Fuentes
Appearances
The Dan Le Batard Show with Stugotz
Local Hour: The Marlins Park Heist
So wait, the problem is that I wasn't on the schedule Monday, but I was on the show Monday. But you could have put me on the schedule Monday and then we would have just done it on Monday. But we don't have to do it today. We could just move on. I'm fine with that.
The Dan Le Batard Show with Stugotz
Local Hour: The Marlins Park Heist
I hope so. I miss her. Okay, alright.
The Dan Le Batard Show with Stugotz
Local Hour: The Marlins Park Heist
Bill, weißt du, was ich denke? Heist.
The Dan Le Batard Show with Stugotz
Local Hour: The Marlins Park Heist
We'll stuff you in a suitcase.
The Dan Le Batard Show with Stugotz
Local Hour: The Marlins Park Heist
You guys really want... Heavy-handed Sturguts.
The Dan Le Batard Show with Stugotz
Local Hour: The Marlins Park Heist
Aber tut Zucker nicht immer noch etwas in Ihrem Gehirn, wenn Sie es essen, auch wenn Sie es nicht riechen können? Bekommt man nicht einen Dopamin-Rusch oder einen Energie-Rusch daraus?
The Dan Le Batard Show with Stugotz
Local Hour: The Marlins Park Heist
Well, I mean, I disagree. Dan, when you're sick and you lose your sense of smell and taste, do you only eat like steamed broccoli every day? Like to me, it seems like you would still eat the things that bring you comfort if you're sick or if you can't taste them, even if you can't taste them.
The Dan Le Batard Show with Stugotz
Local Hour: The Marlins Park Heist
Das ist richtig. Ich denke, das ist für viele Leute wahr. Essen ist mehr als nur Geschmack. Essen ist wie mit deiner Familie zusammenkommen und ein Essen machen und es genießen. Breaking Bread. Ich weiß nicht. Es gibt viel mehr zu essen, als nur, oh, das schmeckt gut, denke ich, für viele Leute.
The Dan Le Batard Show with Stugotz
Local Hour: The Marlins Park Heist
Ich mache das. It's pretty common for productions to have food on standby for people because the people in the control room are there for like 12 hours without a break most of the time.
The Dan Le Batard Show with Stugotz
Local Hour: The Marlins Park Heist
Du bist King Levitard mit deinen off-limits Leuten, die nicht mit dir sprechen dürfen.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Billy O'Possum's
No. There were like three defenders.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Billy O'Possum's
Do you think that there's one person taking these phone calls that will be like, I remember you. I remember you. You're not getting out of this. This is definitely automated. No.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Billy O'Possum's
You work in the media. They don't want you.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Billy O'Possum's
God bless football, Fuentes.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Billy O'Possum's
You were a little worried about Spags there for a minute, weren't you?
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Billy O'Possum's
We wouldn't be able to stop it.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Billy O'Possum's
Okay. The Tampa Bay Buccaneers. Oh, man. They thought they got their offensive coordinator back, and then he snuck off and then met with his side chick again and ended up signing with Jacksonville Jaguars. They were like, oh, no, he's back, and we're going to give him this big contract. He's like, no, they got rid of the guy I don't like. I'm just going to go there.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Billy O'Possum's
I have a winner question. Next time the Chiefs call the Bills, they should just say no.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Billy O'Possum's
And if you're the Chiefs, you call every year. Oh, you got to call every year. Just to get in their head.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Billy O'Possum's
Watch them wonder who it is.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Billy O'Possum's
Is Stephon Diggs calling the Chiefs?
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Billy O'Possum's
Hold up. I can see Diggs calling the Chiefs, them going to the Super Bowl, and him saying, see, I was the missing piece the whole time.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Billy O'Possum's
I thought they had agreed to a buyout at the end of this.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Billy O'Possum's
Now Daniel Jones is making that. He should hold out. Hold out?
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Billy O'Possum's
Is Zach Ertz the one that sent you jury duty notice? Because you're a big man at Zach Ertz. You really are.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Billy O'Possum's
Thank you. Get the ball to Terry.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Billy O'Possum's
Thank you. I need a 12 yards for the parlay. Thanks. What are we doing here? All I hear is you saying Jaden Daniels is overrated.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Billy O'Possum's
But he's got to put on some weight.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Billy O'Possum's
That wasn't a stat. I have a different one.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Billy O'Possum's
Golic makes more than that about diabetes.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Billy O'Possum's
We've got a wedding to plan.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Billy O'Possum's
You're right. I'd be very upset if you did.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Billy O'Possum's
A hundred k. How much would you do it for, Stu? Two dollars, all fair.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Billy O'Possum's
Get it done in the regular season, Mahomes. Stop winning in the playoffs. Show you can do it when it doesn't count.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Billy O'Possum's
But it's starting to get stopped now. Like, teams are stopping. The... They stopped it when Josh Allen tried to run it. Like, maybe we don't need to ban it because maybe it's not as good anymore. No, they got Josh Allen twice. They did. Josh Allen is not Jalen Hurts.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Billy O'Possum's
No, Josh Allen is supposed to be better than Jalen Hurts at it because he's so much bigger.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Billy O'Possum's
They're going to cut to him and have that big Chiefs coat on.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Billy O'Possum's
That's not a terrible idea, especially in fantasy.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Billy O'Possum's
No, I'd already lost the parlay by then because Gainwell was out.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Billy O'Possum's
I feel like such a genius putting it together, and then I just feel so bad once the first leg is completely gone.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Billy O'Possum's
K-Punk's never lost a bet that he sent us.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Billy O'Possum's
He just screenshotted it and sent it. That's possible. It is such a K-Funk thing to do.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Billy O'Possum's
That's how it works. This is Michael Jordan with the Bulls and the Knicks can't win the championship. Is it because Patrick Ewing wasn't great? No, it was because Michael Jordan was there. You got to beat Mahomes. You can't do it.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Billy O'Possum's
Opossums. I think we ate there in Arizona.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Billy O'Possum's
Did they have this planned all the way back then?
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Billy O'Possum's
Do we know if it's plugged into anything? Oh, you think he brought his own from home? Just walking around with a headset. I do. I do kind of like that.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Billy O'Possum's
It's the same thing like when my kids were toddlers, I'd give them a remote with no batteries, and they'd think they were doing everything. Yeah, look, you changed the channel. Same thing with Big Dom. Here's his headset. Don't worry, we'll talk to you when we need you.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Billy O'Possum's
I have never seen a play like that where it was a trick play, but everything was based on the fact that the defense had to be tricked or it was like, oh, we give up. And the Eagles were absolutely not fooled by that play at all. But I've never seen a play without another option. That was it.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Good Loss
Yes. All I said was it was very hilly. I don't know what else you heard to make you think it wasn't a great time.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Good Loss
They don't tow when meters expire, and it's only a $25 ticket.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Good Loss
Not to mention a lot of easy missed chip shots yesterday. There was something going on with kickers yesterday. I think Dobbins made the right call. Go ahead and take the six.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Good Loss
God bless football, Fuentes. God bless football, you guys.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Good Loss
Yeah, well, apparently his winner or loser.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Good Loss
Yeah. The Daniel Jones era in New York is likely over. He is being benched and they're going back. The Tommy Cutlets.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Good Loss
The spread in that game is 12. Is this the rare like where gambling and actual football meet perfectly? And as long as you cover, you're in. Yeah, I don't know. Does 12 get it?
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Good Loss
Vegas gave them the number. Vegas gave them the number. Here, 12.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Good Loss
Yeah, I get it. Yeah, he comes back. He's more mature now. You sent a message. Listen, quarterback, you sit down. You learn your lesson. You come back. We'll go win a few games. And they're right there in the mix.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Good Loss
Kind of a big deal. He was important. Chase Brown looked pretty good last night, though.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Good Loss
Would you trade right now the Bengals season for the Jets season? to have all that going right, but still losing or just the dumpster fire that is.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Good Loss
I think it's one of those like not to go back to the Jets, but like the Jets can't beat Jacoby Brissett. And the problem is for Lamar, the Steelers just happen to be their most hated rival. Like it's just one of those. Hey, we got your number. There's nothing you can do about it.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Good Loss
I could hear him saying it. I heard it, but I could hear him saying it.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Good Loss
I do have a loser. I have a loser.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Good Loss
There it is. Oh, I'm sorry. The fantasy football tight end position. Taysom Hill should not have the stats he had as the tight end. Agreed. He had seven carries for 138 yards and three touchdowns to go along with eight catches for 50 yards. Like, those aren't tight end numbers. Get that out of here. Like, they need to have a separate Taysom Hill category in fantasy football.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Good Loss
Billy, what's your threshold there? What's your threshold where you're like, you know what? I can turn this off and go to bed. I don't need to watch the rest of this.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Good Loss
I mean, he didn't do anything. How about this? You get paid per punt. You watch certain teams get their pick of the litter when it comes to punters.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Good Loss
A little garbage time. A little garbage time?
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Good Loss
It worked in the regular season.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Good Loss
I don't think he has to tell them. He has them so well-trained.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Season Hangover
Speaking of graphics, people hated the score bug. Hated the score bug. I liked it. I really liked it. I hated it. I liked it. I liked it how simple it was and you could see through it. Yeah. But such a downgrade from other score bugs they've had.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Season Hangover
At this point, the store comes to him. Well, the store comes to the house and he picks the one he wants.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Season Hangover
They only ran the ball seven times, I think, the Chiefs in total.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Season Hangover
Don't count the Patrick Mahomes scrambling for his life.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Season Hangover
Oh, you got it? Yeah, 110 yards. I should have known better.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Season Hangover
Had my girl in it. Who's your girl? Becky G. Becky G. She's in the commercial for like a quarter of a second on the boat there.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Season Hangover
I'm with Mikey because she has enough money that she can buy the best sweet and the best everything and she'll be there. There's no way Eugene Levy is buying Little Caesars pizza.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Season Hangover
Washed, some people are saying. Some people asked that.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Season Hangover
I did think about Rose for a second, and then I quickly forgot about her.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Season Hangover
Might be hitting the road a little bit. Maybe going to Tennessee, Nashville situation.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Season Hangover
It's about projector screens. I don't get why people are obsessed with projector screens. The max quality you get is like 720. It's not a good viewing experience. And then there was like
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Season Hangover
at my uncle's house there was wi-fi issues and then like i kept stopping and then the tv outside the projector is like a full minute behind the inside like behind the inside yeah so i'm like yo i love you i'm going inside i'm not doing this outside thing anymore like i don't know what you're trying to do here i know it's nice outside we're trying to watch a game not doing this were there a lot of people outside with you
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Season Hangover
like all the old men were out there yeah like half the people didn't care about the game yeah the other half wanted to see Kendrick Lamar didn't care about the game so it was like me and like some of the kids inside like the teenagers and then the guys that were watching for gambling
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Season Hangover
but it's not any good. I can watch games in stunning 4K HD, the best possible viewing experience, then I gotta go outside to watch this hopefully 1080p on a projection that's probably diagonal because they don't know how to prop it up. The sound is absolute ass because the speaker built in is crap. It's just not a great viewing experience. Oh my God, we're outside of Florida, who cares?
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: Season Hangover
So now I'm out in the nice weather getting eaten alive by mosquitoes watching this game.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
God bless football, Billy Gill. God bless football, Mikey A. God bless football, Fuentes.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
And it doesn't matter. It goes back to Aaron Rodgers. 18 consecutive winning seasons. It doesn't matter who his quarterback is going to be next year. He's still going to go 9-8. We talk college football with Lucy next.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
I should be worried about the camera shots, but I'm not.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
Wait, so Rose, who works here at Metal Ark Media, she was at the game with you. She was. You guys are on the field after the game.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
The melee breaks out. Yes. Pepper spray starts flying.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
And Rose caught some pepper spray?
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
If she gets the right attorney, she could have years off.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
Man. Do it. They have enough of a lead. They can afford it. You mentioned Mac Jones. They left the back door open for Mac Jones, and he walked right through it. Jesus, did that hurt.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
When Billy started that sentence, did you think that the response was going to be, that's a genius thought? Are you asking me? Yes.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
Yes. Okay. I'm sorry. Did I offend you? I have a game for Lucy. I have a game for Lucy, too, but let's do your game first. Is it Lucy or Goosey? It is Lucy or Goosey, but hold on a second. Lucy, at any point, were you nervous being down on the field there? No.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
Yeah. It's all right. It's a rough one. Yeah, it is. Speaking of that was football. Michigan, Ohio State. That was football. Was it? It was.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
Yeah, of course with your friend, right?
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
You might be a bully. Yeah. Well, yeah, but Rose said she would have done the same thing.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
Oh, Jesus Christ. Billy, you would laugh at me, no? You would laugh at me. You would laugh at me, Billy.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
Do we have a poll? Can you walk off pepper spray? I mean, I don't think it's a thing. You walk off like a hamstring. You don't walk off. Blink it out? Yeah. Blink it out, right? It's better. Bill, you have a game for Lucy here? Yeah, it's not really a game.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
Uh, we don't ignore a college football here on God bless football. Lucy will join us in studio. She was at the game, the game, not Harvard Yale. She was at that one too. She was at that game, but it's not the game. The game is Michigan and Ohio state. And there was a fight afterwards and Lucy was on the field.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
All right. Are you ready for Lucy or Goosey?
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
Okay. This is. Very exciting.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
What stinks is the most exciting team in the Big 12 won't make it in.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
And so, uh, we will talk to her about that, uh, coming up the college football playoff, uh, I guess the picture is becoming clearer, although it's very confusing. What stood out for you yesterday, Billy, with the NFL? Like, was there anything besides the snow and that's football? Was there anything that stood out to you? I mean.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
Thank you, Mike Fuentes. We were just having a discussion. I believe that football in the snow looks fun. Oh, my gosh.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
They should have won that game.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
I would say this, if it does come down to Alabama or Indiana, I want Alabama in. I think Alabama's better.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
All right, a couple of quick ones here. Lucy or Goosey, if Penn State loses a close game to Oregon, they're still getting into the playoffs.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
Okay, what if they get blown out?
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
It's not this year, this year, right?
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
It's like, we got to get over seven. It took Georgia. You mentioned overtime before Georgia, Georgia tech. It took that game to remind us just how ridiculous the overtime rules are in college football.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
Can we just stay on the same side of the field?
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
Lucy or Goosey, South Carolina should make the playoff.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
All right, last one for you, Lucy. We went long here. Lucy or Goosey, Marcus Freeman will leave Notre Dame to coach the Chicago Bears. Lucy or Goosey. Billy, that's a rumor that's out there. You're making a face. It's a rumor that's actually out there. Marcus Freeman leaving Notre Dame. I don't think it's going to happen. I can't see it.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
Go for it on fourth down for crying out loud.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
Last one. Lucy or Goosey, Georgia beats Texas.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
Georgia's going to lose and still get in?
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
Wow. Book it and take it to the bank. Lucy, thank you as always.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
Lucy guarantee. More NFL coming up next.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
So there's a surprise Next Segment with the Big Board Bets that you're not going to share with us now. You're teasing it for Next Segment. Correct. It's big breaking news.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
I got my game in, Can You See It?, and so I'm good.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
Green Bay Packers make the Super Bowl.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
I can see it. Now you have the Lions and the Eagles in that same conference.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
Because we can all see it? Yeah, you can see it. Any others? I'm just surprised you can see it so clearly.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
It's snowing. No, I can't predict the weather. I could just tell you that the Packers are going to make the Super Bowl. Can you see it?
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
All right. I got a couple more. Okay, quick, quick, quick. Bill Belichick, Bears. Can you see it? I can't see it, no. I can't see it.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
Can't see it. All right. I had a tough time seeing it as well. All right. Mike Vrabel, Bears. Can you see it?
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
Mike Frabel, Ohio State. Can you see it? Oh, I can see that. I can see it. Oh, I can see that. I can see it. I can see it. Poor Ryan Day, man. If Ryan Day wins a national championship, they should still fire him.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
I can't see it. No. I can see it. I can see it. I can't. Oh, that McDonald. Can you see it? I can hear it. I can't see it.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
I have no idea. Well, it's in your hands.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
Keep the music on. Kansas City Chiefs in the Super Bowl. Can you see it? I can see it. How could you not see it?
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
Me and Mikey can see it clearly. Fuentes can see it clearly. Why wouldn't you be able to see it clearly? It doesn't matter. Billy can't see it. You have another winner?
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
So he had three missed kicks yesterday, first time in his career. He does lead the NFL with 10 missed kicks this season. And there are talks about them moving on. Crazy.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
Billy, the Ravens, five losses by a combined 22 points. Tucker has missed. Field goals and extra points. A total of 22 points. Yeah. He's the reason. All right.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
He's kicking his way out of the Hall of Fame.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
Yeah. They lost. But Carolina, what a win. They're not.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
I can see us all owing Frank Reich an apology about that.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
He didn't want to draft him also. He did not want to draft him. He was right about that one. I take my apology back. He wanted C.J. Stroud. Yes, he did want C.J. Stroud, and he's regressed. This is crazy. Wow, so we don't owe Frank Reich an apology. We have no idea. BBBs with a big announcement next. All right, wrapping it up here on God Bless Football. We have the Broncos and Browns tonight.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
That means I'll be sleeping by 8.15, 8.30. Billy. Yeah. The BBBs are coming up.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
I told you I have big news. Yes, but before... Well, I was setting you up for that. Before we get to the BBBs, your picks, and you've been on fire. Yeah. You teased some big news last segment about the BBBs.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
For years around here, it's been Billy's Big Board Bets brought to you by dot, dot, dot. And now there's no more dot, dot, dot. Poor dot, dot, dot. We're sorry you lost your sponsorship.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
Denver Broncos, AFC Championship game, Mikey. Can you see it? Can't see it. Can't see it. Fuentes can't see it? Can't see it. Can't really see it, huh?
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
Yep. Yeah. They are the ones that beat the Ravens. You're right. At home, they'll play the Ravens. Big upset. Yes. The Ravens should be getting the home game. They won't. The Broncos will get it. The Broncos will beat the Ravens. You're right. You're poor Lamar Jackson. All right, Billy. Pick number two.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
I like it. I mean, if you think Bo Nix is going to throw for that many yards, then it stands to reason that Cortland Sutton would have that many catches, I guess.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
I don't know. I'm not really excited for this game. Browns. Really? Really. Yeah. Okay. It's not the Broncos. It's the Browns.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
And here's my other one where, again, I just wish one of them was good.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
You bet the Titans, didn't you? Hell no, I didn't. You've been mad about this since yesterday. You took the Titans. No one would be this upset when they took the Titans.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
It's on you for listening to Chris.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
I am on a heater right now. Stu, you got NFL and I took Washington. So, I mean, listen to me and stop listening to Chris. It'd be crazy.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
No, Billy's right. Mikey, it took Gino Smith like a decade after he left the jets to get it right.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
I don't know. How's that going to work? I don't know. How's that one going to work? Yeah, that was a good loss for the Jets. It was. Absolutely. Yes. I don't want to win games. I don't want to win games, and I don't want the Jets benching Aaron Rodgers. He gives our team the best chance to lose.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
that the person that they hire is going to get it right without even knowing who that person is yep i know billy billy welcome to the jet lifelong jet fan yeah i already know they're not going to get it right so that's already no so why are we excited about them losing i don't know it's a good loss i mean that's all we have i mean it's better than winning by the way billy we spend our entire time as jet fans looking towards april and may yeah that's
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
If not, we'll be on YouTube. Excellent. You mentioned Sam Darnold. That was a great win yesterday. In his last three games, three wins, 811 passing yards, seven touchdowns, zero interceptions. Darnold, when trailing by 13-plus points in his career, was 0-25. Until yesterday. Yeah. Crazy. The NFL. I have a game for you, Billy. Okay. It's called I Can See It. I Can See It? Yes. I Can See It.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
How does this work? I Can See It. Well, it's a game called I Can See It. Yeah. And you only have two options. Your options are I Can See It or I Can't See It.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
So the name of the game is I Can See It.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
Yeah. You were helping him out with a disclaimer. I know. I know what you're saying.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
I got it. I know what we're doing. I can see it. Mm-hmm. The Baltimore Ravens in the Super Bowl.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
No, I'm not going to try to help you see it. I, too, when I closed my eyes last night, Valhalla, I, too, could not see it. I was trying to see it. I wanted to see it.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
Because I want Lamar to be in a Super Bowl, but I just couldn't get myself to seeing it. Yeah.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
You're looking into that thing that they use for the sight test. And you're saying the Ravens are way off in the distance.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
Justin Tucker's a problem, huh?
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
So wait a second. You can't see them going to a Super Bowl.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
So you're doing the eye test and you can't see the thing off into the distance.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
I can't see. Oh, I can see it. No, I can't. Can you see it? I mean, they scored a lot of.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
Best 4-8 team in NFL history, but yes, they're bad. How are they bad? Easily. How are they bad? I don't know.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
So what you saw last night was football.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
Their defense is bad. Last week, I asked Chris Sims, are the Bengals going to ruin Joe Burrow's career? The Bengals don't spend money.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
Well-run organization, Pittsburgh Steelers. Paying Russell Wilson no money to give him that production. I mean, yeah. As opposed to the Jets, who are paying $37 million.
The Dan Le Batard Show with Stugotz
GBF- Monday Hangover: I can see it
It's a new game called I'm Leaning Towards. Go ahead, Mikey.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Er ist der gleiche Junge. Ja. Er bricht mich als Hintergrund.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Oh, they dropped it to 59.5. He's in. He's eligible.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Du musst das tun, Forrest, weil ich dir jetzt sage, wenn du es nicht tust, werden keine unserer Kinder essen.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Oh, Mikey C. No, no, no, no, no, no, no. What if we existed in a world where both Mike Fuentes and Mikey C could be on the show? But then he'd be Mikey F also. Mikey F, Mikey C, Mikey A. I'm gonna start calling you Mikey.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
I mean, that guy almost got the one seed in the NFC with Sam Darnold. Kevin O'Connell, number two. Wow. He's a good coach, Billy. I don't know what other names are there.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
He doesn't have six better coaches on his list than Kevin O'Connell. It's impossible.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Oh, wow. He's on the hot seat, I'll tell you that much. Seven. Seven, get it done. I'm gonna put him at eight.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
If he didn't have Josh Allen, he would have been fired five years ago. Fuentes, what do you want me to respect? He hasn't made a Super Bowl with a quarterback that most coaches would make a Super Bowl with, and he fires his coordinators every year.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Once he's gone, then it's like, uh, Josh? Uh-huh. Anyway.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Let's do it this way. If Sean McDermott got fired, the first call the Bills would make would be to Kevin O'Connell. Darn right.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
We'll have news for you regarding God bless football coming up in the next week or so. So, Billy, we have one but not two blind rankings. This is very exciting. Fuentes has one and Mikey A has one. No, so then we do have two. Ja, wir haben zwei. Ich sollte nur sagen, wir haben zwei. Du hast recht. Wir haben zwei blinde Ranking. Fuentes hat einen, Mikey A. hat einen.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
So here's the deal, he's at number 9 on my list now, but if Cam Ward's good and we play this game again next year, and Fuentes is still part of the show as Mikey F. wearing a mustache, then perhaps, perhaps, if Cam Ward's good, Callaghan will be top 3. Exactly.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Wir gehen alle bei 5. Ich stelle D'Amico bei 5. Er fühlt sich bei 5 an.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Wir haben Headlines, wir haben mehr Mike Lee. Und ich frage mich, wo will Billy Gill auf unserem letzten Episode bei Metal Ark Media, wo will er zuerst?
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
I have number one and number two still left, so I'm feeling pretty good. I put Jim Harbaugh at four. Where did Billy put him?
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
It's really not a sexy name. It's a common name, Ben Johnson, but I understand what you're saying. No experience as a head coach.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
That was a thing. I buy a house in the mountains in Arizona.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Es würde sich herausstellen. Denkst du, dass der Dolphins-Head Coach hier sein wird? Denkst du, dass McDaniel hier sein wird? Denkst du, dass der Jets-Head Coach hier sein wird? Ich versuche, mit diesem Coach was zu tun.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
I'm putting Ben Johnson at 10. I have him at 8.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Das ist, was Mikey sagte. Kevin O'Connell, er sieht aus wie ein Hauptcoach. Er hat einen viel besser aussehenden Gesicht. Es gibt keine Frage darüber.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
I'm okay. I'm being forced to put him ahead of Dan Quinn and Sean McDermott, but I'm okay with that. Like it might be Daniel had Josh Allen. Forget it. Yeah, probably not. Anyway, I have no choice.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
What slots do you have left, Mike? One and four.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Yep, no doubt. All right, go ahead, Fuentes.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Gibt es einen besseren Trainer als Andy Reid, den er da rausnehmen kann?
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Ja, weil wenn es Nick Sirianni ist, möchte ich ihn als Nummer eins. Ich liebe diesen Mann. Was? Was ist mit Tomlin? Er ist großartig. Du bist verrückt. Tomlin, John Harbaugh. I'm workshopping a take about Jalen Hurts being better than Patrick Mahomes. Tease. Tease for a future show.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Ich muss sagen, dieser Bulls-Mann lebt in einem so großartigen Weltraum, in dem niemand um Tampa, um ihn, um ihn kümmert und er wird nie verabschiedet. Ich mag ihn. Ich auch. Er hat immer das gleiche Gesicht auf der Seite, egal ob die Situation. Du weißt nicht, ob er gewinnt oder verliert. Genau.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
All right. We have another blind ranking coming up, plus more Mike Lee. So I'm excited. And I think Billy and Mikey are going to embarrass me somehow. That's coming up next.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
What are we laughing at? Just you. You're in rare form today, man. I'm here, man. I'm just doing my thing. You know what it is? Football's getting close. That's what it is.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
You want to do a little training camp tour this year?
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Ich mag die Idee von Jets, Giants, Buffalo, Philadelphia, das ganze Gebiet. Ich denke, das ist ein guter Ort für uns.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
anyway the rv tour still lives on maybe one day we'll go on an rv tour yes okay blind rankings or mike more michael why don't we take an rv to the uh i think we have another blind ranking for guests here guests on the show at the lark on the draft kings network we're gonna get to that in just a second let's take an rv3 to uh to training camp why not you love camp rv3 rv3 you like that rv3 we'll call it the rv3
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
I don't know why, but we will. Blind Rankings, what are we doing here, Mikey? Fuentes has to play along here. This is great. I like this.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Explain to the audience what it is we're doing. We're blind ranking the guests in the history of this show.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Do you think if given the choice, kids graduation or record the final episode on the lark of God bless football, if they were conflicting times, do you think Kay Funk would have chosen to record with us? I mean, what do you think?
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Gojo missed the cut, huh? Yes, it will be told. All stories.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Das wird... Nitro war mehr als drei Mal. Ich meine... Ich gehe mit drei mit Nitro. Einmal fühlte es sich wie tausendmal an. Ja, es geht ein bisschen lang. Wo hast du ihn? Ich gehe mit drei. I put them at five for Nitro.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Just to remind the audience, Billy met Adam Schefter's mom on a cruise. In an elevator.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
I know. And I take her to lunch in Boynton Beach somewhere. Yeah, we gotta follow up on that.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Oh, ja. Ja, ich liebe das. Wir haben so viele Pläne. Ich meine, wir werden sie alle bekommen.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
I'm going to put him at nine. I'm going to put Matt Sims at...
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
So I thought I was I was on the driving range at Lake Tahoe thinking I was speaking to Aaron Rodgers. I was speaking to a country music singer, Jake Owen, who thanked him for being our quarterback, who really just played along, played along beautifully. He made the whole week for us at Lake Tahoe. I can't wait to go back to that place. I love it. I mean, it is.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Those are mountains, by the way, Fontes. I can't wait to go back there. I thought it was Aaron Rodgers. It wasn't. It was Jake Owen. They all made fun of me for the remainder of the weekend. It became a thing at Tahoe. Jake Owen was on the show. I'm going to put him at number one, man. What? 10 für mich. Billy, es hat für uns eine Lücke geschlossen diese Woche. Es war so wichtig, ihn anzunehmen.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Ich habe ihn wahrscheinlich zu hoch gesetzt. Dein Witz über das Verlangen von dem, wer er war, ist besser als er.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Oh, Scott Seiler. He should be number one. He was great. You do not remember him.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Seiler was on. He made pics with Kay Funk. He had a book to promote. I think he went 0-5. I don't know. I'm going to put Seiler at 7. Listen, here's what I do know, Billy. I don't want to piss off Brandon Seiler. That is true.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Hey, Billy, what did you do yesterday? I got out of the pool with Kay Funk and Brandon Seiler. Oh, ShareBear. Oh, ShareBear.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
No protection on whatsoever. Kay Funk just...
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Lacey's a two. I can't believe I put Shirley Schefter at two.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Number three for me. She was a bartender who owned an air conditioning company.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
I'm putting her at three. Yeah. Puts a smile on my face.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
This is the last Super Bowl, just a few months ago.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
It's better that way. I put the Old Spice guy at one because he made my job easy that week.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Okay, Old Spice Guy's at one. Alright, I'll put him at six.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Es ist unglaublich. Alright, so I have three slots left, right? I have one, eight, and ten. I'm doomed.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Wir hatten Spags im Studio, es war fantastisch. Ein bloßes Freundeskreis. Man, wir könnten auch mit Spags reisen.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Das ist ein fairer Punkt. Also von all den letzten Gästen, es war nicht Chris Sims, den du ausgesprochen hast, es war nicht Mike Golick, den du ausgesprochen hast, es war K-Funk.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Sie hat wahrscheinlich gesagt, ich kann nicht glauben, dass das mein Leben ist. Ich bin eine immediate Beziehungsperson für eine echte Schwester.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Du musst ihr aber Kredit geben, oder? Für das, dass sie sich in den Charakter gesinkt hat, aus Leid.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Was ist passiert? Also, die echte Schwester ist einfach geflogen? Sie wollte es nicht machen? Ja.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Right, if she just said, hey, the witch can't do it, Stanzik would have been like, okay, see you later.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Yeah, this is our kind of PR person, Billy. I'm telling you, listen, Billy and I are going to get into business, hopefully together. We're going to do some shows together moving forward. And I'm telling you, Roslyn. Person I thought was Rosalind will be running said business. Okay. Because that's the kind of person you need, Billy. Someone who's willing to do anything. Anything.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Including acting like a witch when she's not. Imagine what you do for us. It was odd. Any final thoughts here as we wrap up or anything? You got a more Mike Lee or anything?
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
We have fun doing it, though. It's a celebration of football. That's what it is. It's a celebration of the sport that all of us have fallen in love with. Just a couple more people to thank. Chris Sims, Mike Golick, who have been great to us over the four years, joined us just about every single week. Incredible. Mojo, Kay Funk, all those guys. Chris Gronkowski as well.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Ja, wir werden nie alle erwähnen. And whenever we have events in other cities, those events are packed and those events are tight and done well. So thank you to Smirnoff, man. And Mikey A. And Fuentes.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Es gibt eine Chance, dass das Show noch auf der DraftKings-Network bleibt. Das hat nichts mit DraftKings zu tun. Wir lieben sie. Sie waren tolle Partner.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Genau. Wenn Sie sich über das interessieren, werden Sie von The Lark wütend. Im Wesentlichen von Levitard und David Sampson. Auf jeden Fall. Bereit für die Headline?
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Richtig, ja. Wie tut er das? Er schaut den Film des Anfangs-Querterbacks und sagt dem QB-Koach, ich würde das nicht machen.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Es wäre sehr komfortabel, wenn Joe Flacco mein Backup-Quartier wäre. Er war unser Backup-Quartier, Mikey.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Richtig. Ich glaube, das ist, was Mikey sagt. Mit einem Anfangs-Job kommen die Erwartungen. Der Backup-Job ist immer der populärste Typ im Stadion. Er erzeugt Hoffnung. Er ist der nächste Typ.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Billy, here's a headline. Caleb Williams swears he wants to be in Chicago.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Thank you, Fuentes. A very exciting day. Billy already wants to say something. We have not one, but two blind rankings. We have headlines. We have more Mike Lee, but first we go to Billy, because Billy has something to say.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
You're saying make a mess of it like Eli did when he came out in the draft, right?
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
On the front end, probably not. He was hyped enough. He was not good enough, Mike. He was the number one or number two pick?
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Und er hatte Archie, seinen Vater, die Arbeit und die Gespräche für ihn.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Der Mist hat gekostet, Billy. Er hat zwei Superbowl gewonnen als New York Giants Quarterback und beide kamen gegen Tom Brady.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Just asking here. Just asking here. Alright, that's a good question. Mikey, do you have a headline for us?
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
I don't know. So Diggs was not at practice after this video surfaced, because Mike Rabel is the coach, Patriot Way, all that.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Ich meine, ich habe nur ein Wochenende in Foxborough verbracht. Ich würde auf einem Boot gehen. Ich würde alles tun, außer einen Tag in Foxborough verbringen. Wenn ich ganz ehrlich bin. Es ist so seltsam, dass das Stadion so weit von Boston ist.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Level one to ten, ten being the highest, like he takes no nonsense?
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Ich werde dir sagen, dass ich für Golik bei dem Lake Tahoe Golf-Tournament gekaddet habe. Ray Romano war Teil seines Dreisamens. Der andere war Mike Vrabel. Ich, Golik und Ray Romano hatten einen Blast. Lachen es auf, jucken es auf. Vrabel nicht so viel. Echt? Ein sehr seriöser Golfler.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
So at Sajo, just the way they have it laid out, they do. So for the Pro-Am, which I participate in every year and actually play golf, it's foursomes. For the actual tournament itself, they go threesomes. Three celebrities per...
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Vrabes just took he was taking the golf very, very seriously. He didn't want to be bothered. He didn't want, you know, he didn't want me asking questions. I was trying to mess around. I was doing a thing. I was going to go. It's caddy. And like he didn't he didn't want anything of it. I would say that Vrabel is he's pretty high on the no BS meter.
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Wir werden sehen, wie es geht. Okay. Letzte Episode auf MetalArk Media, aber nicht die letzte Episode. In der Tat, wir werden die Fußballspiele erweitern. Also, wenn du dich um Billy und seine Familie interessierst, dann abonniere es. Wenn du dich um Mike Yeh und seine Familie interessierst, abonniere es und rate es. Wenn du dich um Fuentes und seine Familie interessierst, dann abonniere es. Okay?
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Well, that's a nice tease, but I think it's the last show and Fuentes has a headline. And so I want to get to Mike Fuentes as well. Fuentes, do you have a headline for us?
The Dan Le Batard Show with Stugotz
GBF - Goodbye, Lark
Yeah, try a different dude. Wait, Will Levis is still in Tennessee, right? Correct. Yes. Ja, nein, nein. Will Levis ging von der meisten... Zurück zu unserer ursprünglichen Gespräche über Joe Flacco, okay? Will Levis ging von einem Jungen, den die Tennessee Titans-Fans bescheiden, zu einem Jungen, der der populärste Jungen im Haus sein wird, wenn Cam Ward schlecht spielt. Was macht er?
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
I'm itching to pick an upset. Yeah, but Aiden O'Connell, I'm not doing that. All right. But that's not it.
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
That's the problem. I don't even know who you said. I think it was the Bengals. I'll take the Bengals because I don't trust Trevor Lawrence.
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
I was going to say give me the Horsies. They're both Horsies. Give me the Broncos. I like Bo Nix.
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
Wow. Can we take a second to... If Aaron Rodgers goes to the Steelers, the combination of George Pickens, DK Metcalf, Aaron Rodgers, and then Mike Tomlin trying to wrestle it all together, that's going to be amazing. I really hope it happens, but since it has not happened yet, I will stick with Mikey.
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
Mikey, we've agreed on everything so far, right? Pretty much. I'll take the Steelers, just so Billy has to throw in his hat on this. You know what?
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
Yeah, Brock Purdy, Brandon Ayuk. Oh, George Kittle's still there, too. No, I guess it's not that bad.
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
I had said you're Bryce Young I had said you're Bryce Young I said I liked I say it is yeah give me the Panthers but hold on Fuentes as we all know is also an LA guy yeah I had said I know big LA guy I had said before this Billy Billy put me in a corner I knew it's gonna happen because I know he did it so good he did it so good I like the Panthers I know I like Bryce Young I feel like they're rising they can make a deep run but then I'm a Rams guy and I think
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
Give me the Cardinals. Really? Yeah, give me the Cardinals. Lost Ben Johnson. They lost all the coaches. All the swag is gone. The kneecap stuff's over. Kyler Murray rising. Let's go.
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
Oh, wow. I like this one more than I thought I would.
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
Yeah. It'd be funny if I gave the Dolphins an edge because Tua was next to Baker, but then I don't give Baker the same edge. Yeah, it's like, give me the Bucs.
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
I will also go with the Bears because of the offensive line additions. And Ben Johnson is now the quarterback, the head coach there. I was already a believer in Caleb Williams. And I do like the Vikings. I love Justin Jefferson. But just the J.J. McCarthy question mark is too big right now.
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
when they were out in the first round. It's a big choice from the committee. I know.
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
Yeah, that happened sometimes too. But you know what it is? In these one-off scenarios, you never know. You just never know.
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
Cowboys twice, huh? All right. Yeah, Cowboys twice, too.
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
Whoever it is, I take the Commanders. The Commanders, yeah, it's the Commanders.
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
Ah, the Commanders. Russell Wilson. Russell Wilson's not enough to get over the Commanders. Yeah, it's the Giants.
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
Unless Jameis is playing, then you never know. It's a small committee.
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
This is the game where you have the Baker swag. Tua Baker. You want to go with the offense? Give me the Bills.
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
I think that it's really great that they kept the offense together for Joe, but who's going to – They didn't get any better.
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
Exactly. Yikes. All right. I like the Bengals. I like Joe Burrow. He just has to outscore everybody, and I don't know if he can always do that.
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
You're a big Bo guy. I am, but I'm going to go with the Ravens. All right. Marjax is too good.
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
Eagles. Eagles. Wow. Yeah. Unless Michael Penix takes a jump.
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
It was a close one, but they survived. Survived in advance.
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
Give me the Bucs. Yeah, give me the Bucs. Give me the Bucs. I actually like that they kept Chris Godwin.
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
I think it's big for Baker, too. You've got to keep him with guys that he knows and can move the ball. They're going to have a better running game this year, correct?
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
matchup of the weekend a matchup of one and two pick from 2024 the number first first two picks yep yeah number two pick wins it yeah oh you think so give me the commanders with the debo samuel commanders uh i'm gonna say the bears uh yeah i mean i really believe in ben johnson i believe in ben johnson i believe in the offensive line let's do it
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
You were also a Cardinals guy. Yeah, I was part of the Bird Gang, as we all know.
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
Josh Allen can't find anybody, and he can't do it all by himself. Eventually, the Chargers win it. John Harbaugh. Is it John or Jim there?
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
Jim Harbaugh. He finds a way to power his guys through the Chargers defense. Stop Josh Allen.
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
That hurt. I'm sorry, Baker. I keep thinking about Jaden Daniels in the playoffs and how good he was. Just give me Jaden Daniels.
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
Chiefs kingdom. The AFC dominance continues. Unbelievable.
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
Commanders. Yeah, Commanders. Oh, okay. Oh, wow. They got seasoned over the year, and they're over there. A little seasoning, and boom, there you go.
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
TV production stuff. You need to not worry so much about that.
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
Yeah, yeah. Give it to the people. They want it.
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
I also think it's new time for a new champion. And after last season's disappointment, The Kansas City Chiefs raised from the fire like a phoenix. Chiefs kingdom rises. They said, we didn't get the three-peat, but we're back. And we're getting our third title in four years. Patrick Mahomes, once again, reigns supreme. Wow.
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
I get what you're saying about that, but actually it makes more sense now that I think about it because they do draft whoever at three if they're able to get one of the top two guys because I'm not, are we sure like the Titans might take a quarterback and then the Browns will take a quarterback right to the top two picks?
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
Yeah, so if Cam Ward and Shador Sanders are both gone, then the next guy is Jackson Dart. So you might – maybe they do trade back because now, like you said, the emphasis is not really there to draft a quarterback. And I feel like any quarterback taking the top five, top ten, they have to play right away. That's like how most NFL people feel about it.
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
So I think it might just be more of an insurance policy. So I'm kind of with you there, Mike, because like you said, if Russell Wilson and Jameis never see in the field, they don't really cost you much, especially for a quarterback. $14 million for two quarterbacks, drop in the bucket, the way that quarterbacks get paid these days. Drop in the bucket.
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
Well, Mike McDaniel, if Tua gets hurt again, Mike McDaniel's like, oh, well, I'm doing what I can. He wasn't there when they drafted Tua. So he has that excuse. Shane Steichen, though, he chose Anthony Richardson. He decided we're going to sign Daniel Jones. So he had to have great signing, by the way.
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
I let you get away with one. Shane Steichen.
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
I mean, he's only 23 years old, so he has at least like seven years left. I mean, he's not like going to walk out tomorrow. I think it's just more of like a football thing where we saw him at Radio Row. He looked like a guy who was going to fix your computer. He might just feel like, yeah, he just doesn't – not that he doesn't love football, but he might have other things he wants to do.
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
Yeah. He might settle into like a series of one years, you know, like 12 every year until he's like, okay, now I feel bad, you know?
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
Do you think that like Dable and Joe Shane is the other guy, right? Like I understand Joe Shane inherited Daniel Jones. I guess Dable did too. But then like Joe Shane gave Daniel Jones the extension, didn't he? Well, yes, but that's kind of like the quarterback he was in on then because he felt like, oh, this guy's enough. So I'm in on this guy. So maybe Dayball has that leash.
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
We need to lock up our guy because I got to go back and see what's available then because because I got to lock up your guy. But you're also like Daniel Jones had his best year before he won the playoff game and he duped them into giving them more money.
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
Yeah, and that is true. But I think some of it's kind of like fan service we have to look like. Because Jameis Winston is not a name you're going to take seriously as a starting quarterback. I want him on the Steelers.
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
Jameis Winston was Mike's target. I love Jameis. I'm with you. I like him more than I like Russell.
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
We keep saying that, that it's been a long time since he's been a proven number one. He had the four years in Buffalo. He had 127 receptions, 103, 108, 107 receptions. four consecutive thousand yard seasons. Like he was really good still at the Bills. He's just 31 years old coming off.
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
No. You mean number one receiver for Allen? Yeah. No. On a team.
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
Which is why he ended up one on a team. Like his worst years were actually in Minnesota. He took off, which of course is the Josh Allen effect. Right. But I mean, he still caught the ball over a thousand yards. You can't see receiver for more than a hundred receptions.
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
He's a proven commodity. By the way, that's why they got Amari Cooper, honestly. It's just because he was a name. It's like, well, nobody likes just having Shakir, right? So is Amari Cooper available? We can get him for cheap. He doesn't want to be in Cleveland anymore. Get him over here.
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
Yes, but mainly because I forgot Will Lefson's in the NFL until right now when you mentioned him. Okay. So I was already thinking Cam Ward was the quarterback of the thing.
The Dan Le Batard Show with Stugotz
GBF- So Many Upsets
I like that take. I like that take. It was going to be a push. I feel like CJ Stroud's on the decline. That's right. Tua's getting the killer instinct from Baker.
The Dan Le Batard Show with Stugotz
GBF- Grades
Yeah, but if you're already... Reassign him is fine. But if you're already calling me Fuentes, that means you're already the Mike on God Bless Football.
The Dan Le Batard Show with Stugotz
GBF- Grades
$50 million. Money and a shot. Yeah, $50 million. Money and a shot is what he's looking for.
The Dan Le Batard Show with Stugotz
GBF- Grades
I'm going to say the Rams just because I don't know, like, what is their plan after Matt Stafford? Like, are they going to go after Sam Darnold? Like, who's their guy?
The Dan Le Batard Show with Stugotz
GBF- Grades
That's what I'm saying. Like, Jimmy Garoppolo. Like, what's your deal? I just don't know who it is. Unknown. So I'm going to have to go Rams.
The Dan Le Batard Show with Stugotz
GBF- Grades
Yeah, 49ers because the division's just too stacked for the Bears.
The Dan Le Batard Show with Stugotz
GBF - Bleeding Hands Means It's a Hot One
Bad arm day. It happens.
The Dan Le Batard Show with Stugotz
GBF - Bleeding Hands Means It's a Hot One
We checked the videotape. Must have been thinking about something else. Seems like you enjoyed asking that question.
The Dan Le Batard Show with Stugotz
GBF- Hall of Hypotheticals
I mean, Taylor is the steak and Stu gots is the sizzle. I got you.
The Dan Le Batard Show with Stugotz
GBF- Hall of Hypotheticals
This is where the Jets win. This is the only time the Jets win.
The Dan Le Batard Show with Stugotz
GBF- Hall of Hypotheticals
Very close to Sue Gatz is where I stand. You guys. You guys are the worst. What do you mean we're the worst? They're the worst. Don't blame us. He was so bad this year that the Jets, despite him starting every game, won five games. And you know what? He's still their best option for next year. So he's absolutely right. You need to go away. We hate you. But stay.
The Dan Le Batard Show with Stugotz
GBF- Hall of Hypotheticals
Six quarterbacks were taken in the top 12 picks last year. That's the thing. The Jets had the 10th pick. They would have wound up with one of those six quarterbacks. And honestly, all six of them look pretty good right now. Let's see something.
The Dan Le Batard Show with Stugotz
GBF- Hall of Hypotheticals
We would have had our choice of Bo Nix or J.J. McCarthy.
The Dan Le Batard Show with Stugotz
GBF- Hall of Hypotheticals
It's not sexy. Right pick. But anyway, I want Hall of Hypotheticals. Was it really the right pick?
The Dan Le Batard Show with Stugotz
GBF- Hall of Hypotheticals
Listen, left tackle is not a position you want to need.
The Dan Le Batard Show with Stugotz
GBF- Hall of Hypotheticals
Yes, they would have taken J.J., I bet.
The Dan Le Batard Show with Stugotz
GBF- Hall of Hypotheticals
Sure. He would have been Aaron Rodgers 2.0. It would have been, we got the guy for the future. He got hurt before, you know, right as the season started. Now we have all the, yay, now we have him for real this time.
The Dan Le Batard Show with Stugotz
GBF- Hall of Hypotheticals
Of course they don't. But I'm not giving them the seventh overall pick.
The Dan Le Batard Show with Stugotz
GBF- Hall of Hypotheticals
How about a pick swap? Actually, move from, what, 26, 28, whatever the Vikings are, to seven.
The Dan Le Batard Show with Stugotz
GBF- Hall of Hypotheticals
Yeah, probably. I hope not. Really? I hope. Why get rid of Aaron Rodgers to bring in lesser Aaron Rodgers? I would just stick with Tyron. Give me Tyron for a year.
The Dan Le Batard Show with Stugotz
GBF- Hall of Hypotheticals
wouldn't hate green bay same seems like if if you're gonna go to green bay seems like this is the time of the year to do it right mikey why are you objecting to green bay it's the nfl draft at lambo field like how could it get better than that if we're gonna be in green bay i'm all for it if we're gonna be in milwaukee an hour and a half down the road just put me in nashville green bay ish
The Dan Le Batard Show with Stugotz
GBF- Hall of Hypotheticals
And we end up with Jackson Dart. After 14 years of no playoffs, I'll take the Saturday game against the Texans every year for a while.
The Dan Le Batard Show with Stugotz
GBF- Hall of Hypotheticals
Absolutely. Absolutely. Not even a question. I agree. And Cleveland. Yes.
The Dan Le Batard Show with Stugotz
GBF- Hall of Hypotheticals
And the fact that they called him Robert Goon, it makes him sound so official. Like he's not the guy that we know. He's Bobby Goons. He's not Robert Goon.
The Dan Le Batard Show with Stugotz
GBF- Hall of Hypotheticals
We went to the wrong house looking for the P&G house to interview a bunch of people, and it... How do I... Okay, there were people living in it, but they did not pay for it, and there were
The Dan Le Batard Show with Stugotz
GBF- Hall of Hypotheticals
This poor guy thinks he's getting Robert Goon and he's getting Bobby Goons. Oh, 100%.
The Dan Le Batard Show with Stugotz
GBF- Hall of Hypotheticals
boarded up windows and yeah it was a um a house for the homeless it was a squatter's house right it was a squatter's house all right uh danny b was parking in front of it going i'm pretty sure this is the address i go i don't care if this is the address this is not where we're going right yeah yeah uh did you think the guys the people that were squatting were draft prospects no they were not all right
The Dan Le Batard Show with Stugotz
GBF- Hall of Hypotheticals
Well, on that downer. Exactly. Don't sound so excited.
The Dan Le Batard Show with Stugotz
GBF- Hall of Hypotheticals
All right, more Mike Lee to pick first in the NFL draft. The Titans or the field?
The Dan Le Batard Show with Stugotz
GBF- Hall of Hypotheticals
Why do you think it's on here? Why do you think this question is on here?
The Dan Le Batard Show with Stugotz
GBF- Hall of Hypotheticals
You could also trade a few down and get Abdul Carter.
The Dan Le Batard Show with Stugotz
GBF- Hall of Hypotheticals
One guy had hops. Okay. I saw him leap over the fence.
The Dan Le Batard Show with Stugotz
GBF- Hall of Hypotheticals
All right. More Mike Lee to be a starting quarterback next season. Jameis Winston or Daniel Jones?
The Dan Le Batard Show with Stugotz
GBF- Hall of Hypotheticals
Okay, they're the starter opening week, whether you want to call it based on injury or not, but it's not like a one-week fill-in in week nine because of a hamstring.
The Dan Le Batard Show with Stugotz
GBF- Hall of Hypotheticals
Can I step in real quick and marry these two worlds real quick? Please do. Can we get Vasselli to interview on the show? Wow. Can we have Vasselli do the interview? I want to hear the questions he asks, and I want to hear how you answer them.
The Dan Le Batard Show with Stugotz
GBF- Hall of Hypotheticals
I'm going to do the same thing for that seasonal dining room attendant thing, by the way. That sounded good. I'll hire you, okay? Yeah.
The Dan Le Batard Show with Stugotz
GBF- Hall of Hypotheticals
First time. Get the whole crew in. Yeah, wow.
The Dan Le Batard Show with Stugotz
GBF - Stugotz. Is. Back!
It's been an interesting few weeks. I got to say like a bunch of new games. Mikey had some new games. Billy had some new games. This is my first new game. Still got to wait for you to come back for this one. Wow. Because you would appreciate this game has a little bit of a twist because
The Dan Le Batard Show with Stugotz
GBF - Stugotz. Is. Back!
There's one thing I know about- Yeah, well, there's one thing I know about Stu is he likes talking quarterbacks and ranking quarterbacks. I do. He loves doing that. I mean, who doesn't? Let's be honest. Exactly. Sure. We're doing a little bit of a twist on this one. It's gonna be called Blind Rankings, and we're gonna blind rank some quarterbacks coming up.
The Dan Le Batard Show with Stugotz
GBF - Stugotz. Is. Back!
And this game is presented by Smirnoff, the world's number one vodka. Please drink responsibly. Now, how it's gonna work, Stu, is we're gonna do 34 quarterbacks.
The Dan Le Batard Show with Stugotz
GBF - Stugotz. Is. Back!
all the starting quarterbacks in the league plus Cam Ward plus Aaron Rodgers but you're only going to rank 10 of them and you don't know who's coming back I mean who's coming next and here's the thing I'm going to cover this real quick so you don't see it I've already randomized the quarterbacks so that way I'm not pulling any tricks on you I'm not you know just saying good guys after you're already ranked trying to catch you in something
The Dan Le Batard Show with Stugotz
GBF - Stugotz. Is. Back!
So that's how it starts. So I'm going to name a quarterback. You rank them 1 through 10 without knowing the next quarterback in the sequence.
The Dan Le Batard Show with Stugotz
GBF - Stugotz. Is. Back!
All right. Go ahead. So remember, it's the starting – 32 starting quarterbacks plus Cam Ward because, obviously, after next week he'll be in the league. And Aaron Rodgers because we don't know where he is, but he might –
The Dan Le Batard Show with Stugotz
GBF - Stugotz. Is. Back!
in the league okay yeah okay so we're gonna start totally all these games by the way again are brought to you by smirnoff and also brought to you by the offseason yeah exactly brought to you by by by april football talk okay ready okay quarterback number one okay funny it came up this way cam ward the has been finalist from the university of miami cam ward where do you rank them one through ten blindly cam ward one through ten i'm gonna put them 10th how about that that's fine
The Dan Le Batard Show with Stugotz
GBF - Stugotz. Is. Back!
Number two. Yes. Mikey's favorite quarterback, Aaron Rodgers. Where do you rank Aaron Rodgers in the blind ranking top 10? Eighth. Mikey is jumping with eighth. A little bit above Cam Ward. Interesting.
The Dan Le Batard Show with Stugotz
GBF - Stugotz. Is. Back!
I love that Cam Ward's never played a game before. The Super Bowl champion, multiple-time MVP.
The Dan Le Batard Show with Stugotz
GBF - Stugotz. Is. Back!
In front. In front. No, Aaron Rodgers in front.
The Dan Le Batard Show with Stugotz
GBF - Stugotz. Is. Back!
Currently, no. He's in the league, just not signed.
The Dan Le Batard Show with Stugotz
GBF - Stugotz. Is. Back!
I don't know. So this is a godless football favorite. Washington Commanders quarterback, Jaden Daniels. Oh, wow. I'm guessing he's cracking the top five for both of you.
The Dan Le Batard Show with Stugotz
GBF - Stugotz. Is. Back!
Well, technically, it's going to be a sophomore slump either way, right? Unless he wins a Super Bowl.
The Dan Le Batard Show with Stugotz
GBF - Stugotz. Is. Back!
Okay. Number five. Very exciting. Detroit Lions quarterback, Jared Goff.
The Dan Le Batard Show with Stugotz
GBF - Stugotz. Is. Back!
Jared Goff, number six. Jared Goff, number six for Mikey A.
The Dan Le Batard Show with Stugotz
GBF - Stugotz. Is. Back!
Go ahead. Okay, the next one up is newly acquired Seattle Seahawks quarterback, Sam Darnold.
The Dan Le Batard Show with Stugotz
GBF - Stugotz. Is. Back!
You have Jaden Daniels at 4, Jared Goff at 5, Aaron Rodgers is 8, Cam Ward at 10. So you have 1, 2, 3, 6, 7, and 9 available.
The Dan Le Batard Show with Stugotz
GBF - Stugotz. Is. Back!
Yes, Aaron Rodgers at eight. If he hit me with a bunch of MVPs right now, I'm going to have to put one of them at ten. Well, here you go. Next one on the list, Buffalo Bills quarterback Josh Allen. Where do you rank Josh Allen? On our blind quarterbacks ranking list. Number two. Number two for Mikey A., Josh Allen.
The Dan Le Batard Show with Stugotz
GBF - Stugotz. Is. Back!
He randomized it. I'm being true to the game. I like Mr. Steinfeld at number one. I do like him because you can make an argument, Stu can, that that's the right pick no matter who comes after.
The Dan Le Batard Show with Stugotz
GBF - Stugotz. Is. Back!
No, no. I'm staying true to the list, but I like Josh Allen.
The Dan Le Batard Show with Stugotz
GBF - Stugotz. Is. Back!
Okay. I got it. The next name on our list. Chicago Bears quarterback, Caleb Williams. Do you believe? Ten. Wow. Ten. Ten. Ten.
The Dan Le Batard Show with Stugotz
GBF - Stugotz. Is. Back!
What slots do I have left? You have two, three, six, and nine. Nine for Caleb Williams. Nine for Caleb Williams. I have two, three, and six left. Okay.
The Dan Le Batard Show with Stugotz
GBF - Stugotz. Is. Back!
okay so nine for caleb williams next on the list another young struggling quarterback small in stature but showed some signs last year no bryce young bryce young oh wow wow i mean you have no choice i have no choice i still have the sixth slot left so i'm okay yep i'll put him at six yeah mikey rough bryce young currently better than jayden daniels and jericho
The Dan Le Batard Show with Stugotz
GBF - Stugotz. Is. Back!
And Aaron Rodgers, yeah. I'm winning the game. Oddly, Stu is. Oddly, Stu is. We'll see. Okay, next up on our list, newly acquired overpaid quarterback, Russell Wilson.
The Dan Le Batard Show with Stugotz
GBF - Stugotz. Is. Back!
He did. Who's my number one quarterback? Mikey's number one quarterback. Stu's number two quarterback in the league. It's really funny this worked out that way. Justin Fields.
The Dan Le Batard Show with Stugotz
GBF - Stugotz. Is. Back!
As you can see here, the list was printed out. I did make one mistake. I said Jared Goff before Sam Darnold, so I had to switch those. Either way, irrelevant. Justin Fields, Mikey A's number one quarterback.
The Dan Le Batard Show with Stugotz
GBF - Stugotz. Is. Back!
Oh, another thing I did that I see here that if you could see, Deshaun Watson made it on this list by accident, so I crossed him out because he's not going to be a starting quarterback next season.
The Dan Le Batard Show with Stugotz
GBF - Stugotz. Is. Back!
If you put him back – yeah, well, if he would have been the sixth guy, so he would have been right before Josh Allen. He would have been before Josh Allen, so he would have been Mikey Ace 10 because he would have been before Caleb Williams. So that would have worked out for Mikey. And it would have been your nine. So that would have worked out.
The Dan Le Batard Show with Stugotz
GBF - Stugotz. Is. Back!
Well, you know what it was? Mikey was so scared of Patrick Mahomes coming up that he was like, I'm going to say Josh Allen. No, honestly, I was hoping for a Joe Burrow.
The Dan Le Batard Show with Stugotz
GBF - Stugotz. Is. Back!
Yeah, Tua would have come up. So let me give you the next three quarterbacks that would have came if I would have just extended the list three more people. The next person on my list was Dak Prescott. Okay. Then you would have had Patrick Mahomes, Matt Stafford. And then would have been Drake May and Lamar Jackson after that.
The Dan Le Batard Show with Stugotz
GBF - Stugotz. Is. Back!
I'm better than that guy. Talking about the draft, I remember working up to the draft last year. He was like a projected third rounder. And then all of a sudden he shot up the boards and luckily for the commanders, they believe the hype took him and then NFC Championship.
The Dan Le Batard Show with Stugotz
GBF - Stugotz. Is. Back!
Sure, that was the only guy I was going to say that you're LeBron James 100%. Yeah, maybe Kevin Durant. I was staying in football, yeah.
The Dan Le Batard Show with Stugotz
GBF - Stugotz. Is. Back!
This episode of God Bless Football is presented by Smirnoff. We do game days. Please drink responsibly. The Smirnoff Company, New York, New York.
The Dan Le Batard Show with Stugotz
GBF - Stugotz. Is. Back!
You knew the rules. You knew the rules. Like, you know, if you want to protect against Justin Fields coming up, you got to know. You know what you did.
The Dan Le Batard Show with Stugotz
GBF - Stugotz. Is. Back!
Can't throw an interception when you're retired.
The Dan Le Batard Show with Stugotz
GBF - Stugotz. Is. Back!
Yeah, just a reminder. More Mike Lee. Just a reminder. Mikey A. ranked Justin Fields number one on his quarterbacks in the NFL. That's why I'm saying Justin Fields. He had Aaron Rodgers number nine. Aaron Rodgers number eight. Just to remind you of that.
The Dan Le Batard Show with Stugotz
GBF - Stugotz. Is. Back!
Fuentes? I'm going to say Jamar Chase because he has a guy named Joe Burrow helping him do stuff. So Juan Soto has to do it on his own. Right, that's a good point.
The Dan Le Batard Show with Stugotz
GBF - Stugotz. Is. Back!
Wait, did you say the Chiefs aren't making it to the Super Bowl?
The Dan Le Batard Show with Stugotz
GBF - Stugotz. Is. Back!
Oh, that's okay. Never mind. Yeah, that's fine. You're right. Jets-Bears last year.
The Dan Le Batard Show with Stugotz
GBF - Stugotz. Is. Back!
Yeah, I'm going to say Mike Yeh, too. I think Mike Yeh is going to be there.
The Dan Le Batard Show with Stugotz
GBF - Stugotz. Is. Back!
That's a big ask, right? Because you're asking 17 guys from the SEC to be picked.
The Dan Le Batard Show with Stugotz
GBF - Stugotz. Is. Back!
This episode of God Bless Football is brought to you by DraftKings. DraftKings, the crown is yours.
The Dan Le Batard Show with Stugotz
GBF - That's a game
I'm going to say the... Who did Fuentes say? He said the Carolina Panthers. I'm saying Bears. You're saying Bears, huh? Yeah. I'm saying Raiders.
The Dan Le Batard Show with Stugotz
GBF - That's a game
Thursday night. It's a game. Thursday night. It's a game. It's a solid. Good start to the week.
The Dan Le Batard Show with Stugotz
GBF- Ignore Chapter 7
Now he's going to tell us, oh, there's only 30 seconds left. You're really stressing me out today. I'm not cutting it off. Got to stay on time.
The Dan Le Batard Show with Stugotz
GBF- Ignore Chapter 7
Guys, 30 seconds. Oh, hurry up. There it is. Five minute warning. Better be quick, Mikey.
The Dan Le Batard Show with Stugotz
GBF- Ignore Chapter 7
So I don't know what I'm supposed to do with this 20-year-old book that is featuring defensive strategy schemes of Jerry Sandusky.
The Dan Le Batard Show with Stugotz
GBF- Dirty Diana and Deirdre Ruin Everything
And I was like, not at 17. I didn't say it was a good pick. I didn't say it was a good pick. I said, he did what he was supposed to do. He's a kicker. He kicks the field goals. It's not his fault he got drafted by Terrible. Was that Al Davis?
The Dan Le Batard Show with Stugotz
GBF- Dirty Diana and Deirdre Ruin Everything
Exactly. But that's the Raiders' fault. That's not his fault. You could have taken him like that. You know what? It's only his fault.
The Dan Le Batard Show with Stugotz
GBF- Dirty Diana and Deirdre Ruin Everything
You think the Jets were like, damn, we missed out on Janikowski? Who had a better career?
The Dan Le Batard Show with Stugotz
GBF- Dirty Diana and Deirdre Ruin Everything
I mean, that's all.
The Dan Le Batard Show with Stugotz
GBF- Dirty Diana and Deirdre Ruin Everything
I was about to say, he rode that season for years. He rode that season for years. He did his job.
The Dan Le Batard Show with Stugotz
GBF- Dirty Diana and Deirdre Ruin Everything
That's my pick. I think they'd be good enough to not get the number one pick, but that's it.
The Dan Le Batard Show with Stugotz
GBF- Dirty Diana and Deirdre Ruin Everything
I don't think Russell Wilson is a 14-loss guy yet. Alright, so I'm taking the Saints here. Who are you going with, Billy?
The Dan Le Batard Show with Stugotz
GBF- Dirty Diana and Deirdre Ruin Everything
Ich würde sagen, dass die Buckeyes die Chancen haben. Wirklich? Ja, die Buckeyes. Sie garantieren die Playoffs jedes Jahr. Sie müssen nicht durch Patrick Mahomes gehen. Oder Josh Allen oder wer auch immer sie in der Superbowl sind. Aber die Eagles sind schon durch Patrick Mahomes gegangen. Sie sind fast zweimal durchgegangen. Ja, aber sie hatten einen wunderschönen, perfekten Sturm im Gegensatz.
The Dan Le Batard Show with Stugotz
GBF- Dirty Diana and Deirdre Ruin Everything
Ich weiß nicht, ob man das jedes Jahr replizieren kann.
The Dan Le Batard Show with Stugotz
GBF- Dirty Diana and Deirdre Ruin Everything
God bless football, Fuentes. God bless football, Stugatz.
The Dan Le Batard Show with Stugotz
GBF- Dirty Diana and Deirdre Ruin Everything
The Jacksonville Jaguars released wide receiver Gabe Davis one year after signing him to a $39 million contract.
The Dan Le Batard Show with Stugotz
GBF- Dirty Diana and Deirdre Ruin Everything
He'll always have that four-touchdown game.
The Dan Le Batard Show with Stugotz
GBF- Dirty Diana and Deirdre Ruin Everything
I don't blame Gabe Davis at all. I don't blame him.
The Dan Le Batard Show with Stugotz
GBF- Dirty Diana and Deirdre Ruin Everything
He didn't do anything. That's the problem.
The Dan Le Batard Show with Stugotz
GBF- Dirty Diana and Deirdre Ruin Everything
In 10 games he had 20 catches, 239 yards, 10 touchdowns. No, 2 touchdowns, sorry. I got excited. I saw 10 there in 10 games. 10, he'd still be a Jaguar.
The Dan Le Batard Show with Stugotz
GBF- Dirty Diana and Deirdre Ruin Everything
Es ist immer noch das eine kleine Video. Ja. Das Bild. Ja. Wie lange hat das gespielt?
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
The wrong time for wide receivers to demand a trade, considering how saturated the market is with wide receivers, this free agency. I mean, Chris Godwin, Devontae Adams, Keenan Allen, Amari Cooper, Stephon Diggs, Hollywood Brown, DeAndre Hopkins, Brandon Cooks, not to mention Cooper Cup is available for trade. It's Debo Samuel's already been traded. Probably not the best time to be like, pay me.
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
Yeah, see, that's not it. I mean, that's a mocking version. But that's not...
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
Quick question. Why? Why did the Eagles do that? You just signed him to a big deal. Dude. Why? I don't get it.
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
Howie Roseman drunk on the parade float. I'm going to give you more money. You're just the best. I'm going to give you some more money.
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
What does he have to be next year to be worth that?
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
Sure. Hopefully Fuentes will join us on this one. I got one good one. We'll leave it there. More Mike Lee. to be an NFL bust, Abdul Carter or Travis Hunter?
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
So if we're doing notes here, which it looks like we are, it sounds to me like you shouldn't do it the way Stu does it, but you should do it differently than the way you are doing it.
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
I would say Abdul Carter, you can line him up and say go get the quarterback. Travis Hunter, I think a lot of it's going to depend on the coaching staff and how they want to use him. So I agree with you guys because I think Travis Hunter could be a bust. Not his fault, though. I think he could be misused.
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
No one used the word terrible but you, but okay.
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
Being a GM is all about making very hard decisions. And when they don't work out, it makes you look so bad. And Joe Shane couldn't have made worse decisions last offseason, at least by the optics of it. And... Why would anyone sign up for that? Why would anyone be like, hey, why don't you film me when I take the most beloved guy on our team and tell him he's not worth the money?
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
It was easily Saquon, because they didn't have a chance to draft Jaden. They wanted to, they called, they tried to, but it made it sound like they didn't try very hard. And his whole thing, we're going to rely on Daniel Jones, it's going to be Daniel Jones' year, only to... Just like midseason trade cut him. They didn't even trade him. They cut him like everything.
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
Every decision you made looked terrible. And we all got to see you make those decisions.
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
I couldn't disagree with you more. Really? Now, I agree with you on in-season hard knocks. In-season hard knocks is the one that's got to go. That's the one that does absolutely nothing for me. I already know how this whole thing plays out. There's no immediacy to it. Whereas during training camp, you know,
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
They play during the week, and then the following Tuesday, you get to see leading up to that week. So it's like, okay, I'm in. And the off-season one, because of how bad it went for the Giants, is like must-watch to me. To see how Joe Shane convinced himself to get rid of Saquon, only to then watch Saquon sign with Philly... That that's poetry. That's that's what I want to watch.
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
Yeah. Hard knocks kicks the crap out of new regular hard.
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
Yeah, but see, that's the problem. Old hard knocks. I mean, the name of the show was hard knocks because it was guys going to training camp, trying to fight for a roster spot. Then they, at some point around the Jets and Dolphins season, They started transitioning from those fringe guys to the stars. And you know what? Training camp ain't that hard for the stars.
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
They got – it's not – I mean, listen, I'm sure it's still a grind, and I certainly couldn't do it. But it's not like trying to make the team. And I feel like lately, hard knocks by lately, I mean the last few years – has taken to the last two weeks, let's go focus on one or two of these fringe guys and that'll be it.
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
But you used to follow him from get up for his first day at training camp until he gets cut or makes the team. Now it's like, ah, here's two episodes of fringe guys.
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
Well, Nicole Hardman was the guy who did it for the Jets, and he was traded to the Chiefs, and they beat the 49ers. So it kind of happened. Just wasn't the Jets.
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
experiment next year and I'm going to nominate Fuentes to do it. Watch none of the NFL games. Only watch Hard Knocks.
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
In season Hard Knocks you're talking about? Yeah.
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
You pick a random week. You pick a random week. You watch none of the NFL games. You don't catch the scores. You don't check your DraftKings account. And then you just watch hard knocks.
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
We don't need to make that. I just said I'm very much looking forward to see where Matt Collins ends up next year.
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
By the way, back to the hard knocks thing for a second, the Bill Belichick deciding not to do hard knocks, which I don't think you actually ever got to. That's the headline, that he's actually not doing it. Was this kind of Bill thinking that he was going to do a big F you to the NFL because they wanted him to do hard knocks for years and he refused to do it?
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
And then he leaves the NFL and in his first college years, like, yeah, sure, I'll do it. And then maybe he was like, cooler heads, cooler heads for value. Like, you know what? No, I really don't want to do it. But it was funny to watch the NFL panic when I was going to do it.
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
I'm going to zig. I'm going to zig. Okay. We'll be back.
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
The name I came up with will fit both categories.
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
So when we were discussing this, it was brought to my attention. What you should do is you just pick the big guys because you don't want to sit next to the big guy because then he's in your space and all that. But listen, I am a big guy. I'm going to be in your space. You're going to be in mine. We're just going to have a nonverbal contract. When you sit down on the plane, this is what's happening.
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
So I'm going a different route. Nick Sirianni. Because I have a feeling that Nick Sirianni is the guy that's going to complain to the stewardess about everything. The guy that's going to lean his seat all the way back when you're not supposed to. The guy when they say turn off your phones is going to be like, why do I have to turn off my phone?
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
You think my phone is going to interfere with the plane? He's just going to be a jerk. So I'm going to go Nick Sirianni.
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
He doesn't even hit the button. He just goes, hey, hey, another one here. Okay.
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
Yeah, Mike McDaniel, sure. He looks like, you know, he's an interesting guy. We could have, we can have a little taxiing conversation. Oh, you headed home? Oh, you're, oh, you're headed. Okay. And you can have that conversation. And then I feel like Mike McDaniel will put on his headphones and we won't talk the rest of the flight. And I'm okay with that.
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
To finish it in the break, what we said was top five coaches that would love Entourage.
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
And my throw in there was Pete Carroll. Pete Carroll loves Entourage. It's like the thing he does that – I think he was on Entourage.
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
Pete Carroll got the contract from the Raiders and yelled victory like Johnny Drama.
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
Yeah. If he heard me and you having a conversation across the aisle and one of us was left, he'd be like, no, I'm going to go ahead and I'm going to take this over. I'm going to come over the top and I'm going to be the funny guy. He's not this guy.
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
Headlines. Who brings us Headlines? Does somebody bring us Headlines?
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
Well, it's a ridiculous contract extension. He got three years, $106.5 million. Highest paid non-quarterback in the NFL, at least for the week. Free agency starts next week, and then we'll see. I mean, he is their entire defense, and he's kind of their identity, but does it really matter if you're not going to fix the Aiden O'Connell problem? I mean...
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
What is having Max Crosby do for you if you can't do anything offensively?
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
I hate to point out the obvious here, but when we talk about an established veteran who's available, who are we talking about?
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
Are we talking about... okay, Kirk Cousins, who was so awful last year that he got benched for Michael Penix. How about Sam Darnold? Is that the established veteran we're talking about? Or are we going to do the obvious thing and connect the dots and bring Russell Wilson back to Pete Carroll and join them up in Vegas?
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
And then you go, was Russell Wilson good or was like the Steelers defense and Mike Tomlin finding a way to win ugly games the reason that they were good?
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
Let me ask you a question. Are the Raiders... Are we spoiled with the way the quarterbacks have moved the last few years that the Raiders think it's going to happen again, only this year it's not? Like in the past few years, we saw Aaron Rodgers move teams. We saw Tom Brady move teams. We saw Matt Stafford move teams. We saw Russell Wilson move teams twice.
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
We've seen all these guys that you're like, oh man, if we had that guy, we'd be good. And then... I think it just kind of stopped this year. I don't think there's anybody coming this year that would make you go, all right, now we're over the hump.
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
What's the pitch there? You don't have to move? You don't have to hire a moving company?
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
Devontae Adams was fantastic for the Jets. They were terrible. He had some games.
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
I don't think he really cares. New regime, though. It's new regime. It's new everything.
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
Does Tom Brady bring in Tom Brady?
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
Does DK Metcalf move the needle? I mean, did he move the needle in Seattle? It's essentially the same team. It's essentially the same thing.
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
Can you have that energy? Can Billy Gill have that type of energy? Because I just don't see it.
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
And Jamar Chase wants a new contract, and he deserves to be probably the highest paid, if not top two wide receiver in football. And now you're just going to go ahead and pay his number two, $26.5 million. Yeah. You're just – like, what are you doing? You just lost Sam Hubbard, who retired unexpectedly out of nowhere. So your defense, which was –
The Dan Le Batard Show with Stugotz
GBF- One Last Boys Trip to Vegas
the worst in the league, or at least up there last year, now just lost its lone piece that was worth a damn.
The Dan Le Batard Show with Stugotz
GBF - Anonymous Sources
Everybody in the AL Central is 2-4. That's crazy.
The Dan Le Batard Show with Stugotz
GBF - Anonymous Sources
I'm wondering how many players' skill set would transfer well to flag football.
The Dan Le Batard Show with Stugotz
GBF - Anonymous Sources
Because a lot of people – please, go ahead.
The Dan Le Batard Show with Stugotz
GBF - Anonymous Sources
I asked the question to get that response.
The Dan Le Batard Show with Stugotz
GBF - Anonymous Sources
I asked the question to get exactly what I got. It worked.
The Dan Le Batard Show with Stugotz
GBF - Anonymous Sources
Yeah. But see Josh Allen to me, like that's one of the guys where it's like, you can't really run somebody over.
The Dan Le Batard Show with Stugotz
GBF - Anonymous Sources
That's why give me, I mean, Kyler Murray, Kyler Murray, Kyler Murray, Lamar Jackson, Joe Milton. Give me those guys. Yeah.
The Dan Le Batard Show with Stugotz
GBF - Anonymous Sources
You know what else I'm looking forward to? The, huh, I didn't know he was from there when I'm watching flag football. When all of a sudden you see some guy and you're like, huh, I didn't know he was German.
The Dan Le Batard Show with Stugotz
GBF - Anonymous Sources
You're going to want to listen to this one, yeah.
The Dan Le Batard Show with Stugotz
GBF - Anonymous Sources
I have no problem. I think that's a fantastic idea. Name's got to go.
The Dan Le Batard Show with Stugotz
GBF - Anonymous Sources
Yeah. I disagree because I think offensive linemen are some of the funnier guys on teams. And I think you could be missing a hell of a speech, uh, Uh, offensive linemen are kind of like lefty relievers. They're all a little bit off. You kind of have to be to do the work that they do.
The Dan Le Batard Show with Stugotz
GBF - Anonymous Sources
Now there's, there's obviously some boring ones, but I think if you've got an offensive lineman in front of a microphone for a few minutes, you'll get a, you'll get a few good chuckles.
The Dan Le Batard Show with Stugotz
GBF - Anonymous Sources
I'm going to expand it, okay? All awards. You know what you should be having? Tryouts for your speech, whether you make the broadcast or not. Oh, this person wants to win best actor, but his speech is terrible? No, get that off. Give me the guy that's going to entertain me for a few minutes. I don't care who wins. I want a good speech. So if the MVP is boring, I don't want to see that speech.
The Dan Le Batard Show with Stugotz
GBF - Anonymous Sources
Just tell me who won. That's all I care about. But if you're telling me the offensive lineman who won the Shield Award is going to be entertaining, let that guy go.
The Dan Le Batard Show with Stugotz
GBF - Anonymous Sources
I was all for the former. And then what you said makes me think I kind of want to see the latter. I mean, the former was like, because if you did the work, you should get the award. I just don't need to see your speech. Yeah, that's all I'm saying. Okay. So if you're if you if you won the best, whatever, you should get the award.
The Dan Le Batard Show with Stugotz
GBF - Anonymous Sources
But now I kind of want to see a beauty pageant type thing at some of these things.
The Dan Le Batard Show with Stugotz
GBF - Anonymous Sources
swimsuit cop i can't you see it like you know uh give me an offensive lineman and you go your quarterback was just pushed down by a defensive lineman after the play how would you resolve the situation and give him a microphone and he's got to yeah talk about you know brotherhood like that stuff okay yeah i kind of want to see that
The Dan Le Batard Show with Stugotz
GBF - Anonymous Sources
I'll go ahead and spoil it for you. You're not. But yeah, it's my favorite time of year too. Anonymous sources, rule changes. I kind of love this quote, to be honest.
The Dan Le Batard Show with Stugotz
GBF - Anonymous Sources
Spoiler, neither one is going to make the Jets look good.
The Dan Le Batard Show with Stugotz
GBF - Anonymous Sources
I it's hard to beat but I can beat it. Okay. This week, Woody Johnson said, Oh, I think Justin Fields is going to be a total winner for us. He's going to be the starter as you found out. I've been impressed with him since his college days. It was him or Trevor Lawrence. They selected Zach Wilson. They had the second pick. They didn't take him.
The Dan Le Batard Show with Stugotz
GBF - Anonymous Sources
They took Zach Wilson, but he's saying now it was him or Justin Fields. I don't know how it got Zach Wilson.
The Dan Le Batard Show with Stugotz
GBF - Anonymous Sources
cle cle cle cle cle cle cle cle cle cle cle cleketketketketketketketketketketketketketketketketketketketketketketketketacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacketketketketketketket cleket cle cleket cle cle cleket cle cle cleket cle cle cleket cle cle cleket cleac cleac cleac cleac cleac cleac cleacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniaceniacenieniket
The Dan Le Batard Show with Stugotz
GBF - Anonymous Sources
Thank you. Thank you. Thank you. Thank you.
The Dan Le Batard Show with Stugotz
GBF - Anonymous Sources
Yeah, Joe Milton was kind of one of the hot names. Everybody was trying to sort of bring him in to be their backup in hopes that some of the magic they saw, whether it be in preseason or when he was in college, they could tap that potential and sort of bring him along as a starting quarterback. And, you know, in Dallas, you're going to get work as the backup quarterback.
The Dan Le Batard Show with Stugotz
GBF - Anonymous Sources
That's just how they're built. And you have C.D. Lamb, why not?
The Dan Le Batard Show with Stugotz
GBF - Anonymous Sources
They signed okay players to good-sized deals, and I do not believe in free agency like that. If you're going to do that, go the Chargers route. Sit and wait and go for one-year contracts.
The Dan Le Batard Show with Stugotz
GBF - Anonymous Sources
Guys, neither of you. Give me another guess. Give me another guess.
The Dan Le Batard Show with Stugotz
GBF - Anonymous Sources
That was his guess. No, neither of you got it right.
The Dan Le Batard Show with Stugotz
GBF - Anonymous Sources
It was such a good game until now. I now win anonymous sources. Who was it?
The Dan Le Batard Show with Stugotz
GBF - Anonymous Sources
The answer was the Jacksonville Jaguars.
The Dan Le Batard Show with Stugotz
GBF - Anonymous Sources
The NFL makes so much money that they're not even laying off irrelevant workers anymore. You guys go ahead and do it as a backup.
The Dan Le Batard Show with Stugotz
GBF - Anonymous Sources
Yeah, then Russell Wilson took his job. Yeah, they signed him and drafted Russell Wilson in the fifth round, and Russell Wilson beat him out.
The Dan Le Batard Show with Stugotz
GBF - Anonymous Sources
Here we are. All right, Mike, you have a headline for us? Well, here's a headline. Speaking of splashing names, Cleveland Browns owner Jimmy Haslam has admitted That maybe, just maybe, they made a little bit of a mistake in signing, trading for and signing Deshaun Watson. Quote, we took a big swing and a miss with Deshaun. We thought we had a quarterback. We didn't.
The Dan Le Batard Show with Stugotz
GBF - Anonymous Sources
And we gave up a lot of draft picks to get him. So we've got to dig ourselves out of that hole. That hole is a, it's a chasm. It's a canyon. Right now, if they were to cut Deshaun Watson, it would be a $167 million dead cap hit. And it doesn't get much better next year. If they cut him next year, it's $131 million in dead cap.
The Dan Le Batard Show with Stugotz
GBF - Anonymous Sources
They went all in on a player, and it was the exact wrong player to do so. If you remember, even when the Texans were going to trade him, he was like, no, Cleveland's out. And then Cleveland's like, well, what if we gave you this? He's like, you're... You're going to give me all, okay, I'm in. I'll do that.
The Dan Le Batard Show with Stugotz
GBF - Anonymous Sources
I don't know how the Browns recover within the next two, three years from this Deshaun Watson ordeal, but it's funny to hear him say that they had a swing and a miss on a quarterback who's still on the team. I mean, he's hurt and he's probably not going to play this year, but he's still there.
The Dan Le Batard Show with Stugotz
GBF - Anonymous Sources
The crazy part about it is they did all this after that stuff came out. They knew what they were getting into. Yeah. When they traded for him, they were like, yeah, we know all about that. And they even sort of built things into his contract to be like, no, you're going to get past this. The year that he got suspended, his salary was $1 million.
The Dan Le Batard Show with Stugotz
GBF - Anonymous Sources
So that when he lost that year of salary, he lost $1 million. Whereas the rest of it is all guaranteed. Yeah.
The Dan Le Batard Show with Stugotz
GBF - Anonymous Sources
I got to tell you, though, it's nice to hear an owner take some ownership of some of his mistakes. We'll get into that in a little bit.
The Dan Le Batard Show with Stugotz
GBF - Anonymous Sources
Deshaun Watson's playing contract runs through the 2026 season, but they're going to be paying him for at least three more years after that with void years.
The Dan Le Batard Show with Stugotz
GBF - Anonymous Sources
I'm pretty sure that was a comment straight out of the what not to say about a player you're negotiating with. Yeah. That was like the absolute worst thing you could say. Like he should just be happy with what he's got. Be happy with the rate you got, basically, is what you're saying. The rate, like it's an interest rate.
The Dan Le Batard Show with Stugotz
GBF - Anonymous Sources
Why are bad teams always so bad? I mean, we're going to do the Jets thing in a little bit. That's going to be hysterical. We just talked about the Cleveland Browns and the Cincinnati Bengals. Why are these teams always so bad? Why can't they learn from some of their mistakes? But a little unfair to put the Bengals. I'm not talking about Joe Burrow. I'm not talking about Jamar.
The Dan Le Batard Show with Stugotz
GBF - Anonymous Sources
They're very talented, but the organizations themselves are – are dumpster fires most of the time.
The Dan Le Batard Show with Stugotz
GBF - Anonymous Sources
The only difference between the Jets, Browns, and Bengals is the Bengals hit on Joe Burrow. That is the only difference.
The Dan Le Batard Show with Stugotz
GBF - Anonymous Sources
It's flabbergasting to me how some organizations can run so... Yes, good word. By the way, in case you couldn't tell, I'm feeling a little sick today. I'm a little under the weather, so this is going to be my Jordan flu game. Yeah, this is... It's absolutely mind-boggling to me how some teams can run so smooth and efficiently.
The Dan Le Batard Show with Stugotz
GBF - Anonymous Sources
And whether or not they have the talent and they win every year is not the case, but... Bad teams are just going to be bad.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
Slightly older than I felt five seconds ago.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
By the way, I think I could eat the appropriate amount of McDonald's in 36 hours to get a million dollars. I could do it.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
I think I could. But Billy, there's a million dollars waiting for you at the end of the rainbow.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
He has a lawyer. That's right. Someone's going to eat this, okay, over 36 hours and not win any money because of legalities. Billy's right about this. Yes. Mr. Beast has no intention of giving this million dollars away.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
He gives away a million dollars all the time? All the time. It's crazy how much money he gives away.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
To make pics with the kid. Okay. We're back after this.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
All right. So the games that we have on the table today are more Mike Lee. You're familiar with that one.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
Love that one. Anonymous sources. You're familiar with that one.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
Okay. The final game on the table, I'm leaning towards anonymous sources right now, just so you know, because you're very excited about it.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
You're not familiar with this game, Billy. So now I'm tempted to go there first because you're not familiar. Fuentes, explain your game to Billy and see if he understands.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
Yeah, the couch show up here? I don't know.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
Wait, so Fontes, tell Billy where Mikey A had Justin Fields ranked in his quarterback rankings.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
But there's a lesson to be learned from last week's game. When you hear Josh Allen, just rank him number one.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
Yeah, we all do blind rankings. So, Billy, you decide here on the game. More Mike Lee, anonymous sources, Fuentes' blind rankings, or a bone to pick?
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
I had Josh Allen, man. Don't complain to him. I had Josh Allen.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
A.J. Brown, I'm going to rank him third on my list. Third. Third.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
I'm going to put him at six. Wow, Billy. I like that. That could work in your favor or it could embarrass you. It could be a disaster.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
I'll put Puka four. I can't believe I'm putting Puka four.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
Jesus Christ. Um... God, he's good. Underrated, in my opinion. I'm going to put... I'm hesitant to do this. Nico at five.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
I mean, Billy, I'll tell you this. I probably would put, had I not put AJ at three and Pook at four, I'd probably put Nico at three.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
I'll put Diggs at eight. Stefan digs at eight.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
God bless football, Billy Gill. God bless football, Mikey A. God bless football, Fuentes.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
I'm outraged by this. If I knew it was wide receiver ones, I would have changed my order. Yeah, I thought we had some wide receiver threes coming our way. I fully thought Berrios was coming up at some point. Malik neighbors. Neighbors at eight. Neighbors at eight. I'll put neighbors at six, I guess.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
10 oh come on that's not a number one he's not a number one that's not a number one good job saving your 10 good job watching read anyone he's better he's better than all those guys all right good job saving your 10 stugats yeah thank you thank you save my 10 for golden i have golden at nine and you seven you have now lied to us about how this game works multiple times okay mikey mikey you have matt golden where
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
DJ Moore. I will put DJ Moore at seven on my list.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
Please. According to you, Golden's going to be the rookie of the year. He might be the MVP.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
It's going to be Matt Golden or Justin Fields.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
All right, but we're outside that window right now, correct? They're late. But we're getting close.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
I'm playing well, too. You are? Yes. Mikey? I already said three.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
Yeah, but he's probably not in this game. You can make the argument.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
All right, I'll put Chase at one. Because I have no issue putting Justin in if he is in this game.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
Are we? Okay. So there's a chance that someone might deliver a couch to your house while we're on the air doing the show here.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
I got to tell you, if I was asked to rank these guys, this is the way I would probably rank them.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
No, but if you told us 32 number ones, perhaps we would have adjusted our list accordingly.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
Everybody somehow had to open. Just to be clear, we all have Ladd-McConkie being better than A.J. Brown, Puka Nakua, Nico Collins, and Malik Neighbors.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
If I could redo the entire list, I'd throw Golden off the list. Thank you for this information.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
Oh, yeah, but they're touchdowns all the time. Yes.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
Anonymous sources, and we pick a boat. Next. The debate continued during the break as to whether Matt Golden should have been included in Fuentes' list. I am with Billy. It is blasphemy. How is Matt Golden a number one wide receiver? He hasn't played a game in the NFL yet.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
What if someone said the couch is coming? No one looks forward to the couch coming. Nobody. I do. I'm looking forward to the couch. You look forward to getting the new couch and sitting in the comfortable new couch, but no one looks forward to the delivery of said couch, right?
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
I so badly want this to happen while we're on. on the air recording here. Please let it happen. Stop four right now. You're stop five. Yeah.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
Those stops are a tricky game though. I mean, sometimes, you know, some stops could take 15 minutes. Some stops could take, you know, an hour.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
Yeah. Billy, what do you want to do here? Anonymous sources, more Mike Lee, or you want to, you have a bone to pick.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
I thought you were going to clobber Fuentes for Matt Golden. I was about to say, if you guys bring up that damn game.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
I thought Michigan would have been better. That's what I said on Greg Cody's show. I had three picks in the top 12, and how were they so bad last year? That's what I said. I mean, that and I was not surprised Shador Sanders did not get selected in the first round. I didn't think he'd last until the fifth round, but I was not surprised he was not drafted in the first round, so...
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
I think a lot of media people boosted his value because they didn't want to piss off Deion Sanders. Seriously. Like, they have relationships with him, and they didn't want to upset Deion, and they probably knew he wasn't that good all along.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
On the way from where? On the way from where, though?
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
That was a quick delivery. I got to be honest.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
Billy, you want more Mike Lee? By the way, you picked your bone. It's a fair bone to pick. Bone picked. I apologize. Bone picked. I'll do better moving forward. I want to say I'll do better, but I probably won't.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
Say what? But listen, you and I both have an allegiance to Greg Cody. We love him. And so when he asked me to do something, I don't want to say no to Greg.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
OK, you're right. You're right about that. More Mike Lee or anonymous sources. Which one? Where do you want to go here, Billy? Let's do.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
I'm going to stay with Fuentes. I think it's Jackson. I think it is the obvious choice this time. And Buscelli with analytics, get the hell out of here.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
When that young GM goes to Buscelli and shows him the analytics, what do you think Buscelli says to that kid?
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
I'm going to say I like this game so much I want more.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
I love the game Anonymous Sources so much. I want to play more. I do. Billy, do we have a quick update on the couch here? What's going on there?
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
Thank you, Mikey A. Thank you, Fuentes. Sorry about that. No, you're welcome. I got my mics mixed. Listen, I got them mixed up. I'm sorry about that. We have a brand new segment that we're going to debut this week. I'm very excited for it. A bone to pick. Billy has a bone to pick. Yes, now we're going to get to that. We have a lot of things to get to. More Mike Lee. Hey, here's a headline.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
Why, Billy, do you want to go more Mike Lee? Like, I'll do whatever you want here.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
AFC. This is a tough one. AFC. It's got to be Jacksonville then, no?
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
Nico Collins. Man, fifth best wide receiver on my list.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
Wow. I'm going to say the Kansas City Chiefs.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
I love this game. I could play this game all night. Good job, Stu Goss.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
Thank you, Billy. Oh, my God. It's a great game. More Mike Lee? Like, give me one. Just give me one.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
It was the Dolphin Mall appearance that we did, and Billy gave away five books and gave away all the money in my pocket.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
Subscribe, please. Download, subscribe, rate, review, all those fun things. Do it for Billy. Do it for Mikey A. Do it for me because we own this property now.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
Right. I feel like it's been you know, I feel like it was sooner than that. Mikey and I did a couple episodes last week of some stuff.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
Mel Kiper on. We had Todd McShay on. to get people ready for the draft. But you're right. We have not been together for quite some time.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
Oh, I see. I thought we were doing headline or not a headline.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
Well, I thought that was the game. You were trying to see if I could figure out the game on the fly here. I've never played the game before. You guys invented the game while I was away, and I was trying to see if I could keep up with the game. That's all I was trying to do.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
No, I do think it happened, and I don't really think it's a newsworthy story, but I'm happy to give my thoughts on it if that's part of the game.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
But Mikey, you would agree we need to start with what's going on in Billy's house, right?
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
So your son or your daughter did something. They don't have the money to pay for it. You didn't give them permission to do it. It's going to cost you $100,000.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
I don't care. He could drink. He can go to a bar. He could serve our military. He could do whatever he wants. That should not be on dad. That should be on a 21-year-old making a bad decision. Well, a good decision, depending on how you look at it. Or a bad decision. Making a prank call that cost him $100,000. It should not cost his parents anything. Not a penny.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
So Billy, explain to the audience what is going on at your house right now.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
So, Billy, I just want to be clear here. You're blaming dad for leaving his phone just laying around the house. He's supposed to have that locked up at all times.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
That's a terrible job by this kid. I mean, seriously, dad should make the kid work and pay off the $100,000.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
Right. Yeah. But this kid graduated college, it seems like. I mean, he's already back home living with dad.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
Yeah, but dad has to pay it. Kid has to pay him back. To Billy's point, assign these chores a very low dollar amount and have them do a million of them.
The Dan Le Batard Show with Stugotz
GBF - A Bone to Pick
And I mean, the audacity of this kid to blame his dad for having a lot of contacts in his phone and leaving his phone laying around the house. Who would do that? What kind of son is this?