aaron Rodgers number nine. Aaron Rodgers number eight. Just to remind you of that.
Fuentes? I'm going to say Jamar Chase because he has a guy named Joe Burrow helping him do stuff. So Juan Soto has to do it on his own. Right, that's a good point.
Fuentes? I'm going to say Jamar Chase because he has a guy named Joe Burrow helping him do stuff. So Juan Soto has to do it on his own. Right, that's a good point.
Wait, did you say the Chiefs aren't making it to the Super Bowl?
Wait, did you say the Chiefs aren't making it to the Super Bowl?
Oh, that's okay. Never mind. Yeah, that's fine. You're right. Jets-Bears last year.
Oh, that's okay. Never mind. Yeah, that's fine. You're right. Jets-Bears last year.
Yeah, I'm going to say Mike Yeh, too. I think Mike Yeh is going to be there.
Yeah, I'm going to say Mike Yeh, too. I think Mike Yeh is going to be there.
That's a big ask, right? Because you're asking 17 guys from the SEC to be picked.
That's a big ask, right? Because you're asking 17 guys from the SEC to be picked.
Yeah. Yeah.
Yeah. Yeah.
SEC. I feel like it's a safer bet.
SEC. I feel like it's a safer bet.
This episode of God Bless Football is brought to you by DraftKings. DraftKings, the crown is yours.
This episode of God Bless Football is brought to you by DraftKings. DraftKings, the crown is yours.
Everybody in the AL Central is 2-4. That's crazy.
Everybody in the AL Central is 2-4. That's crazy.
I'm wondering how many players' skill set would transfer well to flag football.
I'm wondering how many players' skill set would transfer well to flag football.
Because a lot of people – please, go ahead.
Because a lot of people – please, go ahead.
I asked the question to get that response.
I asked the question to get that response.
I asked the question to get exactly what I got. It worked.
I asked the question to get exactly what I got. It worked.
Yeah. But see Josh Allen to me, like that's one of the guys where it's like, you can't really run somebody over.
Yeah. But see Josh Allen to me, like that's one of the guys where it's like, you can't really run somebody over.
That's why give me, I mean, Kyler Murray, Kyler Murray, Kyler Murray, Lamar Jackson, Joe Milton. Give me those guys. Yeah.
That's why give me, I mean, Kyler Murray, Kyler Murray, Kyler Murray, Lamar Jackson, Joe Milton. Give me those guys. Yeah.
You know what else I'm looking forward to? The, huh, I didn't know he was from there when I'm watching flag football. When all of a sudden you see some guy and you're like, huh, I didn't know he was German.
You know what else I'm looking forward to? The, huh, I didn't know he was from there when I'm watching flag football. When all of a sudden you see some guy and you're like, huh, I didn't know he was German.
You're going to want to listen to this one, yeah.
You're going to want to listen to this one, yeah.
I have no problem. I think that's a fantastic idea. Name's got to go.
I have no problem. I think that's a fantastic idea. Name's got to go.
Yeah. I disagree because I think offensive linemen are some of the funnier guys on teams. And I think you could be missing a hell of a speech, uh, Uh, offensive linemen are kind of like lefty relievers. They're all a little bit off. You kind of have to be to do the work that they do.
Yeah. I disagree because I think offensive linemen are some of the funnier guys on teams. And I think you could be missing a hell of a speech, uh, Uh, offensive linemen are kind of like lefty relievers. They're all a little bit off. You kind of have to be to do the work that they do.
Now there's, there's obviously some boring ones, but I think if you've got an offensive lineman in front of a microphone for a few minutes, you'll get a, you'll get a few good chuckles.
Now there's, there's obviously some boring ones, but I think if you've got an offensive lineman in front of a microphone for a few minutes, you'll get a, you'll get a few good chuckles.
I'm going to expand it, okay? All awards. You know what you should be having? Tryouts for your speech, whether you make the broadcast or not. Oh, this person wants to win best actor, but his speech is terrible? No, get that off. Give me the guy that's going to entertain me for a few minutes. I don't care who wins. I want a good speech. So if the MVP is boring, I don't want to see that speech.
I'm going to expand it, okay? All awards. You know what you should be having? Tryouts for your speech, whether you make the broadcast or not. Oh, this person wants to win best actor, but his speech is terrible? No, get that off. Give me the guy that's going to entertain me for a few minutes. I don't care who wins. I want a good speech. So if the MVP is boring, I don't want to see that speech.
Just tell me who won. That's all I care about. But if you're telling me the offensive lineman who won the Shield Award is going to be entertaining, let that guy go.
Just tell me who won. That's all I care about. But if you're telling me the offensive lineman who won the Shield Award is going to be entertaining, let that guy go.
I was all for the former. And then what you said makes me think I kind of want to see the latter. I mean, the former was like, because if you did the work, you should get the award. I just don't need to see your speech. Yeah, that's all I'm saying. Okay. So if you're if you if you won the best, whatever, you should get the award.
I was all for the former. And then what you said makes me think I kind of want to see the latter. I mean, the former was like, because if you did the work, you should get the award. I just don't need to see your speech. Yeah, that's all I'm saying. Okay. So if you're if you if you won the best, whatever, you should get the award.
But now I kind of want to see a beauty pageant type thing at some of these things.
But now I kind of want to see a beauty pageant type thing at some of these things.
30% of your score.
30% of your score.
swimsuit cop i can't you see it like you know uh give me an offensive lineman and you go your quarterback was just pushed down by a defensive lineman after the play how would you resolve the situation and give him a microphone and he's got to yeah talk about you know brotherhood like that stuff okay yeah i kind of want to see that
swimsuit cop i can't you see it like you know uh give me an offensive lineman and you go your quarterback was just pushed down by a defensive lineman after the play how would you resolve the situation and give him a microphone and he's got to yeah talk about you know brotherhood like that stuff okay yeah i kind of want to see that
You're not.
You're not.
I'll go ahead and spoil it for you. You're not. But yeah, it's my favorite time of year too. Anonymous sources, rule changes. I kind of love this quote, to be honest.
I'll go ahead and spoil it for you. You're not. But yeah, it's my favorite time of year too. Anonymous sources, rule changes. I kind of love this quote, to be honest.
Spoiler, neither one is going to make the Jets look good.
Spoiler, neither one is going to make the Jets look good.
You go ahead first.
You go ahead first.
I it's hard to beat but I can beat it. Okay. This week, Woody Johnson said, Oh, I think Justin Fields is going to be a total winner for us. He's going to be the starter as you found out. I've been impressed with him since his college days. It was him or Trevor Lawrence. They selected Zach Wilson. They had the second pick. They didn't take him.
I it's hard to beat but I can beat it. Okay. This week, Woody Johnson said, Oh, I think Justin Fields is going to be a total winner for us. He's going to be the starter as you found out. I've been impressed with him since his college days. It was him or Trevor Lawrence. They selected Zach Wilson. They had the second pick. They didn't take him.
They took Zach Wilson, but he's saying now it was him or Justin Fields. I don't know how it got Zach Wilson.
They took Zach Wilson, but he's saying now it was him or Justin Fields. I don't know how it got Zach Wilson.
You always go first. I like you going.
You always go first. I like you going.
But they didn't.
But they didn't.
Thank you.
Thank you.
cle cle cle cle cle cle cle cle cle cle cle cleketketketketketketketketketketketketketketketketketketketketketketketketacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacketketketketketketket cleket cle cleket cle cle cleket cle cle cleket cle cle cleket cle cle cleket cleac cleac cleac cleac cleac cleac cleacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniacenieniket
cle cle cle cle cle cle cle cle cle cle cle cleketketketketketketketketketketketketketketketketketketketketketketketketacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacketketketketketketket cleket cle cleket cle cle cleket cle cle cleket cle cle cleket cle cle cleket cleac cleac cleac cleac cleac cleac cleacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniacenieniket
Thank you.
Thank you.
Thank you. Thank you. Thank you.
Thank you. Thank you. Thank you.
Thank you.
Thank you.
Thank you. Thank you.
Thank you. Thank you.
Thank you. Thank you. Thank you. Thank you.
Thank you. Thank you. Thank you. Thank you.
Yeah, Joe Milton was kind of one of the hot names. Everybody was trying to sort of bring him in to be their backup in hopes that some of the magic they saw, whether it be in preseason or when he was in college, they could tap that potential and sort of bring him along as a starting quarterback. And, you know, in Dallas, you're going to get work as the backup quarterback.
Yeah, Joe Milton was kind of one of the hot names. Everybody was trying to sort of bring him in to be their backup in hopes that some of the magic they saw, whether it be in preseason or when he was in college, they could tap that potential and sort of bring him along as a starting quarterback. And, you know, in Dallas, you're going to get work as the backup quarterback.
Thank you.
Thank you.
That's just how they're built. And you have C.D. Lamb, why not?
That's just how they're built. And you have C.D. Lamb, why not?
They signed okay players to good-sized deals, and I do not believe in free agency like that. If you're going to do that, go the Chargers route. Sit and wait and go for one-year contracts.
They signed okay players to good-sized deals, and I do not believe in free agency like that. If you're going to do that, go the Chargers route. Sit and wait and go for one-year contracts.
It's not a repeat.
It's not a repeat.
There's no repeats.
There's no repeats.
Not anonymous sources.
Not anonymous sources.
Guys, neither of you. Give me another guess. Give me another guess.
Guys, neither of you. Give me another guess. Give me another guess.
He just said Raiders.
He just said Raiders.
That was his guess. No, neither of you got it right.
That was his guess. No, neither of you got it right.
It was such a good game until now. I now win anonymous sources. Who was it?
It was such a good game until now. I now win anonymous sources. Who was it?
The answer was the Jacksonville Jaguars.
The answer was the Jacksonville Jaguars.
The NFL makes so much money that they're not even laying off irrelevant workers anymore. You guys go ahead and do it as a backup.
The NFL makes so much money that they're not even laying off irrelevant workers anymore. You guys go ahead and do it as a backup.
Yeah, then Russell Wilson took his job. Yeah, they signed him and drafted Russell Wilson in the fifth round, and Russell Wilson beat him out.
Yeah, then Russell Wilson took his job. Yeah, they signed him and drafted Russell Wilson in the fifth round, and Russell Wilson beat him out.
Here we are. All right, Mike, you have a headline for us? Well, here's a headline. Speaking of splashing names, Cleveland Browns owner Jimmy Haslam has admitted That maybe, just maybe, they made a little bit of a mistake in signing, trading for and signing Deshaun Watson. Quote, we took a big swing and a miss with Deshaun. We thought we had a quarterback. We didn't.
Here we are. All right, Mike, you have a headline for us? Well, here's a headline. Speaking of splashing names, Cleveland Browns owner Jimmy Haslam has admitted That maybe, just maybe, they made a little bit of a mistake in signing, trading for and signing Deshaun Watson. Quote, we took a big swing and a miss with Deshaun. We thought we had a quarterback. We didn't.
And we gave up a lot of draft picks to get him. So we've got to dig ourselves out of that hole. That hole is a, it's a chasm. It's a canyon. Right now, if they were to cut Deshaun Watson, it would be a $167 million dead cap hit. And it doesn't get much better next year. If they cut him next year, it's $131 million in dead cap.
And we gave up a lot of draft picks to get him. So we've got to dig ourselves out of that hole. That hole is a, it's a chasm. It's a canyon. Right now, if they were to cut Deshaun Watson, it would be a $167 million dead cap hit. And it doesn't get much better next year. If they cut him next year, it's $131 million in dead cap.
They went all in on a player, and it was the exact wrong player to do so. If you remember, even when the Texans were going to trade him, he was like, no, Cleveland's out. And then Cleveland's like, well, what if we gave you this? He's like, you're... You're going to give me all, okay, I'm in. I'll do that.
They went all in on a player, and it was the exact wrong player to do so. If you remember, even when the Texans were going to trade him, he was like, no, Cleveland's out. And then Cleveland's like, well, what if we gave you this? He's like, you're... You're going to give me all, okay, I'm in. I'll do that.
I don't know how the Browns recover within the next two, three years from this Deshaun Watson ordeal, but it's funny to hear him say that they had a swing and a miss on a quarterback who's still on the team. I mean, he's hurt and he's probably not going to play this year, but he's still there.
I don't know how the Browns recover within the next two, three years from this Deshaun Watson ordeal, but it's funny to hear him say that they had a swing and a miss on a quarterback who's still on the team. I mean, he's hurt and he's probably not going to play this year, but he's still there.
The crazy part about it is they did all this after that stuff came out. They knew what they were getting into. Yeah. When they traded for him, they were like, yeah, we know all about that. And they even sort of built things into his contract to be like, no, you're going to get past this. The year that he got suspended, his salary was $1 million.
The crazy part about it is they did all this after that stuff came out. They knew what they were getting into. Yeah. When they traded for him, they were like, yeah, we know all about that. And they even sort of built things into his contract to be like, no, you're going to get past this. The year that he got suspended, his salary was $1 million.
So that when he lost that year of salary, he lost $1 million. Whereas the rest of it is all guaranteed. Yeah.
So that when he lost that year of salary, he lost $1 million. Whereas the rest of it is all guaranteed. Yeah.
I got to tell you, though, it's nice to hear an owner take some ownership of some of his mistakes. We'll get into that in a little bit.
I got to tell you, though, it's nice to hear an owner take some ownership of some of his mistakes. We'll get into that in a little bit.
Deshaun Watson's playing contract runs through the 2026 season, but they're going to be paying him for at least three more years after that with void years.
Deshaun Watson's playing contract runs through the 2026 season, but they're going to be paying him for at least three more years after that with void years.
I'm pretty sure that was a comment straight out of the what not to say about a player you're negotiating with. Yeah. That was like the absolute worst thing you could say. Like he should just be happy with what he's got. Be happy with the rate you got, basically, is what you're saying. The rate, like it's an interest rate.
I'm pretty sure that was a comment straight out of the what not to say about a player you're negotiating with. Yeah. That was like the absolute worst thing you could say. Like he should just be happy with what he's got. Be happy with the rate you got, basically, is what you're saying. The rate, like it's an interest rate.
Why are bad teams always so bad? I mean, we're going to do the Jets thing in a little bit. That's going to be hysterical. We just talked about the Cleveland Browns and the Cincinnati Bengals. Why are these teams always so bad? Why can't they learn from some of their mistakes? But a little unfair to put the Bengals. I'm not talking about Joe Burrow. I'm not talking about Jamar.
Why are bad teams always so bad? I mean, we're going to do the Jets thing in a little bit. That's going to be hysterical. We just talked about the Cleveland Browns and the Cincinnati Bengals. Why are these teams always so bad? Why can't they learn from some of their mistakes? But a little unfair to put the Bengals. I'm not talking about Joe Burrow. I'm not talking about Jamar.
They're very talented, but the organizations themselves are – are dumpster fires most of the time.
They're very talented, but the organizations themselves are – are dumpster fires most of the time.
The only difference between the Jets, Browns, and Bengals is the Bengals hit on Joe Burrow. That is the only difference.
The only difference between the Jets, Browns, and Bengals is the Bengals hit on Joe Burrow. That is the only difference.
It's flabbergasting to me how some organizations can run so... Yes, good word. By the way, in case you couldn't tell, I'm feeling a little sick today. I'm a little under the weather, so this is going to be my Jordan flu game. Yeah, this is... It's absolutely mind-boggling to me how some teams can run so smooth and efficiently.
It's flabbergasting to me how some organizations can run so... Yes, good word. By the way, in case you couldn't tell, I'm feeling a little sick today. I'm a little under the weather, so this is going to be my Jordan flu game. Yeah, this is... It's absolutely mind-boggling to me how some teams can run so smooth and efficiently.
And whether or not they have the talent and they win every year is not the case, but... Bad teams are just going to be bad.
And whether or not they have the talent and they win every year is not the case, but... Bad teams are just going to be bad.
I'm itching to pick an upset. Yeah, but Aiden O'Connell, I'm not doing that. All right. But that's not it.
I'm itching to pick an upset. Yeah, but Aiden O'Connell, I'm not doing that. All right. But that's not it.
That's the problem. I don't even know who you said. I think it was the Bengals. I'll take the Bengals because I don't trust Trevor Lawrence.
That's the problem. I don't even know who you said. I think it was the Bengals. I'll take the Bengals because I don't trust Trevor Lawrence.
I was going to say give me the Horsies. They're both Horsies. Give me the Broncos. I like Bo Nix.
I was going to say give me the Horsies. They're both Horsies. Give me the Broncos. I like Bo Nix.
Wow. Can we take a second to... If Aaron Rodgers goes to the Steelers, the combination of George Pickens, DK Metcalf, Aaron Rodgers, and then Mike Tomlin trying to wrestle it all together, that's going to be amazing. I really hope it happens, but since it has not happened yet, I will stick with Mikey.
Wow. Can we take a second to... If Aaron Rodgers goes to the Steelers, the combination of George Pickens, DK Metcalf, Aaron Rodgers, and then Mike Tomlin trying to wrestle it all together, that's going to be amazing. I really hope it happens, but since it has not happened yet, I will stick with Mikey.
Mikey, we've agreed on everything so far, right? Pretty much. I'll take the Steelers, just so Billy has to throw in his hat on this. You know what?
Mikey, we've agreed on everything so far, right? Pretty much. I'll take the Steelers, just so Billy has to throw in his hat on this. You know what?
I can't stand with them.
I can't stand with them.
Yeah, Brock Purdy, Brandon Ayuk. Oh, George Kittle's still there, too. No, I guess it's not that bad.
Yeah, Brock Purdy, Brandon Ayuk. Oh, George Kittle's still there, too. No, I guess it's not that bad.
No, no, I'm sticking with Eagles.
No, no, I'm sticking with Eagles.
I had said you're Bryce Young I had said you're Bryce Young I said I liked I say it is yeah give me the Panthers but hold on Fuentes as we all know is also an LA guy yeah I had said I know big LA guy I had said before this Billy Billy put me in a corner I knew it's gonna happen because I know he did it so good he did it so good I like the Panthers I know I like Bryce Young I feel like they're rising they can make a deep run but then I'm a Rams guy and I think
I had said you're Bryce Young I had said you're Bryce Young I said I liked I say it is yeah give me the Panthers but hold on Fuentes as we all know is also an LA guy yeah I had said I know big LA guy I had said before this Billy Billy put me in a corner I knew it's gonna happen because I know he did it so good he did it so good I like the Panthers I know I like Bryce Young I feel like they're rising they can make a deep run but then I'm a Rams guy and I think
Give me the Cardinals. Really? Yeah, give me the Cardinals. Lost Ben Johnson. They lost all the coaches. All the swag is gone. The kneecap stuff's over. Kyler Murray rising. Let's go.
Give me the Cardinals. Really? Yeah, give me the Cardinals. Lost Ben Johnson. They lost all the coaches. All the swag is gone. The kneecap stuff's over. Kyler Murray rising. Let's go.
Oh, wow. I like this one more than I thought I would.
Oh, wow. I like this one more than I thought I would.
Yeah. It'd be funny if I gave the Dolphins an edge because Tua was next to Baker, but then I don't give Baker the same edge. Yeah, it's like, give me the Bucs.
Yeah. It'd be funny if I gave the Dolphins an edge because Tua was next to Baker, but then I don't give Baker the same edge. Yeah, it's like, give me the Bucs.
I will also go with the Bears because of the offensive line additions. And Ben Johnson is now the quarterback, the head coach there. I was already a believer in Caleb Williams. And I do like the Vikings. I love Justin Jefferson. But just the J.J. McCarthy question mark is too big right now.
I will also go with the Bears because of the offensive line additions. And Ben Johnson is now the quarterback, the head coach there. I was already a believer in Caleb Williams. And I do like the Vikings. I love Justin Jefferson. But just the J.J. McCarthy question mark is too big right now.
when they were out in the first round. It's a big choice from the committee. I know.
when they were out in the first round. It's a big choice from the committee. I know.
Yeah, that happened sometimes too. But you know what it is? In these one-off scenarios, you never know. You just never know.
Yeah, that happened sometimes too. But you know what it is? In these one-off scenarios, you never know. You just never know.
Cowboys twice, huh? All right. Yeah, Cowboys twice, too.
Cowboys twice, huh? All right. Yeah, Cowboys twice, too.
Whoever it is, I take the Commanders. The Commanders, yeah, it's the Commanders.
Whoever it is, I take the Commanders. The Commanders, yeah, it's the Commanders.
Ah, the Commanders. Russell Wilson. Russell Wilson's not enough to get over the Commanders. Yeah, it's the Giants.
Ah, the Commanders. Russell Wilson. Russell Wilson's not enough to get over the Commanders. Yeah, it's the Giants.
Unless Jameis is playing, then you never know. It's a small committee.
Unless Jameis is playing, then you never know. It's a small committee.
This is the game where you have the Baker swag. Tua Baker. You want to go with the offense? Give me the Bills.
This is the game where you have the Baker swag. Tua Baker. You want to go with the offense? Give me the Bills.
I think that it's really great that they kept the offense together for Joe, but who's going to – They didn't get any better.
I think that it's really great that they kept the offense together for Joe, but who's going to – They didn't get any better.
Exactly. Yikes. All right. I like the Bengals. I like Joe Burrow. He just has to outscore everybody, and I don't know if he can always do that.
Exactly. Yikes. All right. I like the Bengals. I like Joe Burrow. He just has to outscore everybody, and I don't know if he can always do that.
You're a big Bo guy. I am, but I'm going to go with the Ravens. All right. Marjax is too good.
You're a big Bo guy. I am, but I'm going to go with the Ravens. All right. Marjax is too good.
Not a lot of analysis on the Chiefs.
Not a lot of analysis on the Chiefs.
Eagles. Eagles. Wow. Yeah. Unless Michael Penix takes a jump.
Eagles. Eagles. Wow. Yeah. Unless Michael Penix takes a jump.
It was a close one, but they survived. Survived in advance.
It was a close one, but they survived. Survived in advance.
Wow. Give me a reason.
Wow. Give me a reason.
Give me the Bucs. Yeah, give me the Bucs. Give me the Bucs. I actually like that they kept Chris Godwin.
Give me the Bucs. Yeah, give me the Bucs. Give me the Bucs. I actually like that they kept Chris Godwin.
I think it's big for Baker, too. You've got to keep him with guys that he knows and can move the ball. They're going to have a better running game this year, correct?
I think it's big for Baker, too. You've got to keep him with guys that he knows and can move the ball. They're going to have a better running game this year, correct?
matchup of the weekend a matchup of one and two pick from 2024 the number first first two picks yep yeah number two pick wins it yeah oh you think so give me the commanders with the debo samuel commanders uh i'm gonna say the bears uh yeah i mean i really believe in ben johnson i believe in ben johnson i believe in the offensive line let's do it
matchup of the weekend a matchup of one and two pick from 2024 the number first first two picks yep yeah number two pick wins it yeah oh you think so give me the commanders with the debo samuel commanders uh i'm gonna say the bears uh yeah i mean i really believe in ben johnson i believe in ben johnson i believe in the offensive line let's do it
You were also a Cardinals guy. Yeah, I was part of the Bird Gang, as we all know.
You were also a Cardinals guy. Yeah, I was part of the Bird Gang, as we all know.
It's so hard tightening up.
It's so hard tightening up.
We will be tightened up.
We will be tightened up.
Josh Allen can't find anybody, and he can't do it all by himself. Eventually, the Chargers win it. John Harbaugh. Is it John or Jim there?
Josh Allen can't find anybody, and he can't do it all by himself. Eventually, the Chargers win it. John Harbaugh. Is it John or Jim there?
Jim Harbaugh. He finds a way to power his guys through the Chargers defense. Stop Josh Allen.
Jim Harbaugh. He finds a way to power his guys through the Chargers defense. Stop Josh Allen.
That hurt. I'm sorry, Baker. I keep thinking about Jaden Daniels in the playoffs and how good he was. Just give me Jaden Daniels.
That hurt. I'm sorry, Baker. I keep thinking about Jaden Daniels in the playoffs and how good he was. Just give me Jaden Daniels.
Chiefs kingdom. The AFC dominance continues. Unbelievable.
Chiefs kingdom. The AFC dominance continues. Unbelievable.
Commanders. Yeah, Commanders. Oh, okay. Oh, wow. They got seasoned over the year, and they're over there. A little seasoning, and boom, there you go.
Commanders. Yeah, Commanders. Oh, okay. Oh, wow. They got seasoned over the year, and they're over there. A little seasoning, and boom, there you go.
TV production stuff. You need to not worry so much about that.
TV production stuff. You need to not worry so much about that.
Yeah, yeah. Give it to the people. They want it.
Yeah, yeah. Give it to the people. They want it.
I also think it's new time for a new champion. And after last season's disappointment, The Kansas City Chiefs raised from the fire like a phoenix. Chiefs kingdom rises. They said, we didn't get the three-peat, but we're back. And we're getting our third title in four years. Patrick Mahomes, once again, reigns supreme. Wow.
I also think it's new time for a new champion. And after last season's disappointment, The Kansas City Chiefs raised from the fire like a phoenix. Chiefs kingdom rises. They said, we didn't get the three-peat, but we're back. And we're getting our third title in four years. Patrick Mahomes, once again, reigns supreme. Wow.
That was the whole point of my choice.
That was the whole point of my choice.
I get what you're saying about that, but actually it makes more sense now that I think about it because they do draft whoever at three if they're able to get one of the top two guys because I'm not, are we sure like the Titans might take a quarterback and then the Browns will take a quarterback right to the top two picks?
I get what you're saying about that, but actually it makes more sense now that I think about it because they do draft whoever at three if they're able to get one of the top two guys because I'm not, are we sure like the Titans might take a quarterback and then the Browns will take a quarterback right to the top two picks?
Yeah, so if Cam Ward and Shador Sanders are both gone, then the next guy is Jackson Dart. So you might – maybe they do trade back because now, like you said, the emphasis is not really there to draft a quarterback. And I feel like any quarterback taking the top five, top ten, they have to play right away. That's like how most NFL people feel about it.
Yeah, so if Cam Ward and Shador Sanders are both gone, then the next guy is Jackson Dart. So you might – maybe they do trade back because now, like you said, the emphasis is not really there to draft a quarterback. And I feel like any quarterback taking the top five, top ten, they have to play right away. That's like how most NFL people feel about it.
Thank you. Thank you.
Thank you. Thank you.
So I think it might just be more of an insurance policy. So I'm kind of with you there, Mike, because like you said, if Russell Wilson and Jameis never see in the field, they don't really cost you much, especially for a quarterback. $14 million for two quarterbacks, drop in the bucket, the way that quarterbacks get paid these days. Drop in the bucket.
So I think it might just be more of an insurance policy. So I'm kind of with you there, Mike, because like you said, if Russell Wilson and Jameis never see in the field, they don't really cost you much, especially for a quarterback. $14 million for two quarterbacks, drop in the bucket, the way that quarterbacks get paid these days. Drop in the bucket.
Thank you. Thank you.
Thank you. Thank you.
Well, Mike McDaniel, if Tua gets hurt again, Mike McDaniel's like, oh, well, I'm doing what I can. He wasn't there when they drafted Tua. So he has that excuse. Shane Steichen, though, he chose Anthony Richardson. He decided we're going to sign Daniel Jones. So he had to have great signing, by the way.
Well, Mike McDaniel, if Tua gets hurt again, Mike McDaniel's like, oh, well, I'm doing what I can. He wasn't there when they drafted Tua. So he has that excuse. Shane Steichen, though, he chose Anthony Richardson. He decided we're going to sign Daniel Jones. So he had to have great signing, by the way.
I let you get away with one. Shane Steichen.
I let you get away with one. Shane Steichen.
I mean, he's only 23 years old, so he has at least like seven years left. I mean, he's not like going to walk out tomorrow. I think it's just more of like a football thing where we saw him at Radio Row. He looked like a guy who was going to fix your computer. He might just feel like, yeah, he just doesn't – not that he doesn't love football, but he might have other things he wants to do.
I mean, he's only 23 years old, so he has at least like seven years left. I mean, he's not like going to walk out tomorrow. I think it's just more of like a football thing where we saw him at Radio Row. He looked like a guy who was going to fix your computer. He might just feel like, yeah, he just doesn't – not that he doesn't love football, but he might have other things he wants to do.
Yeah. He might settle into like a series of one years, you know, like 12 every year until he's like, okay, now I feel bad, you know?
Yeah. He might settle into like a series of one years, you know, like 12 every year until he's like, okay, now I feel bad, you know?
Do you think that like Dable and Joe Shane is the other guy, right? Like I understand Joe Shane inherited Daniel Jones. I guess Dable did too. But then like Joe Shane gave Daniel Jones the extension, didn't he? Well, yes, but that's kind of like the quarterback he was in on then because he felt like, oh, this guy's enough. So I'm in on this guy. So maybe Dayball has that leash.
Do you think that like Dable and Joe Shane is the other guy, right? Like I understand Joe Shane inherited Daniel Jones. I guess Dable did too. But then like Joe Shane gave Daniel Jones the extension, didn't he? Well, yes, but that's kind of like the quarterback he was in on then because he felt like, oh, this guy's enough. So I'm in on this guy. So maybe Dayball has that leash.
I don't know if Shane does.
I don't know if Shane does.
We need to lock up our guy because I got to go back and see what's available then because because I got to lock up your guy. But you're also like Daniel Jones had his best year before he won the playoff game and he duped them into giving them more money.
We need to lock up our guy because I got to go back and see what's available then because because I got to lock up your guy. But you're also like Daniel Jones had his best year before he won the playoff game and he duped them into giving them more money.
Yeah, and that is true. But I think some of it's kind of like fan service we have to look like. Because Jameis Winston is not a name you're going to take seriously as a starting quarterback. I want him on the Steelers.
Yeah, and that is true. But I think some of it's kind of like fan service we have to look like. Because Jameis Winston is not a name you're going to take seriously as a starting quarterback. I want him on the Steelers.
Jameis Winston was Mike's target. I love Jameis. I'm with you. I like him more than I like Russell.
Jameis Winston was Mike's target. I love Jameis. I'm with you. I like him more than I like Russell.
We keep saying that, that it's been a long time since he's been a proven number one. He had the four years in Buffalo. He had 127 receptions, 103, 108, 107 receptions. four consecutive thousand yard seasons. Like he was really good still at the Bills. He's just 31 years old coming off.
We keep saying that, that it's been a long time since he's been a proven number one. He had the four years in Buffalo. He had 127 receptions, 103, 108, 107 receptions. four consecutive thousand yard seasons. Like he was really good still at the Bills. He's just 31 years old coming off.
But yeah, but he was really good.
But yeah, but he was really good.
No. You mean number one receiver for Allen? Yeah. No. On a team.
No. You mean number one receiver for Allen? Yeah. No. On a team.
Which is why he ended up one on a team. Like his worst years were actually in Minnesota. He took off, which of course is the Josh Allen effect. Right. But I mean, he still caught the ball over a thousand yards. You can't see receiver for more than a hundred receptions.
Which is why he ended up one on a team. Like his worst years were actually in Minnesota. He took off, which of course is the Josh Allen effect. Right. But I mean, he still caught the ball over a thousand yards. You can't see receiver for more than a hundred receptions.
He's a proven commodity. By the way, that's why they got Amari Cooper, honestly. It's just because he was a name. It's like, well, nobody likes just having Shakir, right? So is Amari Cooper available? We can get him for cheap. He doesn't want to be in Cleveland anymore. Get him over here.
He's a proven commodity. By the way, that's why they got Amari Cooper, honestly. It's just because he was a name. It's like, well, nobody likes just having Shakir, right? So is Amari Cooper available? We can get him for cheap. He doesn't want to be in Cleveland anymore. Get him over here.
Not that it matters.
Not that it matters.
Yes, but mainly because I forgot Will Lefson's in the NFL until right now when you mentioned him. Okay. So I was already thinking Cam Ward was the quarterback of the thing.
Yes, but mainly because I forgot Will Lefson's in the NFL until right now when you mentioned him. Okay. So I was already thinking Cam Ward was the quarterback of the thing.
I like that take. I like that take. It was going to be a push. I feel like CJ Stroud's on the decline. That's right. Tua's getting the killer instinct from Baker.
I like that take. I like that take. It was going to be a push. I feel like CJ Stroud's on the decline. That's right. Tua's getting the killer instinct from Baker.
Now he's going to tell us, oh, there's only 30 seconds left. You're really stressing me out today. I'm not cutting it off. Got to stay on time.
Now he's going to tell us, oh, there's only 30 seconds left. You're really stressing me out today. I'm not cutting it off. Got to stay on time.
Guys, 30 seconds. Oh, hurry up. There it is. Five minute warning. Better be quick, Mikey.
Guys, 30 seconds. Oh, hurry up. There it is. Five minute warning. Better be quick, Mikey.
So I don't know what I'm supposed to do with this 20-year-old book that is featuring defensive strategy schemes of Jerry Sandusky.
So I don't know what I'm supposed to do with this 20-year-old book that is featuring defensive strategy schemes of Jerry Sandusky.
The wrong time for wide receivers to demand a trade, considering how saturated the market is with wide receivers, this free agency. I mean, Chris Godwin, Devontae Adams, Keenan Allen, Amari Cooper, Stephon Diggs, Hollywood Brown, DeAndre Hopkins, Brandon Cooks, not to mention Cooper Cup is available for trade. It's Debo Samuel's already been traded. Probably not the best time to be like, pay me.
The wrong time for wide receivers to demand a trade, considering how saturated the market is with wide receivers, this free agency. I mean, Chris Godwin, Devontae Adams, Keenan Allen, Amari Cooper, Stephon Diggs, Hollywood Brown, DeAndre Hopkins, Brandon Cooks, not to mention Cooper Cup is available for trade. It's Debo Samuel's already been traded. Probably not the best time to be like, pay me.
Yeah, see, that's not it. I mean, that's a mocking version. But that's not...
Yeah, see, that's not it. I mean, that's a mocking version. But that's not...
Quick question. Why? Why did the Eagles do that? You just signed him to a big deal. Dude. Why? I don't get it.
Quick question. Why? Why did the Eagles do that? You just signed him to a big deal. Dude. Why? I don't get it.
Howie Roseman drunk on the parade float. I'm going to give you more money. You're just the best. I'm going to give you some more money.
Howie Roseman drunk on the parade float. I'm going to give you more money. You're just the best. I'm going to give you some more money.
Howie signed this thing.
Howie signed this thing.
What does he have to be next year to be worth that?
What does he have to be next year to be worth that?
But that's the whole thing.
But that's the whole thing.
Yeah, good for him.
Yeah, good for him.
Sure. Hopefully Fuentes will join us on this one. I got one good one. We'll leave it there. More Mike Lee. to be an NFL bust, Abdul Carter or Travis Hunter?
Sure. Hopefully Fuentes will join us on this one. I got one good one. We'll leave it there. More Mike Lee. to be an NFL bust, Abdul Carter or Travis Hunter?
So if we're doing notes here, which it looks like we are, it sounds to me like you shouldn't do it the way Stu does it, but you should do it differently than the way you are doing it.
So if we're doing notes here, which it looks like we are, it sounds to me like you shouldn't do it the way Stu does it, but you should do it differently than the way you are doing it.
I would say Abdul Carter, you can line him up and say go get the quarterback. Travis Hunter, I think a lot of it's going to depend on the coaching staff and how they want to use him. So I agree with you guys because I think Travis Hunter could be a bust. Not his fault, though. I think he could be misused.
I would say Abdul Carter, you can line him up and say go get the quarterback. Travis Hunter, I think a lot of it's going to depend on the coaching staff and how they want to use him. So I agree with you guys because I think Travis Hunter could be a bust. Not his fault, though. I think he could be misused.
No one used the word terrible but you, but okay.
No one used the word terrible but you, but okay.
Being a GM is all about making very hard decisions. And when they don't work out, it makes you look so bad. And Joe Shane couldn't have made worse decisions last offseason, at least by the optics of it. And... Why would anyone sign up for that? Why would anyone be like, hey, why don't you film me when I take the most beloved guy on our team and tell him he's not worth the money?
Being a GM is all about making very hard decisions. And when they don't work out, it makes you look so bad. And Joe Shane couldn't have made worse decisions last offseason, at least by the optics of it. And... Why would anyone sign up for that? Why would anyone be like, hey, why don't you film me when I take the most beloved guy on our team and tell him he's not worth the money?
It was easily Saquon, because they didn't have a chance to draft Jaden. They wanted to, they called, they tried to, but it made it sound like they didn't try very hard. And his whole thing, we're going to rely on Daniel Jones, it's going to be Daniel Jones' year, only to... Just like midseason trade cut him. They didn't even trade him. They cut him like everything.
It was easily Saquon, because they didn't have a chance to draft Jaden. They wanted to, they called, they tried to, but it made it sound like they didn't try very hard. And his whole thing, we're going to rely on Daniel Jones, it's going to be Daniel Jones' year, only to... Just like midseason trade cut him. They didn't even trade him. They cut him like everything.
Every decision you made looked terrible. And we all got to see you make those decisions.
Every decision you made looked terrible. And we all got to see you make those decisions.
I couldn't disagree with you more. Really? Now, I agree with you on in-season hard knocks. In-season hard knocks is the one that's got to go. That's the one that does absolutely nothing for me. I already know how this whole thing plays out. There's no immediacy to it. Whereas during training camp, you know,
I couldn't disagree with you more. Really? Now, I agree with you on in-season hard knocks. In-season hard knocks is the one that's got to go. That's the one that does absolutely nothing for me. I already know how this whole thing plays out. There's no immediacy to it. Whereas during training camp, you know,
They play during the week, and then the following Tuesday, you get to see leading up to that week. So it's like, okay, I'm in. And the off-season one, because of how bad it went for the Giants, is like must-watch to me. To see how Joe Shane convinced himself to get rid of Saquon, only to then watch Saquon sign with Philly... That that's poetry. That's that's what I want to watch.
They play during the week, and then the following Tuesday, you get to see leading up to that week. So it's like, okay, I'm in. And the off-season one, because of how bad it went for the Giants, is like must-watch to me. To see how Joe Shane convinced himself to get rid of Saquon, only to then watch Saquon sign with Philly... That that's poetry. That's that's what I want to watch.
Yes. Yes.
Yes. Yes.
Yeah. Hard knocks kicks the crap out of new regular hard.
Yeah. Hard knocks kicks the crap out of new regular hard.
Yeah, but see, that's the problem. Old hard knocks. I mean, the name of the show was hard knocks because it was guys going to training camp, trying to fight for a roster spot. Then they, at some point around the Jets and Dolphins season, They started transitioning from those fringe guys to the stars. And you know what? Training camp ain't that hard for the stars.
Yeah, but see, that's the problem. Old hard knocks. I mean, the name of the show was hard knocks because it was guys going to training camp, trying to fight for a roster spot. Then they, at some point around the Jets and Dolphins season, They started transitioning from those fringe guys to the stars. And you know what? Training camp ain't that hard for the stars.
They got – it's not – I mean, listen, I'm sure it's still a grind, and I certainly couldn't do it. But it's not like trying to make the team. And I feel like lately, hard knocks by lately, I mean the last few years – has taken to the last two weeks, let's go focus on one or two of these fringe guys and that'll be it.
They got – it's not – I mean, listen, I'm sure it's still a grind, and I certainly couldn't do it. But it's not like trying to make the team. And I feel like lately, hard knocks by lately, I mean the last few years – has taken to the last two weeks, let's go focus on one or two of these fringe guys and that'll be it.
But you used to follow him from get up for his first day at training camp until he gets cut or makes the team. Now it's like, ah, here's two episodes of fringe guys.
But you used to follow him from get up for his first day at training camp until he gets cut or makes the team. Now it's like, ah, here's two episodes of fringe guys.
Well, Nicole Hardman was the guy who did it for the Jets, and he was traded to the Chiefs, and they beat the 49ers. So it kind of happened. Just wasn't the Jets.
Well, Nicole Hardman was the guy who did it for the Jets, and he was traded to the Chiefs, and they beat the 49ers. So it kind of happened. Just wasn't the Jets.
experiment next year and I'm going to nominate Fuentes to do it. Watch none of the NFL games. Only watch Hard Knocks.
experiment next year and I'm going to nominate Fuentes to do it. Watch none of the NFL games. Only watch Hard Knocks.
In season Hard Knocks you're talking about? Yeah.
In season Hard Knocks you're talking about? Yeah.
You pick a random week. You pick a random week. You watch none of the NFL games. You don't catch the scores. You don't check your DraftKings account. And then you just watch hard knocks.
You pick a random week. You pick a random week. You watch none of the NFL games. You don't catch the scores. You don't check your DraftKings account. And then you just watch hard knocks.
We don't need to make that. I just said I'm very much looking forward to see where Matt Collins ends up next year.
We don't need to make that. I just said I'm very much looking forward to see where Matt Collins ends up next year.
By the way, back to the hard knocks thing for a second, the Bill Belichick deciding not to do hard knocks, which I don't think you actually ever got to. That's the headline, that he's actually not doing it. Was this kind of Bill thinking that he was going to do a big F you to the NFL because they wanted him to do hard knocks for years and he refused to do it?
By the way, back to the hard knocks thing for a second, the Bill Belichick deciding not to do hard knocks, which I don't think you actually ever got to. That's the headline, that he's actually not doing it. Was this kind of Bill thinking that he was going to do a big F you to the NFL because they wanted him to do hard knocks for years and he refused to do it?
And then he leaves the NFL and in his first college years, like, yeah, sure, I'll do it. And then maybe he was like, cooler heads, cooler heads for value. Like, you know what? No, I really don't want to do it. But it was funny to watch the NFL panic when I was going to do it.
And then he leaves the NFL and in his first college years, like, yeah, sure, I'll do it. And then maybe he was like, cooler heads, cooler heads for value. Like, you know what? No, I really don't want to do it. But it was funny to watch the NFL panic when I was going to do it.
Yeah, pretty much.
Yeah, pretty much.
I'm going to zig. I'm going to zig. Okay. We'll be back.
I'm going to zig. I'm going to zig. Okay. We'll be back.
The name I came up with will fit both categories.
The name I came up with will fit both categories.
So when we were discussing this, it was brought to my attention. What you should do is you just pick the big guys because you don't want to sit next to the big guy because then he's in your space and all that. But listen, I am a big guy. I'm going to be in your space. You're going to be in mine. We're just going to have a nonverbal contract. When you sit down on the plane, this is what's happening.
So when we were discussing this, it was brought to my attention. What you should do is you just pick the big guys because you don't want to sit next to the big guy because then he's in your space and all that. But listen, I am a big guy. I'm going to be in your space. You're going to be in mine. We're just going to have a nonverbal contract. When you sit down on the plane, this is what's happening.
So I'm going a different route. Nick Sirianni. Because I have a feeling that Nick Sirianni is the guy that's going to complain to the stewardess about everything. The guy that's going to lean his seat all the way back when you're not supposed to. The guy when they say turn off your phones is going to be like, why do I have to turn off my phone?
So I'm going a different route. Nick Sirianni. Because I have a feeling that Nick Sirianni is the guy that's going to complain to the stewardess about everything. The guy that's going to lean his seat all the way back when you're not supposed to. The guy when they say turn off your phones is going to be like, why do I have to turn off my phone?
You think my phone is going to interfere with the plane? He's just going to be a jerk. So I'm going to go Nick Sirianni.
You think my phone is going to interfere with the plane? He's just going to be a jerk. So I'm going to go Nick Sirianni.
He doesn't even hit the button. He just goes, hey, hey, another one here. Okay.
He doesn't even hit the button. He just goes, hey, hey, another one here. Okay.
Yeah, Mike McDaniel, sure. He looks like, you know, he's an interesting guy. We could have, we can have a little taxiing conversation. Oh, you headed home? Oh, you're, oh, you're headed. Okay. And you can have that conversation. And then I feel like Mike McDaniel will put on his headphones and we won't talk the rest of the flight. And I'm okay with that.
Yeah, Mike McDaniel, sure. He looks like, you know, he's an interesting guy. We could have, we can have a little taxiing conversation. Oh, you headed home? Oh, you're, oh, you're headed. Okay. And you can have that conversation. And then I feel like Mike McDaniel will put on his headphones and we won't talk the rest of the flight. And I'm okay with that.
What's he watching?
What's he watching?
To finish it in the break, what we said was top five coaches that would love Entourage.
To finish it in the break, what we said was top five coaches that would love Entourage.
And my throw in there was Pete Carroll. Pete Carroll loves Entourage. It's like the thing he does that – I think he was on Entourage.
And my throw in there was Pete Carroll. Pete Carroll loves Entourage. It's like the thing he does that – I think he was on Entourage.
Pete Carroll got the contract from the Raiders and yelled victory like Johnny Drama.
Pete Carroll got the contract from the Raiders and yelled victory like Johnny Drama.
Yeah. If he heard me and you having a conversation across the aisle and one of us was left, he'd be like, no, I'm going to go ahead and I'm going to take this over. I'm going to come over the top and I'm going to be the funny guy. He's not this guy.
Yeah. If he heard me and you having a conversation across the aisle and one of us was left, he'd be like, no, I'm going to go ahead and I'm going to take this over. I'm going to come over the top and I'm going to be the funny guy. He's not this guy.
Headlines. Who brings us Headlines? Does somebody bring us Headlines?
Headlines. Who brings us Headlines? Does somebody bring us Headlines?
Well, it's a ridiculous contract extension. He got three years, $106.5 million. Highest paid non-quarterback in the NFL, at least for the week. Free agency starts next week, and then we'll see. I mean, he is their entire defense, and he's kind of their identity, but does it really matter if you're not going to fix the Aiden O'Connell problem? I mean...
Well, it's a ridiculous contract extension. He got three years, $106.5 million. Highest paid non-quarterback in the NFL, at least for the week. Free agency starts next week, and then we'll see. I mean, he is their entire defense, and he's kind of their identity, but does it really matter if you're not going to fix the Aiden O'Connell problem? I mean...
What is having Max Crosby do for you if you can't do anything offensively?
What is having Max Crosby do for you if you can't do anything offensively?
I hate to point out the obvious here, but when we talk about an established veteran who's available, who are we talking about?
I hate to point out the obvious here, but when we talk about an established veteran who's available, who are we talking about?
Are we talking about... okay, Kirk Cousins, who was so awful last year that he got benched for Michael Penix. How about Sam Darnold? Is that the established veteran we're talking about? Or are we going to do the obvious thing and connect the dots and bring Russell Wilson back to Pete Carroll and join them up in Vegas?
Are we talking about... okay, Kirk Cousins, who was so awful last year that he got benched for Michael Penix. How about Sam Darnold? Is that the established veteran we're talking about? Or are we going to do the obvious thing and connect the dots and bring Russell Wilson back to Pete Carroll and join them up in Vegas?
And then you go, was Russell Wilson good or was like the Steelers defense and Mike Tomlin finding a way to win ugly games the reason that they were good?
And then you go, was Russell Wilson good or was like the Steelers defense and Mike Tomlin finding a way to win ugly games the reason that they were good?
Let me ask you a question. Are the Raiders... Are we spoiled with the way the quarterbacks have moved the last few years that the Raiders think it's going to happen again, only this year it's not? Like in the past few years, we saw Aaron Rodgers move teams. We saw Tom Brady move teams. We saw Matt Stafford move teams. We saw Russell Wilson move teams twice.
Let me ask you a question. Are the Raiders... Are we spoiled with the way the quarterbacks have moved the last few years that the Raiders think it's going to happen again, only this year it's not? Like in the past few years, we saw Aaron Rodgers move teams. We saw Tom Brady move teams. We saw Matt Stafford move teams. We saw Russell Wilson move teams twice.
We've seen all these guys that you're like, oh man, if we had that guy, we'd be good. And then... I think it just kind of stopped this year. I don't think there's anybody coming this year that would make you go, all right, now we're over the hump.
We've seen all these guys that you're like, oh man, if we had that guy, we'd be good. And then... I think it just kind of stopped this year. I don't think there's anybody coming this year that would make you go, all right, now we're over the hump.
What's the pitch there? You don't have to move? You don't have to hire a moving company?
What's the pitch there? You don't have to move? You don't have to hire a moving company?
Devontae Adams was fantastic for the Jets. They were terrible. He had some games.
Devontae Adams was fantastic for the Jets. They were terrible. He had some games.
I don't think he really cares. New regime, though. It's new regime. It's new everything.
I don't think he really cares. New regime, though. It's new regime. It's new everything.
Does Tom Brady bring in Tom Brady?
Does Tom Brady bring in Tom Brady?
Does DK Metcalf move the needle? I mean, did he move the needle in Seattle? It's essentially the same team. It's essentially the same thing.
Does DK Metcalf move the needle? I mean, did he move the needle in Seattle? It's essentially the same team. It's essentially the same thing.
What are they doing?
What are they doing?
And Jamar Chase wants a new contract, and he deserves to be probably the highest paid, if not top two wide receiver in football. And now you're just going to go ahead and pay his number two, $26.5 million. Yeah. You're just – like, what are you doing? You just lost Sam Hubbard, who retired unexpectedly out of nowhere. So your defense, which was –
And Jamar Chase wants a new contract, and he deserves to be probably the highest paid, if not top two wide receiver in football. And now you're just going to go ahead and pay his number two, $26.5 million. Yeah. You're just – like, what are you doing? You just lost Sam Hubbard, who retired unexpectedly out of nowhere. So your defense, which was –
Can you have that energy? Can Billy Gill have that type of energy? Because I just don't see it.
Can you have that energy? Can Billy Gill have that type of energy? Because I just don't see it.
the worst in the league, or at least up there last year, now just lost its lone piece that was worth a damn.
the worst in the league, or at least up there last year, now just lost its lone piece that was worth a damn.
Yeah, but if you're already... Reassign him is fine. But if you're already calling me Fuentes, that means you're already the Mike on God Bless Football.
Yeah, but if you're already... Reassign him is fine. But if you're already calling me Fuentes, that means you're already the Mike on God Bless Football.
Because you didn't refer to me as Mike.
Because you didn't refer to me as Mike.
God bless football, Billy Goh.
God bless football, Billy Goh.
$50 million. Money and a shot. Yeah, $50 million. Money and a shot is what he's looking for.
$50 million. Money and a shot. Yeah, $50 million. Money and a shot is what he's looking for.
I'm going to say the Rams just because I don't know, like, what is their plan after Matt Stafford? Like, are they going to go after Sam Darnold? Like, who's their guy?
I'm going to say the Rams just because I don't know, like, what is their plan after Matt Stafford? Like, are they going to go after Sam Darnold? Like, who's their guy?
That's what I'm saying. Like, Jimmy Garoppolo. Like, what's your deal? I just don't know who it is. Unknown. So I'm going to have to go Rams.
That's what I'm saying. Like, Jimmy Garoppolo. Like, what's your deal? I just don't know who it is. Unknown. So I'm going to have to go Rams.
Yeah, 49ers because the division's just too stacked for the Bears.
Yeah, 49ers because the division's just too stacked for the Bears.
God bless football. God bless football.
God bless football. God bless football.
I mean, Taylor is the steak and Stu gots is the sizzle. I got you.
I mean, Taylor is the steak and Stu gots is the sizzle. I got you.
This is where the Jets win. This is the only time the Jets win.
This is where the Jets win. This is the only time the Jets win.
Very close to Sue Gatz is where I stand. You guys. You guys are the worst. What do you mean we're the worst? They're the worst. Don't blame us. He was so bad this year that the Jets, despite him starting every game, won five games. And you know what? He's still their best option for next year. So he's absolutely right. You need to go away. We hate you. But stay.
Very close to Sue Gatz is where I stand. You guys. You guys are the worst. What do you mean we're the worst? They're the worst. Don't blame us. He was so bad this year that the Jets, despite him starting every game, won five games. And you know what? He's still their best option for next year. So he's absolutely right. You need to go away. We hate you. But stay.
Six quarterbacks were taken in the top 12 picks last year. That's the thing. The Jets had the 10th pick. They would have wound up with one of those six quarterbacks. And honestly, all six of them look pretty good right now. Let's see something.
Six quarterbacks were taken in the top 12 picks last year. That's the thing. The Jets had the 10th pick. They would have wound up with one of those six quarterbacks. And honestly, all six of them look pretty good right now. Let's see something.
We would have had our choice of Bo Nix or J.J. McCarthy.
We would have had our choice of Bo Nix or J.J. McCarthy.
Olufesanu.
Olufesanu.
It's not sexy. Right pick. But anyway, I want Hall of Hypotheticals. Was it really the right pick?
It's not sexy. Right pick. But anyway, I want Hall of Hypotheticals. Was it really the right pick?
Listen, left tackle is not a position you want to need.
Listen, left tackle is not a position you want to need.
Yes, they would have taken J.J., I bet.
Yes, they would have taken J.J., I bet.
Sure. He would have been Aaron Rodgers 2.0. It would have been, we got the guy for the future. He got hurt before, you know, right as the season started. Now we have all the, yay, now we have him for real this time.
Sure. He would have been Aaron Rodgers 2.0. It would have been, we got the guy for the future. He got hurt before, you know, right as the season started. Now we have all the, yay, now we have him for real this time.
Of course they don't. But I'm not giving them the seventh overall pick.
Of course they don't. But I'm not giving them the seventh overall pick.
Or a guy who hasn't played a snap.
Or a guy who hasn't played a snap.
How about a pick swap? Actually, move from, what, 26, 28, whatever the Vikings are, to seven.
How about a pick swap? Actually, move from, what, 26, 28, whatever the Vikings are, to seven.
Yeah, probably. I hope not. Really? I hope. Why get rid of Aaron Rodgers to bring in lesser Aaron Rodgers? I would just stick with Tyron. Give me Tyron for a year.
Yeah, probably. I hope not. Really? I hope. Why get rid of Aaron Rodgers to bring in lesser Aaron Rodgers? I would just stick with Tyron. Give me Tyron for a year.
wouldn't hate green bay same seems like if if you're gonna go to green bay seems like this is the time of the year to do it right mikey why are you objecting to green bay it's the nfl draft at lambo field like how could it get better than that if we're gonna be in green bay i'm all for it if we're gonna be in milwaukee an hour and a half down the road just put me in nashville green bay ish
wouldn't hate green bay same seems like if if you're gonna go to green bay seems like this is the time of the year to do it right mikey why are you objecting to green bay it's the nfl draft at lambo field like how could it get better than that if we're gonna be in green bay i'm all for it if we're gonna be in milwaukee an hour and a half down the road just put me in nashville green bay ish
And we end up with Jackson Dart. After 14 years of no playoffs, I'll take the Saturday game against the Texans every year for a while.
And we end up with Jackson Dart. After 14 years of no playoffs, I'll take the Saturday game against the Texans every year for a while.
Saturday at 3 p.m.
Saturday at 3 p.m.
Absolutely. Absolutely. Not even a question. I agree. And Cleveland. Yes.
Absolutely. Absolutely. Not even a question. I agree. And Cleveland. Yes.
Housemate.
Housemate.
And the fact that they called him Robert Goon, it makes him sound so official. Like he's not the guy that we know. He's Bobby Goons. He's not Robert Goon.
And the fact that they called him Robert Goon, it makes him sound so official. Like he's not the guy that we know. He's Bobby Goons. He's not Robert Goon.
Don't make Robert turn into Bobby.
Don't make Robert turn into Bobby.
We went to the wrong house looking for the P&G house to interview a bunch of people, and it... How do I... Okay, there were people living in it, but they did not pay for it, and there were
We went to the wrong house looking for the P&G house to interview a bunch of people, and it... How do I... Okay, there were people living in it, but they did not pay for it, and there were
This poor guy thinks he's getting Robert Goon and he's getting Bobby Goons. Oh, 100%.
This poor guy thinks he's getting Robert Goon and he's getting Bobby Goons. Oh, 100%.
boarded up windows and yeah it was a um a house for the homeless it was a squatter's house right it was a squatter's house all right uh danny b was parking in front of it going i'm pretty sure this is the address i go i don't care if this is the address this is not where we're going right yeah yeah uh did you think the guys the people that were squatting were draft prospects no they were not all right
boarded up windows and yeah it was a um a house for the homeless it was a squatter's house right it was a squatter's house all right uh danny b was parking in front of it going i'm pretty sure this is the address i go i don't care if this is the address this is not where we're going right yeah yeah uh did you think the guys the people that were squatting were draft prospects no they were not all right
Well, on that downer. Exactly. Don't sound so excited.
Well, on that downer. Exactly. Don't sound so excited.
All right, more Mike Lee to pick first in the NFL draft. The Titans or the field?
All right, more Mike Lee to pick first in the NFL draft. The Titans or the field?
Why do you think it's on here? Why do you think this question is on here?
Why do you think it's on here? Why do you think this question is on here?
You could also trade a few down and get Abdul Carter.
You could also trade a few down and get Abdul Carter.
One guy had hops. Okay. I saw him leap over the fence.
One guy had hops. Okay. I saw him leap over the fence.
I'll say Tennessee.
I'll say Tennessee.
All right. More Mike Lee to be a starting quarterback next season. Jameis Winston or Daniel Jones?
All right. More Mike Lee to be a starting quarterback next season. Jameis Winston or Daniel Jones?
Okay, they're the starter opening week, whether you want to call it based on injury or not, but it's not like a one-week fill-in in week nine because of a hamstring.
Okay, they're the starter opening week, whether you want to call it based on injury or not, but it's not like a one-week fill-in in week nine because of a hamstring.
Can I step in real quick and marry these two worlds real quick? Please do. Can we get Vasselli to interview on the show? Wow. Can we have Vasselli do the interview? I want to hear the questions he asks, and I want to hear how you answer them.
Can I step in real quick and marry these two worlds real quick? Please do. Can we get Vasselli to interview on the show? Wow. Can we have Vasselli do the interview? I want to hear the questions he asks, and I want to hear how you answer them.
I'm going to do the same thing for that seasonal dining room attendant thing, by the way. That sounded good. I'll hire you, okay? Yeah.
I'm going to do the same thing for that seasonal dining room attendant thing, by the way. That sounded good. I'll hire you, okay? Yeah.
First time. Get the whole crew in. Yeah, wow.
First time. Get the whole crew in. Yeah, wow.
Speaking of graphics, people hated the score bug. Hated the score bug. I liked it. I really liked it. I hated it. I liked it. I liked it how simple it was and you could see through it. Yeah. But such a downgrade from other score bugs they've had.
Speaking of graphics, people hated the score bug. Hated the score bug. I liked it. I really liked it. I hated it. I liked it. I liked it how simple it was and you could see through it. Yeah. But such a downgrade from other score bugs they've had.
At this point, the store comes to him. Well, the store comes to the house and he picks the one he wants.
At this point, the store comes to him. Well, the store comes to the house and he picks the one he wants.
Maybe.
Maybe.
They only ran the ball seven times, I think, the Chiefs in total.
They only ran the ball seven times, I think, the Chiefs in total.
Don't count the Patrick Mahomes scrambling for his life.
Don't count the Patrick Mahomes scrambling for his life.
Oh, you got it? Yeah, 110 yards. I should have known better.
Oh, you got it? Yeah, 110 yards. I should have known better.
Seal being a seal, guys.
Seal being a seal, guys.
Had my girl in it. Who's your girl? Becky G. Becky G. She's in the commercial for like a quarter of a second on the boat there.
Had my girl in it. Who's your girl? Becky G. Becky G. She's in the commercial for like a quarter of a second on the boat there.
I don't know.
I don't know.
I'm with Mikey because she has enough money that she can buy the best sweet and the best everything and she'll be there. There's no way Eugene Levy is buying Little Caesars pizza.
I'm with Mikey because she has enough money that she can buy the best sweet and the best everything and she'll be there. There's no way Eugene Levy is buying Little Caesars pizza.
Thank you.
Thank you.
Thank you.
Thank you.
Thank you.
Thank you.
Washed, some people are saying. Some people asked that.
Washed, some people are saying. Some people asked that.
I did think about Rose for a second, and then I quickly forgot about her.
I did think about Rose for a second, and then I quickly forgot about her.
Fridays only.
Fridays only.
Might be hitting the road a little bit. Maybe going to Tennessee, Nashville situation.
Might be hitting the road a little bit. Maybe going to Tennessee, Nashville situation.
It's about projector screens. I don't get why people are obsessed with projector screens. The max quality you get is like 720. It's not a good viewing experience. And then there was like
It's about projector screens. I don't get why people are obsessed with projector screens. The max quality you get is like 720. It's not a good viewing experience. And then there was like
at my uncle's house there was wi-fi issues and then like i kept stopping and then the tv outside the projector is like a full minute behind the inside like behind the inside yeah so i'm like yo i love you i'm going inside i'm not doing this outside thing anymore like i don't know what you're trying to do here i know it's nice outside we're trying to watch a game not doing this were there a lot of people outside with you
at my uncle's house there was wi-fi issues and then like i kept stopping and then the tv outside the projector is like a full minute behind the inside like behind the inside yeah so i'm like yo i love you i'm going inside i'm not doing this outside thing anymore like i don't know what you're trying to do here i know it's nice outside we're trying to watch a game not doing this were there a lot of people outside with you
like all the old men were out there yeah like half the people didn't care about the game yeah the other half wanted to see Kendrick Lamar didn't care about the game so it was like me and like some of the kids inside like the teenagers and then the guys that were watching for gambling
like all the old men were out there yeah like half the people didn't care about the game yeah the other half wanted to see Kendrick Lamar didn't care about the game so it was like me and like some of the kids inside like the teenagers and then the guys that were watching for gambling
but it's not any good. I can watch games in stunning 4K HD, the best possible viewing experience, then I gotta go outside to watch this hopefully 1080p on a projection that's probably diagonal because they don't know how to prop it up. The sound is absolute ass because the speaker built in is crap. It's just not a great viewing experience. Oh my God, we're outside of Florida, who cares?
but it's not any good. I can watch games in stunning 4K HD, the best possible viewing experience, then I gotta go outside to watch this hopefully 1080p on a projection that's probably diagonal because they don't know how to prop it up. The sound is absolute ass because the speaker built in is crap. It's just not a great viewing experience. Oh my God, we're outside of Florida, who cares?
So now I'm out in the nice weather getting eaten alive by mosquitoes watching this game.
So now I'm out in the nice weather getting eaten alive by mosquitoes watching this game.
No. There were like three defenders.
No. There were like three defenders.
The draft?
The draft?
And I can't hear it.
And I can't hear it.
Do you think that there's one person taking these phone calls that will be like, I remember you. I remember you. You're not getting out of this. This is definitely automated. No.
Do you think that there's one person taking these phone calls that will be like, I remember you. I remember you. You're not getting out of this. This is definitely automated. No.
You work in the media. They don't want you.
You work in the media. They don't want you.
God bless football, Fuentes.
God bless football, Fuentes.
You were a little worried about Spags there for a minute, weren't you?
You were a little worried about Spags there for a minute, weren't you?
We wouldn't be able to stop it.
We wouldn't be able to stop it.
Okay. The Tampa Bay Buccaneers. Oh, man. They thought they got their offensive coordinator back, and then he snuck off and then met with his side chick again and ended up signing with Jacksonville Jaguars. They were like, oh, no, he's back, and we're going to give him this big contract. He's like, no, they got rid of the guy I don't like. I'm just going to go there.
Okay. The Tampa Bay Buccaneers. Oh, man. They thought they got their offensive coordinator back, and then he snuck off and then met with his side chick again and ended up signing with Jacksonville Jaguars. They were like, oh, no, he's back, and we're going to give him this big contract. He's like, no, they got rid of the guy I don't like. I'm just going to go there.
I have a winner question. Next time the Chiefs call the Bills, they should just say no.
I have a winner question. Next time the Chiefs call the Bills, they should just say no.
And if you're the Chiefs, you call every year. Oh, you got to call every year. Just to get in their head.
And if you're the Chiefs, you call every year. Oh, you got to call every year. Just to get in their head.
They'll never say yes.
They'll never say yes.
Watch them wonder who it is.
Watch them wonder who it is.
Is Stephon Diggs calling the Chiefs?
Is Stephon Diggs calling the Chiefs?
Hold up. I can see Diggs calling the Chiefs, them going to the Super Bowl, and him saying, see, I was the missing piece the whole time.
Hold up. I can see Diggs calling the Chiefs, them going to the Super Bowl, and him saying, see, I was the missing piece the whole time.
I thought they had agreed to a buyout at the end of this.
I thought they had agreed to a buyout at the end of this.
Now Daniel Jones is making that. He should hold out. Hold out?
Now Daniel Jones is making that. He should hold out. Hold out?
Is Zach Ertz the one that sent you jury duty notice? Because you're a big man at Zach Ertz. You really are.
Is Zach Ertz the one that sent you jury duty notice? Because you're a big man at Zach Ertz. You really are.
Thank you. Get the ball to Terry.
Thank you. Get the ball to Terry.
Thank you. I need a 12 yards for the parlay. Thanks. What are we doing here? All I hear is you saying Jaden Daniels is overrated.
Thank you. I need a 12 yards for the parlay. Thanks. What are we doing here? All I hear is you saying Jaden Daniels is overrated.
But he's got to put on some weight.
But he's got to put on some weight.
That wasn't a stat. I have a different one.
That wasn't a stat. I have a different one.
Golic makes more than that about diabetes.
Golic makes more than that about diabetes.
We've got a wedding to plan.
We've got a wedding to plan.
You're right. I'd be very upset if you did.
You're right. I'd be very upset if you did.
A hundred k. How much would you do it for, Stu? Two dollars, all fair.
A hundred k. How much would you do it for, Stu? Two dollars, all fair.
Get it done in the regular season, Mahomes. Stop winning in the playoffs. Show you can do it when it doesn't count.
Get it done in the regular season, Mahomes. Stop winning in the playoffs. Show you can do it when it doesn't count.
That was a bad one.
That was a bad one.
But it's starting to get stopped now. Like, teams are stopping. The... They stopped it when Josh Allen tried to run it. Like, maybe we don't need to ban it because maybe it's not as good anymore. No, they got Josh Allen twice. They did. Josh Allen is not Jalen Hurts.
But it's starting to get stopped now. Like, teams are stopping. The... They stopped it when Josh Allen tried to run it. Like, maybe we don't need to ban it because maybe it's not as good anymore. No, they got Josh Allen twice. They did. Josh Allen is not Jalen Hurts.
No, Josh Allen is supposed to be better than Jalen Hurts at it because he's so much bigger.
No, Josh Allen is supposed to be better than Jalen Hurts at it because he's so much bigger.
They're going to cut to him and have that big Chiefs coat on.
They're going to cut to him and have that big Chiefs coat on.
That's not a terrible idea, especially in fantasy.
That's not a terrible idea, especially in fantasy.
Yo!
Yo!
No, I'd already lost the parlay by then because Gainwell was out.
No, I'd already lost the parlay by then because Gainwell was out.
I feel like such a genius putting it together, and then I just feel so bad once the first leg is completely gone.
I feel like such a genius putting it together, and then I just feel so bad once the first leg is completely gone.
K-Punk's never lost a bet that he sent us.
K-Punk's never lost a bet that he sent us.
Really?
Really?
That was on Twitter.
That was on Twitter.
He just screenshotted it and sent it. That's possible. It is such a K-Funk thing to do.
He just screenshotted it and sent it. That's possible. It is such a K-Funk thing to do.
That's how it works. This is Michael Jordan with the Bulls and the Knicks can't win the championship. Is it because Patrick Ewing wasn't great? No, it was because Michael Jordan was there. You got to beat Mahomes. You can't do it.
That's how it works. This is Michael Jordan with the Bulls and the Knicks can't win the championship. Is it because Patrick Ewing wasn't great? No, it was because Michael Jordan was there. You got to beat Mahomes. You can't do it.
Opossums. I think we ate there in Arizona.
Opossums. I think we ate there in Arizona.
Opossums?
Opossums?
Billy Opossums.
Billy Opossums.
Did they have this planned all the way back then?
Did they have this planned all the way back then?
Yeah.
Yeah.
Do we know if it's plugged into anything? Oh, you think he brought his own from home? Just walking around with a headset. I do. I do kind of like that.
Do we know if it's plugged into anything? Oh, you think he brought his own from home? Just walking around with a headset. I do. I do kind of like that.
It's the same thing like when my kids were toddlers, I'd give them a remote with no batteries, and they'd think they were doing everything. Yeah, look, you changed the channel. Same thing with Big Dom. Here's his headset. Don't worry, we'll talk to you when we need you.
It's the same thing like when my kids were toddlers, I'd give them a remote with no batteries, and they'd think they were doing everything. Yeah, look, you changed the channel. Same thing with Big Dom. Here's his headset. Don't worry, we'll talk to you when we need you.
I have never seen a play like that where it was a trick play, but everything was based on the fact that the defense had to be tricked or it was like, oh, we give up. And the Eagles were absolutely not fooled by that play at all. But I've never seen a play without another option. That was it.
I have never seen a play like that where it was a trick play, but everything was based on the fact that the defense had to be tricked or it was like, oh, we give up. And the Eagles were absolutely not fooled by that play at all. But I've never seen a play without another option. That was it.
Nein, nein.
Nein, nein.
So wait, the problem is that I wasn't on the schedule Monday, but I was on the show Monday. But you could have put me on the schedule Monday and then we would have just done it on Monday. But we don't have to do it today. We could just move on. I'm fine with that.
So wait, the problem is that I wasn't on the schedule Monday, but I was on the show Monday. But you could have put me on the schedule Monday and then we would have just done it on Monday. But we don't have to do it today. We could just move on. I'm fine with that.
I hope so. I miss her. Okay, alright.
I hope so. I miss her. Okay, alright.
Bill, weißt du, was ich denke? Heist.
Bill, weißt du, was ich denke? Heist.
We'll stuff you in a suitcase.
We'll stuff you in a suitcase.
You guys really want... Heavy-handed Sturguts.
You guys really want... Heavy-handed Sturguts.
Aber tut Zucker nicht immer noch etwas in Ihrem Gehirn, wenn Sie es essen, auch wenn Sie es nicht riechen können? Bekommt man nicht einen Dopamin-Rusch oder einen Energie-Rusch daraus?
Aber tut Zucker nicht immer noch etwas in Ihrem Gehirn, wenn Sie es essen, auch wenn Sie es nicht riechen können? Bekommt man nicht einen Dopamin-Rusch oder einen Energie-Rusch daraus?
Well, I mean, I disagree. Dan, when you're sick and you lose your sense of smell and taste, do you only eat like steamed broccoli every day? Like to me, it seems like you would still eat the things that bring you comfort if you're sick or if you can't taste them, even if you can't taste them.
Well, I mean, I disagree. Dan, when you're sick and you lose your sense of smell and taste, do you only eat like steamed broccoli every day? Like to me, it seems like you would still eat the things that bring you comfort if you're sick or if you can't taste them, even if you can't taste them.
Das ist richtig. Ich denke, das ist für viele Leute wahr. Essen ist mehr als nur Geschmack. Essen ist wie mit deiner Familie zusammenkommen und ein Essen machen und es genießen. Breaking Bread. Ich weiß nicht. Es gibt viel mehr zu essen, als nur, oh, das schmeckt gut, denke ich, für viele Leute.
Das ist richtig. Ich denke, das ist für viele Leute wahr. Essen ist mehr als nur Geschmack. Essen ist wie mit deiner Familie zusammenkommen und ein Essen machen und es genießen. Breaking Bread. Ich weiß nicht. Es gibt viel mehr zu essen, als nur, oh, das schmeckt gut, denke ich, für viele Leute.
Ich liebe es.
Ich liebe es.
Ich mache das. It's pretty common for productions to have food on standby for people because the people in the control room are there for like 12 hours without a break most of the time.
Ich mache das. It's pretty common for productions to have food on standby for people because the people in the control room are there for like 12 hours without a break most of the time.
Du bist King Levitard mit deinen off-limits Leuten, die nicht mit dir sprechen dürfen.
Du bist King Levitard mit deinen off-limits Leuten, die nicht mit dir sprechen dürfen.
And it doesn't matter. It goes back to Aaron Rodgers. 18 consecutive winning seasons. It doesn't matter who his quarterback is going to be next year. He's still going to go 9-8. We talk college football with Lucy next.
And it doesn't matter. It goes back to Aaron Rodgers. 18 consecutive winning seasons. It doesn't matter who his quarterback is going to be next year. He's still going to go 9-8. We talk college football with Lucy next.
God bless football, Billy Gill. God bless football, Mikey A. God bless football, Fuentes.
God bless football, Billy Gill. God bless football, Mikey A. God bless football, Fuentes.
I should be worried about the camera shots, but I'm not.
I should be worried about the camera shots, but I'm not.
Okay.
Okay.
Wait, so Rose, who works here at Metal Ark Media, she was at the game with you. She was. You guys are on the field after the game.
Wait, so Rose, who works here at Metal Ark Media, she was at the game with you. She was. You guys are on the field after the game.
The melee breaks out. Yes. Pepper spray starts flying.
The melee breaks out. Yes. Pepper spray starts flying.
And Rose caught some pepper spray?
And Rose caught some pepper spray?
Okay.
Okay.
Wow.
Wow.
If she gets the right attorney, she could have years off.
If she gets the right attorney, she could have years off.
Man. Do it. They have enough of a lead. They can afford it. You mentioned Mac Jones. They left the back door open for Mac Jones, and he walked right through it. Jesus, did that hurt.
Man. Do it. They have enough of a lead. They can afford it. You mentioned Mac Jones. They left the back door open for Mac Jones, and he walked right through it. Jesus, did that hurt.
When Billy started that sentence, did you think that the response was going to be, that's a genius thought? Are you asking me? Yes.
When Billy started that sentence, did you think that the response was going to be, that's a genius thought? Are you asking me? Yes.
Yes. Okay. I'm sorry. Did I offend you? I have a game for Lucy. I have a game for Lucy, too, but let's do your game first. Is it Lucy or Goosey? It is Lucy or Goosey, but hold on a second. Lucy, at any point, were you nervous being down on the field there? No.
Yes. Okay. I'm sorry. Did I offend you? I have a game for Lucy. I have a game for Lucy, too, but let's do your game first. Is it Lucy or Goosey? It is Lucy or Goosey, but hold on a second. Lucy, at any point, were you nervous being down on the field there? No.
She is...
She is...
Yeah, of course with your friend, right?
Yeah, of course with your friend, right?
Yeah. It's all right. It's a rough one. Yeah, it is. Speaking of that was football. Michigan, Ohio State. That was football. Was it? It was.
Yeah. It's all right. It's a rough one. Yeah, it is. Speaking of that was football. Michigan, Ohio State. That was football. Was it? It was.
You might be a bully. Yeah. Well, yeah, but Rose said she would have done the same thing.
You might be a bully. Yeah. Well, yeah, but Rose said she would have done the same thing.
Oh, Jesus Christ. Billy, you would laugh at me, no? You would laugh at me. You would laugh at me, Billy.
Oh, Jesus Christ. Billy, you would laugh at me, no? You would laugh at me. You would laugh at me, Billy.
Do we have a poll? Can you walk off pepper spray? I mean, I don't think it's a thing. You walk off like a hamstring. You don't walk off. Blink it out? Yeah. Blink it out, right? It's better. Bill, you have a game for Lucy here? Yeah, it's not really a game.
Do we have a poll? Can you walk off pepper spray? I mean, I don't think it's a thing. You walk off like a hamstring. You don't walk off. Blink it out? Yeah. Blink it out, right? It's better. Bill, you have a game for Lucy here? Yeah, it's not really a game.
Uh, we don't ignore a college football here on God bless football. Lucy will join us in studio. She was at the game, the game, not Harvard Yale. She was at that one too. She was at that game, but it's not the game. The game is Michigan and Ohio state. And there was a fight afterwards and Lucy was on the field.
Uh, we don't ignore a college football here on God bless football. Lucy will join us in studio. She was at the game, the game, not Harvard Yale. She was at that one too. She was at that game, but it's not the game. The game is Michigan and Ohio state. And there was a fight afterwards and Lucy was on the field.
All right. Are you ready for Lucy or Goosey?
All right. Are you ready for Lucy or Goosey?
Okay. This is. Very exciting.
Okay. This is. Very exciting.
What stinks is the most exciting team in the Big 12 won't make it in.
What stinks is the most exciting team in the Big 12 won't make it in.
And so, uh, we will talk to her about that, uh, coming up the college football playoff, uh, I guess the picture is becoming clearer, although it's very confusing. What stood out for you yesterday, Billy, with the NFL? Like, was there anything besides the snow and that's football? Was there anything that stood out to you? I mean.
And so, uh, we will talk to her about that, uh, coming up the college football playoff, uh, I guess the picture is becoming clearer, although it's very confusing. What stood out for you yesterday, Billy, with the NFL? Like, was there anything besides the snow and that's football? Was there anything that stood out to you? I mean.
Crazy.
Crazy.
They should have won that game.
They should have won that game.
Thank you, Mike Fuentes. We were just having a discussion. I believe that football in the snow looks fun. Oh, my gosh.
Thank you, Mike Fuentes. We were just having a discussion. I believe that football in the snow looks fun. Oh, my gosh.
I would say this, if it does come down to Alabama or Indiana, I want Alabama in. I think Alabama's better.
I would say this, if it does come down to Alabama or Indiana, I want Alabama in. I think Alabama's better.
All right, a couple of quick ones here. Lucy or Goosey, if Penn State loses a close game to Oregon, they're still getting into the playoffs.
All right, a couple of quick ones here. Lucy or Goosey, if Penn State loses a close game to Oregon, they're still getting into the playoffs.
Okay, what if they get blown out?
Okay, what if they get blown out?
Really?
Really?
It's not this year, this year, right?
It's not this year, this year, right?
It's like, we got to get over seven. It took Georgia. You mentioned overtime before Georgia, Georgia tech. It took that game to remind us just how ridiculous the overtime rules are in college football.
It's like, we got to get over seven. It took Georgia. You mentioned overtime before Georgia, Georgia tech. It took that game to remind us just how ridiculous the overtime rules are in college football.
Yeah.
Yeah.
Can we just stay on the same side of the field?
Can we just stay on the same side of the field?
Lucy or Goosey, South Carolina should make the playoff.
Lucy or Goosey, South Carolina should make the playoff.
All right, last one for you, Lucy. We went long here. Lucy or Goosey, Marcus Freeman will leave Notre Dame to coach the Chicago Bears. Lucy or Goosey. Billy, that's a rumor that's out there. You're making a face. It's a rumor that's actually out there. Marcus Freeman leaving Notre Dame. I don't think it's going to happen. I can't see it.
All right, last one for you, Lucy. We went long here. Lucy or Goosey, Marcus Freeman will leave Notre Dame to coach the Chicago Bears. Lucy or Goosey. Billy, that's a rumor that's out there. You're making a face. It's a rumor that's actually out there. Marcus Freeman leaving Notre Dame. I don't think it's going to happen. I can't see it.
Last one. Lucy or Goosey, Georgia beats Texas.
Last one. Lucy or Goosey, Georgia beats Texas.
Go for it on fourth down for crying out loud.
Go for it on fourth down for crying out loud.
Georgia's out then.
Georgia's out then.
Georgia's going to lose and still get in?
Georgia's going to lose and still get in?
Wow. Book it and take it to the bank. Lucy, thank you as always.
Wow. Book it and take it to the bank. Lucy, thank you as always.
Lucy guarantee. More NFL coming up next.
Lucy guarantee. More NFL coming up next.
So there's a surprise Next Segment with the Big Board Bets that you're not going to share with us now. You're teasing it for Next Segment. Correct. It's big breaking news.
So there's a surprise Next Segment with the Big Board Bets that you're not going to share with us now. You're teasing it for Next Segment. Correct. It's big breaking news.
No, I don't have top fives.
No, I don't have top fives.
I got my game in, Can You See It?, and so I'm good.
I got my game in, Can You See It?, and so I'm good.
I did have some more.
I did have some more.
Green Bay Packers make the Super Bowl.
Green Bay Packers make the Super Bowl.
I can see it.
I can see it.
I can see it. Now you have the Lions and the Eagles in that same conference.
I can see it. Now you have the Lions and the Eagles in that same conference.
Because we can all see it? Yeah, you can see it. Any others? I'm just surprised you can see it so clearly.
Because we can all see it? Yeah, you can see it. Any others? I'm just surprised you can see it so clearly.
It's snowing. No, I can't predict the weather. I could just tell you that the Packers are going to make the Super Bowl. Can you see it?
It's snowing. No, I can't predict the weather. I could just tell you that the Packers are going to make the Super Bowl. Can you see it?
All right. I got a couple more. Okay, quick, quick, quick. Bill Belichick, Bears. Can you see it? I can't see it, no. I can't see it.
All right. I got a couple more. Okay, quick, quick, quick. Bill Belichick, Bears. Can you see it? I can't see it, no. I can't see it.
Can't see it. All right. I had a tough time seeing it as well. All right. Mike Vrabel, Bears. Can you see it?
Can't see it. All right. I had a tough time seeing it as well. All right. Mike Vrabel, Bears. Can you see it?
I can see it.
I can see it.
Mike Frabel, Ohio State. Can you see it? Oh, I can see that. I can see it. Oh, I can see that. I can see it. I can see it. Poor Ryan Day, man. If Ryan Day wins a national championship, they should still fire him.
Mike Frabel, Ohio State. Can you see it? Oh, I can see that. I can see it. Oh, I can see that. I can see it. I can see it. Poor Ryan Day, man. If Ryan Day wins a national championship, they should still fire him.
I can't see it. No. I can see it. I can see it. I can't. Oh, that McDonald. Can you see it? I can hear it. I can't see it.
I can't see it. No. I can see it. I can see it. I can't. Oh, that McDonald. Can you see it? I can hear it. I can't see it.
I have no idea. Well, it's in your hands.
I have no idea. Well, it's in your hands.
Why, at the planet?
Why, at the planet?
Yeah.
Yeah.
Keep the music on. Kansas City Chiefs in the Super Bowl. Can you see it? I can see it. How could you not see it?
Keep the music on. Kansas City Chiefs in the Super Bowl. Can you see it? I can see it. How could you not see it?
Me and Mikey can see it clearly. Fuentes can see it clearly. Why wouldn't you be able to see it clearly? It doesn't matter. Billy can't see it. You have another winner?
Me and Mikey can see it clearly. Fuentes can see it clearly. Why wouldn't you be able to see it clearly? It doesn't matter. Billy can't see it. You have another winner?
So he had three missed kicks yesterday, first time in his career. He does lead the NFL with 10 missed kicks this season. And there are talks about them moving on. Crazy.
So he had three missed kicks yesterday, first time in his career. He does lead the NFL with 10 missed kicks this season. And there are talks about them moving on. Crazy.
Billy, the Ravens, five losses by a combined 22 points. Tucker has missed. Field goals and extra points. A total of 22 points. Yeah. He's the reason. All right.
Billy, the Ravens, five losses by a combined 22 points. Tucker has missed. Field goals and extra points. A total of 22 points. Yeah. He's the reason. All right.
He's kicking his way out of the Hall of Fame.
He's kicking his way out of the Hall of Fame.
Yeah. They lost. But Carolina, what a win. They're not.
Yeah. They lost. But Carolina, what a win. They're not.
I can see us all owing Frank Reich an apology about that.
I can see us all owing Frank Reich an apology about that.
He didn't want to draft him also. He did not want to draft him. He was right about that one. I take my apology back. He wanted C.J. Stroud. Yes, he did want C.J. Stroud, and he's regressed. This is crazy. Wow, so we don't owe Frank Reich an apology. We have no idea. BBBs with a big announcement next. All right, wrapping it up here on God Bless Football. We have the Broncos and Browns tonight.
He didn't want to draft him also. He did not want to draft him. He was right about that one. I take my apology back. He wanted C.J. Stroud. Yes, he did want C.J. Stroud, and he's regressed. This is crazy. Wow, so we don't owe Frank Reich an apology. We have no idea. BBBs with a big announcement next. All right, wrapping it up here on God Bless Football. We have the Broncos and Browns tonight.
That means I'll be sleeping by 8.15, 8.30. Billy. Yeah. The BBBs are coming up.
That means I'll be sleeping by 8.15, 8.30. Billy. Yeah. The BBBs are coming up.
I told you I have big news. Yes, but before... Well, I was setting you up for that. Before we get to the BBBs, your picks, and you've been on fire. Yeah. You teased some big news last segment about the BBBs.
I told you I have big news. Yes, but before... Well, I was setting you up for that. Before we get to the BBBs, your picks, and you've been on fire. Yeah. You teased some big news last segment about the BBBs.
For years around here, it's been Billy's Big Board Bets brought to you by dot, dot, dot. And now there's no more dot, dot, dot. Poor dot, dot, dot. We're sorry you lost your sponsorship.
For years around here, it's been Billy's Big Board Bets brought to you by dot, dot, dot. And now there's no more dot, dot, dot. Poor dot, dot, dot. We're sorry you lost your sponsorship.
Denver Broncos, AFC Championship game, Mikey. Can you see it? Can't see it. Can't see it. Fuentes can't see it? Can't see it. Can't really see it, huh?
Denver Broncos, AFC Championship game, Mikey. Can you see it? Can't see it. Can't see it. Fuentes can't see it? Can't see it. Can't really see it, huh?
Yep. Yeah. They are the ones that beat the Ravens. You're right. At home, they'll play the Ravens. Big upset. Yes. The Ravens should be getting the home game. They won't. The Broncos will get it. The Broncos will beat the Ravens. You're right. You're poor Lamar Jackson. All right, Billy. Pick number two.
Yep. Yeah. They are the ones that beat the Ravens. You're right. At home, they'll play the Ravens. Big upset. Yes. The Ravens should be getting the home game. They won't. The Broncos will get it. The Broncos will beat the Ravens. You're right. You're poor Lamar Jackson. All right, Billy. Pick number two.
Okay.
Okay.
I like it. I mean, if you think Bo Nix is going to throw for that many yards, then it stands to reason that Cortland Sutton would have that many catches, I guess.
I like it. I mean, if you think Bo Nix is going to throw for that many yards, then it stands to reason that Cortland Sutton would have that many catches, I guess.
I don't know. I'm not really excited for this game. Browns. Really? Really. Yeah. Okay. It's not the Broncos. It's the Browns.
I don't know. I'm not really excited for this game. Browns. Really? Really. Yeah. Okay. It's not the Broncos. It's the Browns.
And here's my other one where, again, I just wish one of them was good.
And here's my other one where, again, I just wish one of them was good.
Right.
Right.
You bet the Titans, didn't you? Hell no, I didn't. You've been mad about this since yesterday. You took the Titans. No one would be this upset when they took the Titans.
You bet the Titans, didn't you? Hell no, I didn't. You've been mad about this since yesterday. You took the Titans. No one would be this upset when they took the Titans.
It's on you for listening to Chris.
It's on you for listening to Chris.
I am on a heater right now. Stu, you got NFL and I took Washington. So, I mean, listen to me and stop listening to Chris. It'd be crazy.
I am on a heater right now. Stu, you got NFL and I took Washington. So, I mean, listen to me and stop listening to Chris. It'd be crazy.
Yeah.
Yeah.
No, Billy's right. Mikey, it took Gino Smith like a decade after he left the jets to get it right.
No, Billy's right. Mikey, it took Gino Smith like a decade after he left the jets to get it right.
Unbelievable. Unbelievable.
Unbelievable. Unbelievable.
I don't know. How's that going to work? I don't know. How's that one going to work? Yeah, that was a good loss for the Jets. It was. Absolutely. Yes. I don't want to win games. I don't want to win games, and I don't want the Jets benching Aaron Rodgers. He gives our team the best chance to lose.
I don't know. How's that going to work? I don't know. How's that one going to work? Yeah, that was a good loss for the Jets. It was. Absolutely. Yes. I don't want to win games. I don't want to win games, and I don't want the Jets benching Aaron Rodgers. He gives our team the best chance to lose.
Yeah, that was football.
Yeah, that was football.
that the person that they hire is going to get it right without even knowing who that person is yep i know billy billy welcome to the jet lifelong jet fan yeah i already know they're not going to get it right so that's already no so why are we excited about them losing i don't know it's a good loss i mean that's all we have i mean it's better than winning by the way billy we spend our entire time as jet fans looking towards april and may yeah that's
that the person that they hire is going to get it right without even knowing who that person is yep i know billy billy welcome to the jet lifelong jet fan yeah i already know they're not going to get it right so that's already no so why are we excited about them losing i don't know it's a good loss i mean that's all we have i mean it's better than winning by the way billy we spend our entire time as jet fans looking towards april and may yeah that's
If not, we'll be on YouTube. Excellent. You mentioned Sam Darnold. That was a great win yesterday. In his last three games, three wins, 811 passing yards, seven touchdowns, zero interceptions. Darnold, when trailing by 13-plus points in his career, was 0-25. Until yesterday. Yeah. Crazy. The NFL. I have a game for you, Billy. Okay. It's called I Can See It. I Can See It? Yes. I Can See It.
If not, we'll be on YouTube. Excellent. You mentioned Sam Darnold. That was a great win yesterday. In his last three games, three wins, 811 passing yards, seven touchdowns, zero interceptions. Darnold, when trailing by 13-plus points in his career, was 0-25. Until yesterday. Yeah. Crazy. The NFL. I have a game for you, Billy. Okay. It's called I Can See It. I Can See It? Yes. I Can See It.
How does this work? I Can See It. Well, it's a game called I Can See It. Yeah. And you only have two options. Your options are I Can See It or I Can't See It.
How does this work? I Can See It. Well, it's a game called I Can See It. Yeah. And you only have two options. Your options are I Can See It or I Can't See It.
It's called I Can See It.
It's called I Can See It.
Yes.
Yes.
I can see that.
I can see that.
Okay.
Okay.
So the name of the game is I Can See It.
So the name of the game is I Can See It.
Yeah. You were helping him out with a disclaimer. I know. I know what you're saying.
Yeah. You were helping him out with a disclaimer. I know. I know what you're saying.
I got it. I know what we're doing. I can see it. Mm-hmm. The Baltimore Ravens in the Super Bowl.
I got it. I know what we're doing. I can see it. Mm-hmm. The Baltimore Ravens in the Super Bowl.
I cannot see it.
I cannot see it.
No, I'm not going to try to help you see it. I, too, when I closed my eyes last night, Valhalla, I, too, could not see it. I was trying to see it. I wanted to see it.
No, I'm not going to try to help you see it. I, too, when I closed my eyes last night, Valhalla, I, too, could not see it. I was trying to see it. I wanted to see it.
Because I want Lamar to be in a Super Bowl, but I just couldn't get myself to seeing it. Yeah.
Because I want Lamar to be in a Super Bowl, but I just couldn't get myself to seeing it. Yeah.
So the Ravens are way off.
So the Ravens are way off.
You're looking into that thing that they use for the sight test. And you're saying the Ravens are way off in the distance.
You're looking into that thing that they use for the sight test. And you're saying the Ravens are way off in the distance.
Justin Tucker's a problem, huh?
Justin Tucker's a problem, huh?
So wait a second. You can't see them going to a Super Bowl.
So wait a second. You can't see them going to a Super Bowl.
But you can see that.
But you can see that.
So you're doing the eye test and you can't see the thing off into the distance.
So you're doing the eye test and you can't see the thing off into the distance.
You can't see that.
You can't see that.
I can't see. Oh, I can see it. No, I can't. Can you see it? I mean, they scored a lot of.
I can't see. Oh, I can see it. No, I can't. Can you see it? I mean, they scored a lot of.
Best 4-8 team in NFL history, but yes, they're bad. How are they bad? Easily. How are they bad? I don't know.
Best 4-8 team in NFL history, but yes, they're bad. How are they bad? Easily. How are they bad? I don't know.
So what you saw last night was football.
So what you saw last night was football.
Their defense is bad. Last week, I asked Chris Sims, are the Bengals going to ruin Joe Burrow's career? The Bengals don't spend money.
Their defense is bad. Last week, I asked Chris Sims, are the Bengals going to ruin Joe Burrow's career? The Bengals don't spend money.
They went to a Super Bowl.
They went to a Super Bowl.
Well-run organization, Pittsburgh Steelers. Paying Russell Wilson no money to give him that production. I mean, yeah. As opposed to the Jets, who are paying $37 million.
Well-run organization, Pittsburgh Steelers. Paying Russell Wilson no money to give him that production. I mean, yeah. As opposed to the Jets, who are paying $37 million.
It's a new game called I'm Leaning Towards. Go ahead, Mikey.
It's a new game called I'm Leaning Towards. Go ahead, Mikey.
Yes. All I said was it was very hilly. I don't know what else you heard to make you think it wasn't a great time.
Yes. All I said was it was very hilly. I don't know what else you heard to make you think it wasn't a great time.
They don't tow when meters expire, and it's only a $25 ticket.
They don't tow when meters expire, and it's only a $25 ticket.
Not to mention a lot of easy missed chip shots yesterday. There was something going on with kickers yesterday. I think Dobbins made the right call. Go ahead and take the six.
Not to mention a lot of easy missed chip shots yesterday. There was something going on with kickers yesterday. I think Dobbins made the right call. Go ahead and take the six.
God bless football, Fuentes. God bless football, you guys.
God bless football, Fuentes. God bless football, you guys.
Yeah, well, apparently his winner or loser.
Yeah, well, apparently his winner or loser.
Yeah. The Daniel Jones era in New York is likely over. He is being benched and they're going back. The Tommy Cutlets.
Yeah. The Daniel Jones era in New York is likely over. He is being benched and they're going back. The Tommy Cutlets.
The spread in that game is 12. Is this the rare like where gambling and actual football meet perfectly? And as long as you cover, you're in. Yeah, I don't know. Does 12 get it?
The spread in that game is 12. Is this the rare like where gambling and actual football meet perfectly? And as long as you cover, you're in. Yeah, I don't know. Does 12 get it?
Vegas gave them the number. Vegas gave them the number. Here, 12.
Vegas gave them the number. Vegas gave them the number. Here, 12.
Yeah, I get it. Yeah, he comes back. He's more mature now. You sent a message. Listen, quarterback, you sit down. You learn your lesson. You come back. We'll go win a few games. And they're right there in the mix.
Yeah, I get it. Yeah, he comes back. He's more mature now. You sent a message. Listen, quarterback, you sit down. You learn your lesson. You come back. We'll go win a few games. And they're right there in the mix.
Kind of a big deal. He was important. Chase Brown looked pretty good last night, though.
Kind of a big deal. He was important. Chase Brown looked pretty good last night, though.
Would you trade right now the Bengals season for the Jets season? to have all that going right, but still losing or just the dumpster fire that is.
Would you trade right now the Bengals season for the Jets season? to have all that going right, but still losing or just the dumpster fire that is.
I think it's one of those like not to go back to the Jets, but like the Jets can't beat Jacoby Brissett. And the problem is for Lamar, the Steelers just happen to be their most hated rival. Like it's just one of those. Hey, we got your number. There's nothing you can do about it.
I think it's one of those like not to go back to the Jets, but like the Jets can't beat Jacoby Brissett. And the problem is for Lamar, the Steelers just happen to be their most hated rival. Like it's just one of those. Hey, we got your number. There's nothing you can do about it.
I could hear him saying it. I heard it, but I could hear him saying it.
I could hear him saying it. I heard it, but I could hear him saying it.
I do have a loser. I have a loser.
I do have a loser. I have a loser.
There it is. Oh, I'm sorry. The fantasy football tight end position. Taysom Hill should not have the stats he had as the tight end. Agreed. He had seven carries for 138 yards and three touchdowns to go along with eight catches for 50 yards. Like, those aren't tight end numbers. Get that out of here. Like, they need to have a separate Taysom Hill category in fantasy football.
There it is. Oh, I'm sorry. The fantasy football tight end position. Taysom Hill should not have the stats he had as the tight end. Agreed. He had seven carries for 138 yards and three touchdowns to go along with eight catches for 50 yards. Like, those aren't tight end numbers. Get that out of here. Like, they need to have a separate Taysom Hill category in fantasy football.
Billy, what's your threshold there? What's your threshold where you're like, you know what? I can turn this off and go to bed. I don't need to watch the rest of this.
Billy, what's your threshold there? What's your threshold where you're like, you know what? I can turn this off and go to bed. I don't need to watch the rest of this.
I mean, he didn't do anything. How about this? You get paid per punt. You watch certain teams get their pick of the litter when it comes to punters.
I mean, he didn't do anything. How about this? You get paid per punt. You watch certain teams get their pick of the litter when it comes to punters.
I would love to go there.
I would love to go there.
A little garbage time. A little garbage time?
A little garbage time. A little garbage time?
It worked in the regular season.
It worked in the regular season.
I don't think he has to tell them. He has them so well-trained.
I don't think he has to tell them. He has them so well-trained.
Exactly right.
Exactly right.