Ryan Reynolds
Appearances
20/20
True Crime Vault: The DNA Detective
She calls reporter Barbara Hoffroda to give one final newspaper interview pleading for answers.
20/20
True Crime Vault: The DNA Detective
amazingly the young student who lived through the trauma of losing her teacher good evening is now all grown up and a reporter covering the cold case this is the school where christy marack or miss marack as she was known to her students never showed up the day she was murdered she says her teacher's murder influenced her decision to become a reporter i think her death really did shape a lot of us in ways that we didn't even know
20/20
True Crime Vault: The DNA Detective
Well, my mouth drops open. It took you just a couple of days to find a real, serious tip.
20/20
True Crime Vault: The DNA Detective
Trying to keep his sister's case front and center, Vince leases a giant billboard next to the highway.
20/20
True Crime Vault: The DNA Detective
Flash forward, two decades after the murder, District Attorney Craig Stedman's office takes over the cold case.
20/20
True Crime Vault: The DNA Detective
Coming up, a DNA revolution allows them to stare into the face of a killer. What was it like to look at a sketch of a person who potentially raped and murdered your sister? And a break in another famous cold case would lead to a breakthrough in this one.
20/20
True Crime Vault: The DNA Detective
Across the country in California, a former actress and singer is also watching with keen interest.
20/20
True Crime Vault: The DNA Detective
Her name is Cece Moore, and she is now a genetic genealogist.
20/20
True Crime Vault: The DNA Detective
Cece helps foundlings, babies abandoned at birth, and adoptees find their biological parents.
20/20
True Crime Vault: The DNA Detective
Making family connections never thought possible. I love you like my little girl. Moore got hooked on genealogy when she researched her own family years ago. And although she didn't break the Golden State Killer case... Give it up for CeCe Moore. Her groundbreaking methods helped. She has received international recognition for her pioneering techniques.
20/20
True Crime Vault: The DNA Detective
Moore has always known that she could use her genetic genealogy skills to catch criminals, but she was reluctant.
20/20
True Crime Vault: The DNA Detective
And she is now teaming up with a company called Parabon Nanolabs, who is already familiar with the Merak cold case.
20/20
True Crime Vault: The DNA Detective
In 2017, the Lancaster District Attorney connects with Parabon Nanolabs, who are able to use an innovative technique to create a rendering of the suspect using DNA found at the crime scene. Months later, the composite is released to the public.
20/20
True Crime Vault: The DNA Detective
What was it like to look at a sketch of a person who could potentially rape and murder your sister?
20/20
True Crime Vault: The DNA Detective
Ultimately, the sketch doesn't shake loose any viable leads. But now, Parabon has their new secret weapon. Cece Moore. Could this DNA detective help catch Christy Murak's killer?
20/20
True Crime Vault: The DNA Detective
In the Merak case, there was DNA found both on the carpet and Christy's body. Cece Moore and Parabon convert that DNA into a data file and upload it to a free, no-frills genealogy website called GEDmatch, designed to find genetic relatives.
20/20
True Crime Vault: The DNA Detective
They get a hit. The DNA file matches up with several distant family members of the killer.
20/20
True Crime Vault: The DNA Detective
Cece narrows her search down to a target family in Lancaster of Northern European descent.
20/20
True Crime Vault: The DNA Detective
She also notices that the suspect has some Latin American heritage.
20/20
True Crime Vault: The DNA Detective
How long did it take you from the time you started working on this case to find that person?
20/20
True Crime Vault: The DNA Detective
Well, my mouth drops open because this is a case that went unsolved for over 25 years, and it took you just a couple of days to find a real serious tip.
20/20
True Crime Vault: The DNA Detective
Now it's up to law enforcement to confirm CeCe's findings by obtaining DNA from the possible suspect and matching it to that DNA from the crime scene.
20/20
True Crime Vault: The DNA Detective
Lancaster, Pennsylvania. A popular destination wedding location. Attracting families from surrounding states for the beautiful venues, food, and flowers. But is it also possible that one of these wedding professionals, responsible for creating people's most cherished moments, is also responsible for a brutal murder two and a half decades earlier?
20/20
True Crime Vault: The DNA Detective
An undercover unit begins to stake out the suspect, trailing him as he enters this elementary school. They sit and wait for their moment.
20/20
True Crime Vault: The DNA Detective
DNA from that water bottle and chewing gum is rushed to the crime lab. After 25 years... Police think they have their man.
20/20
True Crime Vault: The DNA Detective
When we come back, an arrest that would stun Lancaster. The alleged perpetrator had been hiding in plain sight.
20/20
True Crime Vault: The DNA Detective
On June 25th, 2018, Lancaster District Attorney Craig Stedman calls reporters together for a late afternoon press conference. But he doesn't tell them why.
20/20
True Crime Vault: The DNA Detective
Unbeknownst to reporters, hours earlier, the man police believe savagely murdered Christy Murak and eluded law enforcement for 26 years was arrested. Tell me what it was like when you got the call from the DA.
20/20
True Crime Vault: The DNA Detective
Vince immediately jumps in his car to make the two-hour drive to Lancaster for the press conference.
20/20
True Crime Vault: The DNA Detective
The man police have charged with criminal homicide is Raymond Rowe. And now, looking at that Parabon sketch created from the DNA at the crime scene, a chilling resemblance.
20/20
True Crime Vault: The DNA Detective
Most people know Raymond Rowe by a different name in this community, DJ Freeze.
20/20
True Crime Vault: The DNA Detective
DJ Freeze was many things in the Lancaster community. A renowned DJ, a business owner, a father, husband, and churchgoer. But now, a new adjective was being used to describe him. Murder suspect. He was one of the most sought after wedding DJs. This ad touts him as the best in Lancaster.
20/20
True Crime Vault: The DNA Detective
Derek Diener has filmed numerous weddings where Raymond Rowe was the DJ.
20/20
True Crime Vault: The DNA Detective
DJ Freeze has been a fixture in this city since his late teens. He started making a name for himself breakdancing, which he spoke about in this documentary.
20/20
True Crime Vault: The DNA Detective
The Chameleon Club, Lancaster's nationally renowned live music venue. In the late 1990s, he was the house DJ there. And also an advocate against violence, which now in hindsight has people's jaws dropping.
20/20
True Crime Vault: The DNA Detective
This story does not begin at a wedding, but during another time of anticipation and excitement, days before Christmas 1992.
20/20
True Crime Vault: The DNA Detective
Roe, the man accused of committing the Christmastime murder, comes across as quite the family man on this Christmas card of his own.
20/20
True Crime Vault: The DNA Detective
How is it possible this successful business and family man allegedly committed this horrific crime?
20/20
True Crime Vault: The DNA Detective
This is horrible. Christy Merak, seen here in her yearbook photo, grew up in Pennsylvania, in cold country, the middle child of a close-knit family and older sister to Vince. What was she like as a sister?
20/20
True Crime Vault: The DNA Detective
Lancaster, Pennsylvania, a city coming to grips with the realization that the man accused of the horrific rape and murder of Christy Murack has been living among them.
20/20
True Crime Vault: The DNA Detective
He had played at their weddings, their kids' elementary school parties, their high school graduation dances.
20/20
True Crime Vault: The DNA Detective
Nobody saw that coming. When you started learning more about what his life was like, what was your reaction?
20/20
True Crime Vault: The DNA Detective
The other part of this that strikes me as ironic is he spent all this time in the middle of people's celebration of the milestones of their life. And yet, if he is the person that did this, he didn't give Christy that same chance.
20/20
True Crime Vault: The DNA Detective
For that tight-knit professional wedding community, it is utter disbelief. The DJ and friend they had been working side by side with is now being charged with criminal homicide.
20/20
True Crime Vault: The DNA Detective
Emily Noble dated Raymond Rowe in 1996, four years after the murder of Christy, while they both worked at the Chameleon Club. Noble looking eerily similar to Merak.
20/20
True Crime Vault: The DNA Detective
The two shared a love of rap music. A favorite, the Sugar Hill Gang. One of the soundtracks for their courtship.
20/20
True Crime Vault: The DNA Detective
Although Emily said he wasn't violent, he became controlling and emotionally abusive.
20/20
True Crime Vault: The DNA Detective
Emily says Roe hated that she smoked and once caught her sneaking a cigarette.
20/20
True Crime Vault: The DNA Detective
Emily says during an outing at Red Lobster, celebrating Mother's Day with Ro's mother and his daughter, she showed up in an outfit that set him off.
20/20
True Crime Vault: The DNA Detective
Eventually, Emily moved away to New Mexico. And when she got the call that Roe had been arrested decades after the relationship, it gave her chills.
20/20
True Crime Vault: The DNA Detective
So was there a relationship between Christy Murack and Raymond Roe? It's a mystery everyone is trying to unwind. Do you think she knew Raymond Roe?
20/20
True Crime Vault: The DNA Detective
Investigators hope they will be able to piece together the connection before trial. But even if they can't, they are feeling extremely confident about the DNA evidence.
20/20
True Crime Vault: The DNA Detective
Roe is being held without bail. His lawyer did not return 2020's calls asking for comment. CeCe Moore says cases like this should put potential criminals on notice.
20/20
True Crime Vault: The DNA Detective
Coming up next, an emotional surprise for the victim's brother, Vince.
20/20
True Crime Vault: The DNA Detective
It's been an arduous 26-year journey for Vince Merak. That's 26 Christmases, 26 birthdays, and hundreds of other life milestones without his radiant sister by his side. No matter what happens at the trial, nothing will erase that heartbreak.
20/20
True Crime Vault: The DNA Detective
Today, Vince is getting the chance to meet that woman whose tireless determination led to the arrest in Christy's case and provided him with a small measure of relief after all these years. Cece Moore.
20/20
True Crime Vault: The DNA Detective
That's Christy on the right, next to Annie. By December of 1992, she was living in Lancaster, Pennsylvania.
20/20
True Crime Vault: The DNA Detective
And that is exactly why CeCe and Parabon will continue to use genetic genealogy on other cold cases.
20/20
True Crime Vault: The DNA Detective
Her work with Parabon has already led to breaks in 10 other cold cases, one just earlier today.
20/20
True Crime Vault: The DNA Detective
And Vince has a message for those families out there searching for those answers who may be losing faith.
20/20
True Crime Vault: The DNA Detective
Teaching sixth grade at Roristown Elementary School, Principal Harry Goodman hired her.
20/20
True Crime Vault: The DNA Detective
December 18th, Christy has dinner with her brother Vince. It would be the last time he would see her.
20/20
True Crime Vault: The DNA Detective
The evening of December 20th, Christy is at home preparing for the holiday, wrapping copies of the book Miracles on Maple Hill for each of her 24 students. She wrote a message to them.
20/20
True Crime Vault: The DNA Detective
The next morning is a chilly one with temperatures below freezing. Christy is up before sunrise.
20/20
True Crime Vault: The DNA Detective
Her roommate leaves first at 7 a.m. Christy would usually leave shortly after by 7.45. But on this morning, she did not. In the next 45 minutes, something unspeakable would happen.
20/20
True Crime Vault: The DNA Detective
Over at Christy's school, Principal Goodman gets worried when she doesn't show up to her classroom.
20/20
True Crime Vault: The DNA Detective
When he walks up, he's horrified by the scene in the living room.
20/20
True Crime Vault: The DNA Detective
Joseph Maddenspacher is the Lancaster District Attorney in 1992.
20/20
True Crime Vault: The DNA Detective
Officers begin to piece together what has just taken place. A horrific scene. Christy dead on the floor. Her head beaten. Her jaw broken. She had been raped and strangled.
20/20
True Crime Vault: The DNA Detective
It is immediately clear to investigators that Christy was in a violent struggle for her life.
20/20
True Crime Vault: The DNA Detective
In that scene of destruction, police are able to collect multiple samples of the killer's DNA. And those Christmas presents she had so meticulously wrapped the night before are now strewn about the apartment.
20/20
True Crime Vault: The DNA Detective
At Christie's school, a classroom full of students is wondering why their teacher never showed up. Assistant Superintendent Bob Wildeson is there.
20/20
True Crime Vault: The DNA Detective
When 12-year-old Christina Butler gets off the bus that afternoon, her mother is waiting to break the news.
20/20
True Crime Vault: The DNA Detective
Who would do this? Still ahead, a disturbing visit the next day from a mystery man looking for Christy at school.
20/20
True Crime Vault: The DNA Detective
Drive a few miles out of downtown Lancaster, Pennsylvania, and you will find some of the most bucolic farmland in the country.
20/20
True Crime Vault: The DNA Detective
That sense of safety is shattered by the murder of 25-year-old schoolteacher Christy Murack just four days before Christmas in 1992. Her family is now planning her funeral. I understand that a priest at one point told you not to look at her.
20/20
True Crime Vault: The DNA Detective
I understand that a priest at one point told you not to look at her.
20/20
True Crime Vault: The DNA Detective
The day after Christy Murack's murder, teachers and students are mourning.
20/20
True Crime Vault: The DNA Detective
Her principal is grief-stricken, but he's also under suspicion.
20/20
True Crime Vault: The DNA Detective
As police launch their investigation, a suspicious visitor shows up at Christy's school, carrying flowers and heading for her classroom.
20/20
True Crime Vault: The DNA Detective
The assistant superintendent escorts him from the building and calls police. The visit seems even more suspicious the next day when the man calls Wilderson at home.
20/20
True Crime Vault: The DNA Detective
The man turns out to be Christy's secret boyfriend, 20 years her senior and married.
20/20
True Crime Vault: The DNA Detective
Those close to Christy are convinced her killer must be someone she knows. She never would have opened the door to a stranger. I understand that she was a stickler for safety.
20/20
True Crime Vault: The DNA Detective
Police run the DNA found at the crime scene through the National Law Enforcement Database. but there is no match. Investigators begin reading through everyone she knows.
20/20
True Crime Vault: The DNA Detective
Ultimately, both Principal Goodman and Christy's married boyfriend provide airtight alibis and are cleared. The suspect list grows shorter and shorter.
20/20
True Crime Vault: Overboard
I was concerned the day before Thanksgiving when I haven't heard from him.
20/20
True Crime Vault: Overboard
You guys were great. Now the problem is, Skylar could never remember his lines. And his dad would yell at him on the set until the producers were basically like, get that guy out of here. He's really, he's upsetting Skylar, he's upsetting everyone else. And Skylar hated acting.
20/20
True Crime Vault: Overboard
When he got out of the Marines, he wanted to change his name to Skyler DeLeon. On the paperwork, it says he doesn't want to be associated by the same name as his father because his father is a bad person and a criminal. It was right before he met Jennifer that he changed his name.
20/20
True Crime Vault: Overboard
According to Jennifer's mother, she thinks that they got pregnant on their wedding night because the timing of it was just so. So, yeah, they had a little girl, Haley, and then they got pregnant again.
20/20
True Crime Vault: Overboard
And they're expecting it to be Skyler. And they know what Skyler looks like because he's got a record and he's in the database, but it's not Skyler.
20/20
True Crime Vault: Overboard
He grew up on a farm with a brother, Jim Hawks. They liked to go surfing. They liked to go sailing.
20/20
True Crime Vault: Overboard
Who would come up with a story that they used money laundered drug money to buy a boat unless it was really true?
20/20
True Crime Vault: Overboard
This transaction allegedly occurred in the parking lot at the 15th Street dock, basically on the trunk of the car with a suitcase full of money.
20/20
True Crime Vault: Overboard
He became a probation officer. His brother became a police officer and then later a police chief. So he came from a law enforcement family.
20/20
True Crime Vault: Overboard
How close were you guys growing up even? Very close. My parents divorced when I was probably like five. He pretty much raised me all the way to adulthood and made me who I am today.
20/20
True Crime Vault: Overboard
The biggest thing that we can do as a family was to reach out in the media and find someone maybe willing to talk, someone that maybe seen them, know of their last location, know about their safety. You know, I think something's wrong. I think something's missing. I think something's really wrong. But my first priority is to find about the whereabouts of my parents.
20/20
True Crime Vault: Overboard
The biggest thing was their car, and if we could find their car, we know we could kind of backtrace their steps or what happened to them.
20/20
True Crime Vault: Overboard
The next day, the police department gets a call from this woman who had seen the show. And she basically said, I'm looking at this car right now. I live in Mexico, and I'm in a trailer park, and it's in the parking lot.
20/20
True Crime Vault: Overboard
They had a lot of friends, 150 people at their wedding. The boys called her mom, even though their mother was still alive.
20/20
True Crime Vault: Overboard
They called me on their way up. It's like, yeah, we got it on the back of a flatbed truck. And that was a key person.
20/20
True Crime Vault: Overboard
They realized that Skyler DeLeon and Jennifer, who was also described, had been down there. They had now witnesses who knew them, and they said, they gave us this car.
20/20
True Crime Vault: Overboard
I was about 99% sure that my parents were murdered. But I still had 1% hope. But when they found that car, that 1% was wiped out.
20/20
True Crime Vault: Overboard
The baby suddenly spits up all over him, and so it interrupts the interview.
20/20
True Crime Vault: Overboard
They get Skyler out of the house and arrest him, and they go inside.
20/20
True Crime Vault: Overboard
I love how they play with the boats. The well-deserved is a 55-foot trawler. It's kind of a smaller yacht, but you can live on it.
20/20
True Crime Vault: Overboard
They put in a lot of up-to-date equipment, the GPS system, and all kinds of other stuff that really made it nice.
20/20
True Crime Vault: Overboard
And she finally says, no, we were not. in the parking lot, like I said before.
20/20
True Crime Vault: Overboard
My stepmother definitely fell hook, line, and sinker for that woman and her baby.
20/20
True Crime Vault: Overboard
Meanwhile, Skyler, he's upsetting the GPS to go out to the deepest point in the ocean. It's 3,500 feet. It's the deepest place.
20/20
True Crime Vault: Overboard
The weight of the anchor, it goes tight. And suddenly, they're being pulled across the deck. Jackie's head knocks into the side. Boom, you can hear it.
20/20
True Crime Vault: Overboard
The weight of the anchor pulls them down to the bottom of the deepest part of the sea.
20/20
True Crime Vault: Overboard
She had a chance to save herself, and she chose to stick by Skylar.
20/20
True Crime Vault: Overboard
Although her family suffers because she's loved, they'll still get a chance to see her say their last words and say their thoughts. They'll be seeing her through plexiglass. But you know, to see my parents, I have to look through 3,600 of the cold Pacific Ocean.
20/20
True Crime Vault: Overboard
I want him to know that I'm there. I want him to realize, you know, this is what he took from me and the rest of my family.
20/20
True Crime Vault: Overboard
It's a big relief. We've been waiting for this for a very long time.
20/20
True Crime Vault: Overboard
Skylar has finally, I think, become the person that she has always wanted to be.
20/20
True Crime Vault: Overboard
Skylar has finally, I think, become the person that she has always wanted to be. Schuyler is now legally a woman. She has filed court papers and she has changed her name from Schuyler Julius de Leon to Schuyler Preciosa de Leon.
20/20
True Crime Vault: Overboard
Over time, he was growing more and more effeminate looking. He asked for female underwear and a bra. And eventually, as the criminal justice system has been kind of changing with the culture, he She was allowed to start wearing those things. And she wants to be called a she.
20/20
True Crime Vault: Overboard
take advantage of the system to get some sort of benefit that they think they deserve, we are sending the wrong message.
20/20
True Crime Vault: Overboard
They went on one last trip to Catalina Island. Jim Hawks, Tom's brother, brought his boat, and they all had this little party.
20/20
True Crime Vault: Overboard
Next thing you know is no one can get a hold of them. For them just to shut off their cell phones and drop off the face of the earth is extremely out of character.
20/20
True Crime Vault: Overboard
My uncle knew something was wrong right away. Your dad didn't tie the dinghy, your dad didn't lift the motor down.
20/20
True Crime Vault: Overboard
They were excited. They thought we got a buyer. You know, we've got someone. We're going to sell this boat.
20/20
True Crime Vault: Overboard
Jennifer says, we don't know where the hawks are and we still wanted to find out where they are because we still need some information about how to use this boat that we now have. We bought the boat, they drove away. You know, we haven't heard from them and we don't know where they are either.
20/20
True Crime Vault: Overboard
Sergeant Dave Byington, he sends out a detective to go out to the boat. And so the guy gets to the boat, and he's looking around, and he sees this receipt. on the floor.
20/20
True Crime Vault: The Sinfluencer of Soho
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
20/20
True Crime Vault: The Sinfluencer of Soho
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
20/20
Death in the Dorms Season 2: Episode 2: Haley Anderson
Ryan Reynolds here from Mint Mobile with a message for everyone paying big wireless way too much. Please, for the love of everything good in this world, stop. With Mint, you can get premium wireless for just $15 a month. Of course, if you enjoy overpaying, no judgments, but that's weird. Okay, one judgment. Anyway, give it a try at mintmobile.com slash switch.
20/20
'Radioactive' - Ep. 5: The Phantom Vehicle
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
20/20
'Radioactive' - Ep. 5: The Phantom Vehicle
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
20/20
'The King Road Killings': 911 Call Released
Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what Big Wireless does. They charge you a lot. We charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right. We're cutting the price of Mint Unlimited from $30 a month to just $15 a month.
20/20
Small Town, Big Con
Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what big wireless does. They charge you a lot. We charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right. We're cutting the price of Mint Unlimited from $30 a month to just $15 a month.
20/20
Mountain of Lies
Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what big wireless does. They charge you a lot. We charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right. We're cutting the price of Mint Unlimited from $30 a month to just $15 a month.
20/20
Mountain of Lies
A Highlands ranch man already being investigated for murdering his first wife, arrested today accused of murdering his second wife.
48 Hours
Anchors Away
I couldn't pitch with my father or anyone else or Jackie with anyone else. Jackie's coming today. Got the boat all cleaned up.
48 Hours
Anchors Away
She couldn't stop crying. She was yelling at Skyler, saying, you this, you that. You took your baby daughter and your wife on our boat. How could you?
48 Hours
Anchors Away
Ich glaube, das Einzige, was mein Vater bewegen konnte, waren seine Hände. Er hat mir die Hände von Jackie gestolpert, um ihr ein bisschen Ruhigkeit zu geben.
48 Hours
Anchors Away
Er hat das Geräusch hundertmal gehört, und er hat gesagt, du Arschloch, sie werden uns nicht verlassen.
48 Hours
Anchors Away
So that's where they are right now. They're 3,600 feet below the cold Pacific Ocean, tied to an anchor.
48 Hours
Anchors Away
Ich habe zuerst meinen Vater angerufen. Dann habe ich Jackie angerufen. Und er hat nie von ihrem Telefon gesprochen. Was ging dir in den Kopf? Ich dachte, es wäre eine letzte-minütige Reise. Ich habe mit meinem Onkel Jim gesprochen. Er ist der Vertreter der Polizei Karlsbad.
48 Hours
Anchors Away
Das musste geschlossen werden. Mein Vater hat mich angerufen und gesagt, dein Vodafone ging in den E-Mail. Das ist wirklich seltsam. Mein Vater ist der Art von Mann, dem man einen Wagen anbauen kann. Ich habe meinen Bruder angerufen und gefragt, was ist denn los, Matt?
48 Hours
Anchors Away
Ich habe Schmerzen. Du würdest nicht denken, dass so etwas jemals passieren könnte.
48 Hours
Anchors Away
Es war nicht ein gutes Gefühl oder aufregend. Es war traurig, weil es alles vorbei war und meine Eltern immer noch nicht da waren. Ich werde niemals die Chance haben, sie zu töten. Ich werde niemals die Chance haben, sie zu verabschieden. Und das macht mich schmerzhaft.
48 Hours
Anchors Away
He was a man's man. He was very masculine, very outdoors. Tom's boys, Ryan and Matt.
48 Hours
Anchors Away
He would take us to Catalina Island. Do a lot of hiking. Some of my better times with him were on the water.
48 Hours
Anchors Away
You know, stay strong. I remember if I wrecked or cried as a little kid, he'd be like, toughen up, boy, toughen up, come on, come on.
48 Hours
Anchors Away
Tom war der Art Probation-Officer, der einen echten Interesse auf die Probleme hatte, die seine Probationer hatten.
48 Hours
Anchors Away
Tom war ein guter Mann. Ich glaube, dass Toms Familienleben, wie die meisten von uns, sehr wichtig war für ihn.
48 Hours
Anchors Away
Ich erinnere mich, er nennt es seinen berühmten Gulasch. Er machte einen Pott davon für etwa eine Woche. Und jedes Mal, wenn wir zum Abendessen kamen, war er so, äh, wirklich, das wieder?
48 Hours
Anchors Away
Jackie, she's a real trooper. Most of the time when they do something, it's my father's idea. And Jackie never complains and she just goes with it.
48 Hours
Anchors Away
Toms Ziel im Leben war es, auf dem Meer zu wohnen, auf einem Fahrrad zu leben. Er sagte, das Leben ist zu kurz und es ist mein Leben und das ist unser Zeitpunkt. Und ich fühle, wenn ich versuche, wird es einfach gehen und ich werde es verpassen.
48 Hours
Anchors Away
Ich würde am Arbeitstag sitzen, und ich würde E-Mails bekommen, wie, die Wasser ist 80 Grad, die Surfen pumpen, und Mama macht mich zum Abendessen. Und ich bin so, pff, das ist hart. Und da ist der Sonnenschein.
48 Hours
Anchors Away
Für sie war das Wasser eine Seltsamkeit. Es war, die Kurve der Erde zu sehen und die Sonne, die jede Nacht hinter ihr fallen würde.
48 Hours
Anchors Away
If my father would introduce my brother and I, it would be, this isn't my son, this is my pride and joy.
48 Hours
A Deadly Family Secret
I've never seen anybody with that much sadness put it aside and just hold on to her kids and be the strong one for her children.
48 Hours
Marriage Secrets
Ryan Reynolds here for, I guess, my 100th Mint commercial. No, no, no, no, no, no, no, no, no. I mean, honestly, when I started this, I thought I'd only have to do like four of these. I mean, it's unlimited premium wireless for $15 a month. How are there still people paying two or three times that much? I'm sorry, I shouldn't be victim blaming here.
48 Hours
The "Batman" Intruder
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
48 Hours
The "Batman" Intruder
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
Armchair Expert with Dax Shepard
Allison Jones (Award-Winning Casting Director)
Ryan Reynolds here for, I guess, my 100th Mint commercial. No, no, no, no, no, no, no, no, no. I mean, honestly, when I started this, I thought I'd only have to do like four of these. I mean, it's unlimited premium wireless for $15 a month. How are there still people paying two or three times that much? I'm sorry, I shouldn't be victim blaming here.
Armchair Expert with Dax Shepard
Allison Jones (Award-Winning Casting Director)
Give it a try at mintmobile.com slash switch whenever you're ready.
Candace
TRULY SICK: Ryan Reynolds Forced His 7-Year-Old Daughter To Say WHAT?! | Candace Ep 165
Thank you. Thank you.
Candace
TRULY SICK: Ryan Reynolds Forced His 7-Year-Old Daughter To Say WHAT?! | Candace Ep 165
Thank you.
Candace
TRULY SICK: Ryan Reynolds Forced His 7-Year-Old Daughter To Say WHAT?! | Candace Ep 165
Thank you. Thank you.
Candace
TRULY SICK: Ryan Reynolds Forced His 7-Year-Old Daughter To Say WHAT?! | Candace Ep 165
Guiltily, that is my daughter, Inez. I'm so sorry we had to admit that. And I am father of the year over here for allowing her to say such language, which, to her credit, she really didn't want to say, and then came back later and said, I want to say it now, when I started looking at other people to play it.
Candace
TRULY SICK: Ryan Reynolds Forced His 7-Year-Old Daughter To Say WHAT?! | Candace Ep 165
Yeah. Yeah. I'm going to pay for that later.
Candace
Judge Slaps Down Blake Lively. Colleen Hoover Returns. | Candace Ep 146
Nope, I got it. I'll get it. Here, I can do that. You're not going to read it? I will then. Okay, thank you very much. That's the one. It says, Ryan would love to have a new dad to have a catch. And I think he could really use a man in his life. Hugh is no spring chicken anymore. Blink once for yes or blink once for I'd love to be your new dad. He blinked. He blinked. Is this hell?
Candace
HYPOCRISY: Blake Lively Improvised Grabbing Her Co-Star's Private Parts | Candace Ep 170
Guiltily, that is my daughter, Inez. I'm so sorry we have to admit that. And I am father of the year over here for allowing her to say such language, which, to her credit, she really didn't want to say, and then came back later and said, I want to say it now, when I started looking at other people to play it.
Candace
HYPOCRISY: Blake Lively Improvised Grabbing Her Co-Star's Private Parts | Candace Ep 170
Yeah. Yeah. I'm going to pay for that later.
Digital Social Hour
AI's Game-Changing Role in Financial Planning | Lucas Winthrop DSH #1207
Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what Big Wireless does. They charge you a lot, we charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month.
Digital Social Hour
AI's Game-Changing Role in Financial Planning | Lucas Winthrop DSH #1207
Give it a try at mintmobile.com slash switch.
Digital Social Hour
The Truth About DEI & Why It’s Failing in America | Matt Dearden DSH #1214
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
Digital Social Hour
The Truth About DEI & Why It’s Failing in America | Matt Dearden DSH #1214
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
Digital Social Hour
From Homeless to Tequila Mogul | Metta Risdal DSH #1215
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
Digital Social Hour
From Homeless to Tequila Mogul | Metta Risdal DSH #1215
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
FloodCast
S10E07 - ¡ Ay, Dracula !
Ryan Reynolds here for, I guess, my 100th Mint commercial. No, no, no, no, no, no, no, no, no. I mean, honestly, when I started this, I thought I'd only have to do like four of these. I mean, it's unlimited premium wireless for $15 a month. How are there still people paying two or three times that much? I'm sorry, I shouldn't be victim blaming here.
FloodCast
S10E07 - ¡ Ay, Dracula !
Give it a try at mintmobile.com slash switch whenever you're ready.
FloodCast
S10E04 - Un Elephant en Pyjama
Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what big wireless does. They charge you a lot. We charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right. We're cutting the price of Mint Unlimited from $30 a month to just $15 a month.
Girls Gone Bible
A Servant’s Heart: Serving Others Like Jesus | Girls Gone Bible
Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what Big Wireless does. They charge you a lot, we charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month.
Girls Gone Bible
A Servant’s Heart: Serving Others Like Jesus | Girls Gone Bible
Give it a try at mintmobile.com slash switch.
Girls Gone Bible
A Servant’s Heart: Serving Others Like Jesus | Girls Gone Bible
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
Girls Gone Bible
A Servant’s Heart: Serving Others Like Jesus | Girls Gone Bible
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
Honestly with Bari Weiss
Trump’s Second Week: DeepSeek, DEI in the Military and . . . Baby Chickens?
Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what Big Wireless does. They charge you a lot, we charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month.
Honestly with Bari Weiss
Trump’s Second Week: DeepSeek, DEI in the Military and . . . Baby Chickens?
Give it a try at mintmobile.com slash switch.
Honestly with Bari Weiss
Sam Altman on His Feud with Elon Musk—and the Battle for AI's Future
Ryan Reynolds here for Mint Mobile. One of the perks about having four kids that you know about is actually getting a direct line to the big man up north. And this year, he wants you to know the best gift that you can give someone is the gift of Mint Mobile's unlimited wireless for $15 a month. Now, you don't even need to wrap it. Give it a try at mintmobile.com slash switch.
My Favorite Murder with Karen Kilgariff and Georgia Hardstark
Rewind with Karen & Georgia - Episode 28: I 28 His Liver With Some Fava Beans and A Nice Chianti
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
My Favorite Murder with Karen Kilgariff and Georgia Hardstark
Rewind with Karen & Georgia - Episode 28: I 28 His Liver With Some Fava Beans and A Nice Chianti
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
Not Gonna Lie with Kylie Kelce
Kylie & Chelsea Handler on Embarrassing Vegas Nights, Flip-Flop Aversions & Bikini Skiing | Ep. 12
Ryan Reynolds here from Mint Mobile with a message for everyone paying big wireless way too much. Please, for the love of everything good in this world, stop. With Mint, you can get premium wireless for just $15 a month. Of course, if you enjoy overpaying, no judgments, but that's weird. Okay, one judgment. Anyway, give it a try at mintmobile.com slash switch.
Not Gonna Lie with Kylie Kelce
Kylie & Chelsea Handler on Embarrassing Vegas Nights, Flip-Flop Aversions & Bikini Skiing | Ep. 12
Upfront payment of $45 for three-month plan, equivalent to $15 per month required. Intro rate first three months only, then full price plan options available. Taxes and fees extra. See full terms at mintmobile.com.
Not Gonna Lie with Kylie Kelce
Kylie on Marrying Into Fandom, Pop Culture Crash Course & Postpartum Lies with Amanda Hirsch | Ep. 7
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
Not Gonna Lie with Kylie Kelce
Kylie on Marrying Into Fandom, Pop Culture Crash Course & Postpartum Lies with Amanda Hirsch | Ep. 7
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
Not Gonna Lie with Kylie Kelce
Kylie & Michelle Obama on Prom at The White House, Destined Girl Dads & Roster Height Lies | Ep. 15
Ryan Reynolds here from Mint Mobile with a message for everyone paying big wireless way too much. Please, for the love of everything good in this world, stop. With Mint, you can get premium wireless for just $15 a month. Of course, if you enjoy overpaying, no judgments, but that's weird. Okay, one judgment. Anyway, give it a try at mintmobile.com slash switch.
Not Gonna Lie with Kylie Kelce
Kylie & Michelle Obama on Prom at The White House, Destined Girl Dads & Roster Height Lies | Ep. 15
Right.
Not Gonna Lie with Kylie Kelce
Kylie & Michelle Obama on Prom at The White House, Destined Girl Dads & Roster Height Lies | Ep. 15
Right.
Not Gonna Lie with Kylie Kelce
Kylie & Michelle Obama on Prom at The White House, Destined Girl Dads & Roster Height Lies | Ep. 15
Right.
Not Gonna Lie with Kylie Kelce
Kylie on Crazy Eagles Superstitions, TikTok Eulogy & Surrogacy Journey with Erin Andrews | Ep. 6
Hey there, Ryan Reynolds here. It's a new year, and you know what that means. No, not the diet. Resolutions. A way for us all to try and do a little bit better than we did last year. And my resolution, unlike Big Wireless, is to not be a raging a**hole. and raise the price of wireless on you every chance I get. Give it a try at mintmobile.com slash switch.
Not Gonna Lie with Kylie Kelce
Kylie on Crazy Eagles Superstitions, TikTok Eulogy & Surrogacy Journey with Erin Andrews | Ep. 6
$45 upfront payment required, equivalent to $15 per month. New customers on first three-month plan only. Taxes and fees extra. Speeds lower above 40 gigabytes on unlimited. See mintmobile.com for details.
Not Gonna Lie with Kylie Kelce
Kylie on Crazy Eagles Superstitions, TikTok Eulogy & Surrogacy Journey with Erin Andrews | Ep. 6
What? IndieClub? We all fam. I don't...
Not Gonna Lie with Kylie Kelce
Kylie & Kat Dennings on Irish Dancing in Bars, Stage Name Origins & Kelce Cat Game Plan | Ep. 14
Ryan Reynolds here from Mint Mobile with a message for everyone paying big wireless way too much. Please, for the love of everything good in this world, stop. With Mint, you can get premium wireless for just $15 a month. Of course, if you enjoy overpaying, no judgments, but that's weird. Okay, one judgment. Anyway, give it a try at mintmobile.com slash switch.
Not Gonna Lie with Kylie Kelce
Kylie & Kat Dennings on Irish Dancing in Bars, Stage Name Origins & Kelce Cat Game Plan | Ep. 14
And
Not Gonna Lie with Kylie Kelce
Kylie on How to Talk to Pregnant Women, USWNT Legacy & Retirement Surprise with Alex Morgan | Ep. 5
Upfront payment of $45 for three-month plan, equivalent to $15 per month required. Intro rate first three months only, then full price plan options available. Taxes and fees extra. See full terms at mintmobile.com. I'm not going to lie.
Not Gonna Lie with Kylie Kelce
Kylie & Kate Hudson on Makeup in the Delivery Room, Red Carpet Run-Ins & RomCom Queendom | Ep. 13
Ryan Reynolds here for Mint Mobile. I don't know if you knew this, but anyone can get the same premium wireless for $15 a month plan that I've been enjoying. It's not just for celebrities. So do like I did and have one of your assistant's assistants switch you to Mint Mobile today. I'm told it's super easy to do at mintmobile.com slash switch.
Not Gonna Lie with Kylie Kelce
Kylie on Inevitable Minivan Future, Online Clapbacks & Body Neutrality with Drew Afualo | Ep. 4
Ryan Reynolds here from Mint Mobile with a message for everyone paying big wireless way too much. Please, for the love of everything good in this world, stop. With Mint, you can get premium wireless for just $15 a month. Of course, if you enjoy overpaying, no judgments, but that's weird. Okay, one judgment. Anyway, give it a try at mintmobile.com slash switch.
Not Gonna Lie with Kylie Kelce
Kylie on Inevitable Minivan Future, Online Clapbacks & Body Neutrality with Drew Afualo | Ep. 4
Yeah.
Not Gonna Lie with Kylie Kelce
Kylie & Jason on Love Languages, Dating Red Flags & Valentine’s Day at the Eagles Parade | Ep. 10
Ryan Reynolds here for Mint Mobile. I don't know if you knew this, but anyone can get the same premium wireless for $15 a month plan that I've been enjoying. Not going to lie.
PBD Podcast
Fani Willis DISQUALIFIED, President Elon Musk, Luigi Mangione Indicted | PBD Podcast | Ep. 523
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f**k are you talking about, you insane Hollywood a**hole?
PBD Podcast
Fani Willis DISQUALIFIED, President Elon Musk, Luigi Mangione Indicted | PBD Podcast | Ep. 523
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com.
Radioactive: The Karen Silkwood Mystery
Ep. 5: The Phantom Vehicle
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
Radioactive: The Karen Silkwood Mystery
Ep. 5: The Phantom Vehicle
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
Sean Carroll's Mindscape: Science, Society, Philosophy, Culture, Arts, and Ideas
288 | Max Richter on the Meaning of Classical Music Today
Ryan Reynolds here from Mint Mobile. With the price of just about everything going up during inflation, we thought we'd bring our prices down. So to help us, we brought in a reverse auctioneer, which is apparently a thing. Give it a try at mintmobile.com slash switch.
Sean Carroll's Mindscape: Science, Society, Philosophy, Culture, Arts, and Ideas
AMA | October 2024
Ryan Reynolds here from Mint Mobile. With the price of just about everything going up during inflation, we thought we'd bring our prices down. So to help us, we brought in a reverse auctioneer, which is apparently a thing.
Small Town Murder
#552 - Too Many Dead Neighbors - Kerby, Oregon
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
Small Town Murder
#552 - Too Many Dead Neighbors - Kerby, Oregon
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
SmartLess
"Ariana Grande"
Ryan Reynolds here from Mint Mobile. I don't know if you knew this, but anyone can get the same premium wireless for $15 a month plan that I've been enjoying. It's not just for celebrities. So do like I did and have one of your assistant's assistants switch you to Mint Mobile today. I'm told it's super easy to do at mintmobile.com slash switch.
Something Was Wrong
S22 E9: How Dare You
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
Something Was Wrong
S22 E9: How Dare You
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
The Commercial Break
12 Days of TCB: Don't Stare At The Red Rocket
Ryan Reynolds here for Mint Mobile. One of the perks about having four kids that you know about is actually getting a direct line to the big man up north. And this year, he wants you to know the best gift that you can give someone is the gift of Mint Mobile's unlimited wireless for $15 a month. Now, you don't even need to wrap it. Give it a try at mintmobile.com slash switch.
The Jordan B. Peterson Podcast
The Birth of Christ | Biblical Series: The Gospels
Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what Big Wireless does. They charge you a lot, we charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month.
The Jordan B. Peterson Podcast
The Birth of Christ | Biblical Series: The Gospels
Upfront payment of $45 for three-month plan, equivalent to $15 per month required. Intro rate first three months only, then full price plan options available. Taxes and fees extra. See full terms at mintmobile.com.
The Jordan B. Peterson Podcast
The Birth of Christ | Biblical Series: The Gospels
Give it a try at mintmobile.com slash switch.
The Jordan B. Peterson Podcast
The Birth of Christ | Biblical Series: The Gospels
$45 upfront payment equivalent to $15 per month. New customers on first three-month plan only. Taxes and fees extra. Speeds lower above 40 gigabytes. See details.
The Jordan B. Peterson Podcast
The Birth of Christ | Biblical Series: The Gospels
Ryan Reynolds here from Mint Mobile. I don't know if you knew this, but anyone can get the same premium wireless for $15 a month plan that I've been enjoying. It's not just for celebrities. So do like I did and have one of your assistant's assistants switch you to Mint Mobile today. I'm told it's super easy to do at mintmobile.com slash switch.
The MeidasTouch Podcast
WOW! France DESTROYS Trump with MILITARY RESPONSE
Ryan Reynolds here from Mint Mobile. I don't know if you knew this, but anyone can get the same premium wireless for $15 a month plan that I've been enjoying. It's not just for celebrities. So do like I did and have one of your assistant's assistants switch you to Mint Mobile today. I'm told it's super easy to do at mintmobile.com slash switch.
The MeidasTouch Podcast
WOW! France DESTROYS Trump with MILITARY RESPONSE
Upfront payment of $45 for three month plan, equivalent to $15 per month required. Intro rate first three months only, then full price plan options available. Taxes and fees extra. See full terms at mintmobile.com.
The MeidasTouch Podcast
Zelenskyy Puts the Screws into Trump… from Kyiv!
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
The MeidasTouch Podcast
Zelenskyy Puts the Screws into Trump… from Kyiv!
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
Trump Gets HUMILIATED by WORST Inauguration Ratings
Hey there, Ryan Reynolds here. It's a new year and you know what that means. No, not the diet. Resolutions. A way for us all to try and do a little bit better than we did last year. And my resolution, unlike big wireless, is to not be a raging a**hole and raise the price of wireless on you every chance I get. Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
Trump has DISASTROUS Day 1 in Oval Office FIRST 24 HOURS
Hey there, Ryan Reynolds here. It's a new year and you know what that means. No, not the diet. Resolutions. A way for us all to try and do a little bit better than we did last year. And my resolution, unlike big wireless, is to not be a raging a**hole and raise the price of wireless on you every chance I get. Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
Democratic Congressman Neguse on GOP Disaster CR
Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what big wireless does. They charge you a lot. We charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right. We're cutting the price of Mint Unlimited from $30 a month to just $15 a month.
The MeidasTouch Podcast
Democratic Congressman Neguse on GOP Disaster CR
Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
Trumpers Get RUDE AWAKENING as they LOSE EVERYTHING
Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what Big Wireless does. They charge you a lot, we charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month.
The MeidasTouch Podcast
Trumpers Get RUDE AWAKENING as they LOSE EVERYTHING
Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
MeidasTouch RESPONDS to BREAKING NEWS on Day 1 - 1/20/25
Ryan Reynolds here from Mint Mobile, with a message for everyone paying big wireless way too much. Please, for the love of everything good in this world, stop. With Mint, you can get premium wireless for just $15 a month. Of course, if you enjoy overpaying, no judgments, but that's weird. Okay, one judgment. Anyway, give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
MeidasTouch RESPONDS to BREAKING NEWS on Day 1 - 1/20/25
Boy, is that striking.
The MeidasTouch Podcast
Judge SLAPS Trump DOWN on Immunity + MORE
Ryan Reynolds here for Mint Mobile. You know, one of the perks about having four kids that you know about is actually getting a direct line to the big man up north. And this year, he wants you to know the best gift that you can give someone is the gift of Mint Mobile's unlimited wireless for $15 a month. Now, you don't even need to wrap it. Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
Trump THROWS Elon UNDER THE BUS for DISASTER
Ryan Reynolds here from Mint Mobile with a message for everyone paying big wireless way too much. Please, for the love of everything good in this world, stop. With Mint, you can get premium wireless for just $15 a month. Of course, if you enjoy overpaying, no judgments, but that's weird. Okay, one judgment. Anyway, give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
Congressman Jake Auchincloss on GOP Blunders
Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what big wireless does. They charge you a lot. We charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right. We're cutting the price of Mint Unlimited from $30 a month to just $15 a month.
The MeidasTouch Podcast
Congressman Jake Auchincloss on GOP Blunders
Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
Trump Throws Tantrum as Bad News Grows
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
The MeidasTouch Podcast
Trump Throws Tantrum as Bad News Grows
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
Trump’s First Cabinet Meeting Plunges Into Disaster
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
The MeidasTouch Podcast
Trump’s First Cabinet Meeting Plunges Into Disaster
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
Canada Leaders Issues FINAL URGENT WARNING to Trump
Hey there, Ryan Reynolds here. It's a new year and you know what that means. No, not the diet. Resolutions. A way for us all to try and do a little bit better than we did last year. And my resolution, unlike big wireless, is to not be a raging a**hole and raise the price of wireless on you every chance I get. Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
Canada Leaders Issues FINAL URGENT WARNING to Trump
$45 upfront payment required equivalent to $15 per month. New customers on first three month plan only. Taxes and fees extra. Speeds lower above 40 gigabytes on unlimited. See mintmobile.com for details.
The MeidasTouch Podcast
GOP House BLOWS ITSELF UP as MAGA Mike FIRES Top Member
Hey there, Ryan Reynolds here. It's a new year and you know what that means. No, not the diet. Resolutions. A way for us all to try and do a little bit better than we did last year. And my resolution, unlike big wireless, is to not be a raging a**hole and raise the price of wireless on you every chance I get. Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
GOP House BLOWS ITSELF UP as MAGA Mike FIRES Top Member
As you know, Donald Trump has been on the sidelines saying he doesn't want to see that aid go to Ukraine unless it's in the form of a loan. But just very quickly, do you expect it to get a vote this week, Congressman?
The MeidasTouch Podcast
Newsom GOES BALLISTIC on Trump in STUNNING RESPONSE
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
The MeidasTouch Podcast
Newsom GOES BALLISTIC on Trump in STUNNING RESPONSE
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
How to Fight Back with Messaging Guru Anat Shenker-Osorio
Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what big wireless does. They charge you a lot. We charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right. We're cutting the price of Mint Unlimited from $30 a month to just $15 a month.
The MeidasTouch Podcast
How to Fight Back with Messaging Guru Anat Shenker-Osorio
Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
Panicked Trump Screws Himself as Term Collapses
Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what big wireless does. They charge you a lot. We charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right. We're cutting the price of Mint Unlimited from $30 a month to just $15 a month.
The MeidasTouch Podcast
Panicked Trump Screws Himself as Term Collapses
Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
Mexico President PUTS Trump TO SHAME in Public
Ryan Reynolds here for Mint Mobile. I don't know if you knew this, but anyone can get the same premium wireless for $15 a month plan that I've been enjoying. It's not just for celebrities. So do like I did and have one of your assistant's assistants switch you to Mint Mobile today. I'm told it's super easy to do at mintmobile.com slash switch.
The MeidasTouch Podcast
Dems Call Trump’s BLUFF with PERFECT TRAP in NEW YEAR
Ryan Reynolds here from Mint Mobile with a message for everyone paying big wireless way too much. Please, for the love of everything good in this world, stop. With Mint, you can get premium wireless for just $15 a month. Of course, if you enjoy overpaying, no judgments, but that's weird. Okay, one judgment. Anyway, give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
Trump Union Voters GET FACES EATEN by MAGA Leopards
Ryan Reynolds here from Mint Mobile. I don't know if you knew this, but anyone can get the same premium wireless for $15 a month plan that I've been enjoying. It's not just for celebrities. So do like I did and have one of your assistant's assistants switch you to Mint Mobile today. I'm told it's super easy to do at mintmobile.com slash switch.
The MeidasTouch Podcast
Denmark UNLEASHES FURY at Trump after CALL FROM HELL
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
The MeidasTouch Podcast
Denmark UNLEASHES FURY at Trump after CALL FROM HELL
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
Trump DESTROYS Lives of HIS Voters who TRUSTED HIM MOST
Hey there, Ryan Reynolds here. It's a new year, and you know what that means. No, not the diet. Resolutions. A way for us all to try and do a little bit better than we did last year. And my resolution, unlike big wireless, is to not be a raging a**hole and raise the price of wireless on you every chance I get. Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
Panicked Trump Gets Frantic as Tables Turn
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
The MeidasTouch Podcast
Panicked Trump Gets Frantic as Tables Turn
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
Trump Gets Destroyed by Dem Govs in Public
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
The MeidasTouch Podcast
Trump Gets Destroyed by Dem Govs in Public
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
Trump Runs to Golf Like a Coward as USA Rises Up
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
The MeidasTouch Podcast
Trump Runs to Golf Like a Coward as USA Rises Up
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
World Leaders Put the Screws in Trump as He Secretly Begs
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
The MeidasTouch Podcast
World Leaders Put the Screws in Trump as He Secretly Begs
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
Sen. Mark Kelly on Trump’s ‘Worst 50 Days’
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
The MeidasTouch Podcast
Sen. Mark Kelly on Trump’s ‘Worst 50 Days’
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
BOOM! Newsom THROWS DOWN on Trump in PUBLIC
Ryan Reynolds here for Mint Mobile. I don't know if you knew this, but anyone can get the same premium wireless for $15 a month plan that I've been enjoying. It's not just for celebrities. So do like I did and have one of your assistant's assistants switch you to Mint Mobile today. I'm told it's super easy to do at mintmobile.com slash switch.
The MeidasTouch Podcast
World Leaders DESTROY Trump as he SCREWS AMERICA
Ryan Reynolds here from Mint Mobile. I don't know if you knew this, but anyone can get the same premium wireless for $15 a month plan that I've been enjoying. It's not just for celebrities. So do like I did and have one of your assistant's assistants switch you to Mint Mobile today. I'm told it's super easy to do at mintmobile.com slash switch.
The MeidasTouch Podcast
Latino Trump Voters SOBBING IN TEARS as Trump BETRAYS THEM
Ryan Reynolds here from Mint Mobile with a message for everyone paying big wireless way too much. Please, for the love of everything good in this world, stop. With Mint, you can get premium wireless for just $15 a month. Of course, if you enjoy overpaying, no judgments, but that's weird. Okay, one judgment. Anyway, give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
Colombia Prez THROWS Trump into TOTAL TANTRUM
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
The MeidasTouch Podcast
Colombia Prez THROWS Trump into TOTAL TANTRUM
Ryan Reynolds here from Mint Mobile. I don't know if you knew this, but anyone can get the same premium wireless for $15 a month plan that I've been enjoying. It's not just for celebrities. So do like I did and have one of your assistant's assistants switch you to Mint Mobile today. I'm told it's super easy to do at mintmobile.com slash switch.
The MeidasTouch Podcast
Colombia Prez THROWS Trump into TOTAL TANTRUM
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
Zelenskyy Punches Back at Trump Hard After Sell Out
Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what big wireless does. They charge you a lot. We charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right. We're cutting the price of Mint Unlimited from $30 a month to just $15 a month.
The MeidasTouch Podcast
Zelenskyy Punches Back at Trump Hard After Sell Out
Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
Trump PSYCHOTIC MELTDOWN gets EVEN WORSE
Ryan Reynolds here from Mint Mobile with a message for everyone paying big wireless way too much. Please, for the love of everything good in this world, stop. With Mint, you can get premium wireless for just $15 a month. Of course, if you enjoy overpaying, no judgments, but that's weird. Okay, one judgment. Anyway, give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
Trump has DISASTROUS Christmas as MAGA IMPLODES
Ryan Reynolds here from Mint Mobile with a message for everyone paying big wireless way too much. Please, for the love of everything good in this world, stop. With Mint, you can get premium wireless for just $15 a month. Of course, if you enjoy overpaying, no judgments, but that's weird. Okay, one judgment. Anyway, give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
MeidasTouch RESPONDS to Trump COLLAPSING TERM
Hey there, Ryan Reynolds here. It's a new year and you know what that means. No, not the diet. Resolutions. A way for us all to try and do a little bit better than we did last year. And my resolution, unlike big wireless, is to not be a raging a**hole and raise the price of wireless on you every chance I get. Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
MeidasTouch RESPONDS to BREAKING NEWS before DAY 1 - 1/16/25
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
The MeidasTouch Podcast
MeidasTouch RESPONDS to BREAKING NEWS before DAY 1 - 1/16/25
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
MeidasTouch Full Podcast - 3/7/25
Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what big wireless does. They charge you a lot. We charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right. We're cutting the price of Mint Unlimited from $30 a month to just $15 a month.
The MeidasTouch Podcast
MeidasTouch Full Podcast - 3/7/25
Give it a try at mintmobile.com slash switch.
The MeidasTouch Podcast
MeidasTouch Full Podcast - 3/7/25
Right. I may have taken away Ebola for a little bit. And, you know, I don't know. You want to know my phone number? It's boob. 8088 boob.
The MeidasTouch Podcast
MeidasTouch Full Podcast - 3/7/25
Hamas is saying, oh, Donald Trump, did you hear?
The Rest Is History
535. Emperors of Rome: Tiberius, Slaughter and Scandal (Part 2)
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
The Rest Is History
535. Emperors of Rome: Tiberius, Slaughter and Scandal (Part 2)
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
The Tucker Carlson Show
Matt Taibbi: All the Top Secret Information Trump Is Releasing & What He Should Declassify Next
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
The Tucker Carlson Show
Matt Taibbi: All the Top Secret Information Trump Is Releasing & What He Should Declassify Next
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
The Tucker Carlson Show
Sean Davis: Trump Shooting Update, & the Real Reason Congress Refuses to Investigate
Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what big wireless does. They charge you a lot. We charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right. We're cutting the price of Mint Unlimited from $30 a month to just $15 a month.
The Tucker Carlson Show
Sean Davis: Trump Shooting Update, & the Real Reason Congress Refuses to Investigate
Give it a try at mintmobile.com slash switch.
The Viall Files
E899 Going Deeper with Emmy and Will
Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?
The Viall Files
E899 Going Deeper with Emmy and Will
So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.
The Viall Files
E899 Going Deeper with Emmy and Will
Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what big wireless does. They charge you a lot. We charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right. We're cutting the price of Mint Unlimited from $30 a month to just $15 a month.
The Viall Files
E899 Going Deeper with Emmy and Will
Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what big wireless does. They charge you a lot. We charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right. We're cutting the price of Mint Unlimited from $30 a month to just $15 a month.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
I had a conversation with him and it was probably the most productive a conversation has felt. And like, I'm just such at my breaking point that I will take anything, any effort to And we came up with a big three, which was, I don't expect you to do the deep cleans. I honestly find those days to be very enjoyable.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
I put my headphones in, I get down and dirty, you know, and his big three could be helping with the dishes, taking the trash out and like just general pick up your clothes off the floor kind of thing. That conversation was probably two or three weeks ago. And I felt like it was a very tangible, he could, that was a three things he could check off and it still hasn't gotten any better.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
And he has not ever touched a dish. He only takes the trash out if I ask. He is, I want to also say like kind in a thousand other ways, but like for some reason things can never be 50-50. And I've asked plenty of times for, you know, a little bit of help and whatnot and don't get any.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
Uh, I don't want to, I really don't, but yeah, you want him to help out.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
Yes, you're totally right. And you're, when you say like, it is almost just a slap in the face at this point, if he doesn't do it, because I, You know, it's almost embarrassing for me at this point that like I have a boyfriend who I'm begging and pleading for help. And no matter what I say or do, he knows that I'm not going to go anywhere.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
And yeah, I think you're right that it does need to be something drastic. I don't want to break up and I don't want to move out. But like, what other option do I have? You know, because clearly his words don't have any value at this point and neither do mine.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
Yeah. Yeah. I don't, I've really struggled with like where to go from here. Um, but I, And I've wanted to avoid any breakup ultimatum talks of any kind. But I think it's at the point where that's kind of just what I have to do.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
Like I said, I told him we had a conversation about this literally last night and I told him that, you know, I just straight up don't believe him anymore, that his words at this point hold no value to me when he says that he'll do something different because they haven't changed in the last four months. So why would it change now kind of thing? And that I just don't trust what he says anymore.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
Yeah. Like any household responsibility, whether it is paying utilities, taking the trash out.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
And it has started to fester into every other aspect of our relationship, like things that we we never had a problem with our sex life before. And now like, why would I want to sleep with you when I'm tired and exhausted? the last thing I want to do is like touch your penis. I can't, I can't do it. I'm tired.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
Yeah. And he's mentioned, you know, in the same way that I feel like I'm not being listened to or anything like that. He does feel like I just nag him all the time and that I'm so hyper focused on it. And he feels insecure because we don't have sex as much as we used to, you know, and I, and I've told him like, yeah, I'm probably not a joy to be around. I'm probably a bitch half the time.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
He feeds the dogs. We share the finances. We're very intertwined in a team when it comes to those things. But even just the simple task of like, hey, the Wi-Fi is due and hopping on there and doing it, that is something that falls on my plate. Or if we just moved recently, trying to communicate with landlords, things like that. Those are all responsibilities that I take care of.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
But like, I don't know what you would want me to do any differently. Like until things get better, I am going to continue to be frustrated and it's going to just get worse.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
He agrees. He's never told me that what I'm saying is wrong. That's the hard part is he doesn't ever disagree with me on anything. It's very annoying. And I've told him I almost feel crazy at this point that my expectations are so far out there and unobtainable that I literally think I'm going insane because I must just be such a crazy, clean freak. girlfriend, whatever.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
And I know I'm not, but I told him that you make me feel that way. And he's like, well, that's not my intention. And, you know, I never want to make you feel like you're crazy and your expectations aren't too far out there and it is doable and I will do better. And it, yeah, those words are just so nice to hear, but they don't mean shit anymore.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
Yeah. And usually if I say something, he will like, I'm like, hey, trying to clean things up around here. Do you think you can maybe do the dishes? And, you know, I roll and he'll go up and do it. And that's great and all. And yeah, that took it off my plate today. But what happens next week and like constantly having to ask for help gets very, very exhausting.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
Like he's never anytime I ask, he will do it. But I don't want to have to ask anymore.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
do it which one would you choose that sounds like a miserable life i would probably opt to break up if i knew that that was what my future was going to be i would opt to break up even if he what if he jumped right up and said sure no problem when you asked still seems frustrating still seems like i'm his mom And maybe that's unrealistic. I don't know. But I'm sure not. It's not unrealistic.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
Yeah. And I think there's blue and pink jobs of how silly that sounds. But if I'm going to clean and do the laundry and whatever, that's fine. But go change the oil in my car. If that's what it is, or hang the shelf, or do the things that if you want to be a man, do the things that a man does. But the problem is, is that I am independent and I handle my own shit. And
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
I've told him, I was like, if you don't want to clean and you don't want to do that, that's fine. But when it comes to mowing the lawn and changing the oil in our cars and things like that.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
At our last rental, our landlord mowed it for us. And at this one, there's someone else that now mows it as well, which is good. I guess that takes something off of, but just in the concept of life, like To me, if I'm gonna do everything else, those are some other things that you could do. Or clean the garage, maybe that's your job. But at this point, they're all my jobs.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
Yeah, I would. And like I said, in every other aspect of our life.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
I feared that that's what you were going to say.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
Yeah. I don't think you're totally wrong. And I do think that he thinks I'm a clean freak. I promise I'm, I like a clean home. I do, but I'm not, I have three dogs. They sleep in our bed. They sit on our couch. They drink out of our toilet. Like there are dishes in the sink sometimes. And that's cool. Like I'm not a freak by any means. I know I'm not.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
Uh, but sometimes it like, he makes me feel like I am.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
Like, okay. So I told you we've been dating for a year and a half ish. Valentine's day was what a month ago. Yeah. The first time he ever cooked me dinner in our entire relationship was this Valentine's day.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
It was fine. It was steak. Yeah. And if that's what, and I've told him there's nights that I work late, later.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
Yeah. I would love that. Yeah. I, there's nights that I work late and whatever. And I've told him, you know, if I, work from eight in the morning until nine o'clock at night, it'd be really nice to come home.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
He is truly like such a kind person. human being. We are such a good team together on every other aspect of life. Another little background is we both work at the same company, um, kind of on different sides of it, but like we do that very well together. We live together. Well, our families blend together.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
And it could truly at this point, if it was Kraft mac and cheese sitting there waiting for me, like I would be over the moon at this point because like, it's just one thing to take off my plate, you know?
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
Well, he's kind to his nieces and nephews and, you know, like he goes out of his way to be just a good person. He really is. So I don't know why this simple task of just like being a team in the house is so hard.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
cle cle cle cle cle cle cle cle cle cle cle cle cle cle cle cle cle cle cle cleacacacacacacacacacacac cle cle cle cle cle cle cle cle cle cle cle cle cle cle cle cle cle cle cle cle cle cleacacacacacacac cle Athlet cle cle Athlet Athlet cle cle Athlet Athlet cle cle Athlet Athletacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacac cle cle disputos disput disputacacacac disputacac disputacac disputacac disputacac disputacac disputacac disputacac disputacac disputacac disputacac disputacac disputacac disputacac disputacac disputacac disputacac disputacac disputacac disputacac disputacac disputacac disputacac disputosket
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
Yeah. And I think like communication, like we do very well on too. We, he's very much the kind of person that if we have an issue, I can feel comfortable like bringing it up. We sit, we chat about it, none of those things. But then when it comes to this, it feels like it's in one ear and out the other. because there's no action to follow, if that makes sense.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
The bed, broom, and the... The budget, right?
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
To be quite frank, I think that his mom has always done everything for him. I actually had a conversation with his older sister about this. Truly, I was at my breaking point, came to his older sister and was like, here's where we're at. Do you have any insight? And she was like, growing up, he never had to. My mom did everything for us. She does the dishes, she handles things, and she...
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
We live in the same town as his parents now. And they she still does the same thing. You know, like if there's something that maybe I can't handle that day and he thinks he doesn't have time for, like his mom will just drop everything and go do it. And so I think it's just, he's never had to lift a finger. And so here I am, like, I truly have begged and pleaded in every way I can.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
I've been angry. I've been sad, like everything. And it just feels like it's in one ear, not the other. I mean, like this, we've, we've had a hundred conversations about it and I kind of get the same response every time that it's okay. I'm so sorry that you feel that way. I will do better. I will be better. I like, I will. And then a week, two weeks goes by. I'm still kind of handling everything.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
And I've tried to give him plenty of like opportunities, you know, like leave the dishes a little extra long and see if anything changes. And it just doesn't. And I think it's just because he's never had to before.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
No, that's my fear is, you know, I would like to be a mom someday. And like having the responsibility of that on top of handling everything else scares the shit out of me.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
No, I would like to someday. I'm telling you.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
Yeah. No, I think it would just make it worse.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
very 50, 50, it's just the act of like hopping on and doing it. But I have told him like, you know, Hey babe, can you run down and get this title thing figured out for, you know, my truck or whatever the case is. And I've straight up just said, no, I work and I don't have time.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
Like, and I have told him, and sometimes it feels like he's just adding more onto my plate, you know, of even the smallest, he can ask me, you know, where's the forks at
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
And my knee-jerk reaction at this point is just to be like, I don't know, you fucking find them yourself kind of thing because it's just festered so long that the simple tasks, I'm just like, if you did the dishes, maybe you would know.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
I don't know. I think that's what I'm having a hard time with. Like I said, he is such a good person in so many other ways. So I haven't wanted to ultimatum him up until this point because I just think it seems dirty to me. I don't know. So I'm just having a hard time deciding, like, when do I draw the line, you know?
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
Yeah. And I will say I have told him like, this is not a situation that I'm comfortable like continuing forward with in the future. I will not marry someone that can't. Help.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
I just won't do it. Uh, probably about a year and a half. Okay.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
Uh, we just started it, so it won't be up again until next February.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
Good. My name's Ryan. I'm 24 years old and my boyfriend can't do the dishes.
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
I've definitely, I guess I don't know if I've voiced this to him, but my own personal thoughts have slowed down a lot on my engagement timeline solely for these reasons. I'm a pretty self-aware person, I think. And so I've kind of halted my brain on moving forward with a
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
engagement like i truly think if he asked me tomorrow i would probably say no um just because i there's not been any actions to follow up his words okay that's good to know yeah i hope so i yeah i don't want to marry someone that can't help so i just don't like is this something that he will grow out of or is this definitely is you know well it's who he is today and i don't think he'll grow out of it he's certainly capable
The Viall Files
E905 Ask Nick - Hope is Not Your Friend
Little context. We've been dating for a little over a year. We did like move in very quickly. I would say like within a couple of months, it was just the most practical thing at the time. So kind of from jump, I'm a homemaker. I cook, I clean, you know, that's just who I am. And you're in the honeymoon phase. You want to be sweet and do all those things. Now it's been like a year and a half.
This Past Weekend w/ Theo Von
E558 Katt Williams
Hey there, Ryan Reynolds here. It's a new year, and you know what that means. No, not the diet. Resolutions. A way for us all to try and do a little bit better than we did last year. And my resolution, unlike big wireless, is to not be a raging a**hole and raise the price of wireless on you every chance I get. Give it a try at mintmobile.com slash switch.
Unfiltered Soccer with Landon Donovan and Tim Howard
USMNT vs Venezuela Recap, Everton Shock Spurs, and the Worst Manchester United Team Ever?!
Hey there, Ryan Reynolds here. It's a new year, and you know what that means. No, not the diet. Resolutions. A way for us all to try and do a little bit better than we did last year. And my resolution, unlike Big Wireless, is to not be a raging a**hole. and raise the price of wireless on you every chance I get. Give it a try at mintmobile.com slash switch.
Unfiltered Soccer with Landon Donovan and Tim Howard
Promotion and Relegation with Adam Crafton
Ryan Reynolds here from Mint Mobile. I don't know if you knew this, but anyone can get the same premium wireless for $15 a month plan that I've been enjoying. It's not just for celebrities. So do like I did and have one of your assistant's assistants switch you to Mint Mobile today. I'm told it's super easy to do at mintmobile.com slash switch.