Menu
Sign In Pricing Add Podcast

Ryan Reynolds

Appearances

20/20

True Crime Vault: The DNA Detective

1034.85

She calls reporter Barbara Hoffroda to give one final newspaper interview pleading for answers.

20/20

True Crime Vault: The DNA Detective

1100.043

amazingly the young student who lived through the trauma of losing her teacher good evening is now all grown up and a reporter covering the cold case this is the school where christy marack or miss marack as she was known to her students never showed up the day she was murdered she says her teacher's murder influenced her decision to become a reporter i think her death really did shape a lot of us in ways that we didn't even know

20/20

True Crime Vault: The DNA Detective

111.226

Well, my mouth drops open. It took you just a couple of days to find a real, serious tip.

20/20

True Crime Vault: The DNA Detective

1131.839

Trying to keep his sister's case front and center, Vince leases a giant billboard next to the highway.

20/20

True Crime Vault: The DNA Detective

1150.493

Flash forward, two decades after the murder, District Attorney Craig Stedman's office takes over the cold case.

20/20

True Crime Vault: The DNA Detective

1162.813

Coming up, a DNA revolution allows them to stare into the face of a killer. What was it like to look at a sketch of a person who potentially raped and murdered your sister? And a break in another famous cold case would lead to a breakthrough in this one.

20/20

True Crime Vault: The DNA Detective

1213.592

Across the country in California, a former actress and singer is also watching with keen interest.

20/20

True Crime Vault: The DNA Detective

1221.455

Her name is Cece Moore, and she is now a genetic genealogist.

20/20

True Crime Vault: The DNA Detective

1235.161

Cece helps foundlings, babies abandoned at birth, and adoptees find their biological parents.

20/20

True Crime Vault: The DNA Detective

1243.956

Making family connections never thought possible. I love you like my little girl. Moore got hooked on genealogy when she researched her own family years ago. And although she didn't break the Golden State Killer case... Give it up for CeCe Moore. Her groundbreaking methods helped. She has received international recognition for her pioneering techniques.

20/20

True Crime Vault: The DNA Detective

1280.549

Moore has always known that she could use her genetic genealogy skills to catch criminals, but she was reluctant.

20/20

True Crime Vault: The DNA Detective

1298.73

And she is now teaming up with a company called Parabon Nanolabs, who is already familiar with the Merak cold case.

20/20

True Crime Vault: The DNA Detective

1317.843

In 2017, the Lancaster District Attorney connects with Parabon Nanolabs, who are able to use an innovative technique to create a rendering of the suspect using DNA found at the crime scene. Months later, the composite is released to the public.

20/20

True Crime Vault: The DNA Detective

1341.598

What was it like to look at a sketch of a person who could potentially rape and murder your sister?

20/20

True Crime Vault: The DNA Detective

1354.634

Ultimately, the sketch doesn't shake loose any viable leads. But now, Parabon has their new secret weapon. Cece Moore. Could this DNA detective help catch Christy Murak's killer?

20/20

True Crime Vault: The DNA Detective

1389.335

In the Merak case, there was DNA found both on the carpet and Christy's body. Cece Moore and Parabon convert that DNA into a data file and upload it to a free, no-frills genealogy website called GEDmatch, designed to find genetic relatives.

20/20

True Crime Vault: The DNA Detective

1409.636

They get a hit. The DNA file matches up with several distant family members of the killer.

20/20

True Crime Vault: The DNA Detective

1432.85

Cece narrows her search down to a target family in Lancaster of Northern European descent.

20/20

True Crime Vault: The DNA Detective

1452.856

She also notices that the suspect has some Latin American heritage.

20/20

True Crime Vault: The DNA Detective

1501.836

CeCe's conclusion stuns District Attorney Craig Stedman.

20/20

True Crime Vault: The DNA Detective

1511.81

How long did it take you from the time you started working on this case to find that person?

20/20

True Crime Vault: The DNA Detective

1518.834

Well, my mouth drops open because this is a case that went unsolved for over 25 years, and it took you just a couple of days to find a real serious tip.

20/20

True Crime Vault: The DNA Detective

1533.344

Now it's up to law enforcement to confirm CeCe's findings by obtaining DNA from the possible suspect and matching it to that DNA from the crime scene.

20/20

True Crime Vault: The DNA Detective

154.704

Lancaster, Pennsylvania. A popular destination wedding location. Attracting families from surrounding states for the beautiful venues, food, and flowers. But is it also possible that one of these wedding professionals, responsible for creating people's most cherished moments, is also responsible for a brutal murder two and a half decades earlier?

20/20

True Crime Vault: The DNA Detective

1552.114

An undercover unit begins to stake out the suspect, trailing him as he enters this elementary school. They sit and wait for their moment.

20/20

True Crime Vault: The DNA Detective

1574.741

DNA from that water bottle and chewing gum is rushed to the crime lab. After 25 years... Police think they have their man.

20/20

True Crime Vault: The DNA Detective

1596.297

When we come back, an arrest that would stun Lancaster. The alleged perpetrator had been hiding in plain sight.

20/20

True Crime Vault: The DNA Detective

1688.671

On June 25th, 2018, Lancaster District Attorney Craig Stedman calls reporters together for a late afternoon press conference. But he doesn't tell them why.

20/20

True Crime Vault: The DNA Detective

1707.907

Unbeknownst to reporters, hours earlier, the man police believe savagely murdered Christy Murak and eluded law enforcement for 26 years was arrested. Tell me what it was like when you got the call from the DA.

20/20

True Crime Vault: The DNA Detective

1742.948

Vince immediately jumps in his car to make the two-hour drive to Lancaster for the press conference.

20/20

True Crime Vault: The DNA Detective

1778.629

The man police have charged with criminal homicide is Raymond Rowe. And now, looking at that Parabon sketch created from the DNA at the crime scene, a chilling resemblance.

20/20

True Crime Vault: The DNA Detective

1805.609

Most people know Raymond Rowe by a different name in this community, DJ Freeze.

20/20

True Crime Vault: The DNA Detective

1828.24

DJ Freeze was many things in the Lancaster community. A renowned DJ, a business owner, a father, husband, and churchgoer. But now, a new adjective was being used to describe him. Murder suspect. He was one of the most sought after wedding DJs. This ad touts him as the best in Lancaster.

20/20

True Crime Vault: The DNA Detective

1863.641

Derek Diener has filmed numerous weddings where Raymond Rowe was the DJ.

20/20

True Crime Vault: The DNA Detective

1893.711

DJ Freeze has been a fixture in this city since his late teens. He started making a name for himself breakdancing, which he spoke about in this documentary.

20/20

True Crime Vault: The DNA Detective

1916.162

The Chameleon Club, Lancaster's nationally renowned live music venue. In the late 1990s, he was the house DJ there. And also an advocate against violence, which now in hindsight has people's jaws dropping.

20/20

True Crime Vault: The DNA Detective

193.769

This story does not begin at a wedding, but during another time of anticipation and excitement, days before Christmas 1992.

20/20

True Crime Vault: The DNA Detective

1953.999

He later talked about violence in that documentary.

20/20

True Crime Vault: The DNA Detective

1961.746

Roe, the man accused of committing the Christmastime murder, comes across as quite the family man on this Christmas card of his own.

20/20

True Crime Vault: The DNA Detective

2001.309

How is it possible this successful business and family man allegedly committed this horrific crime?

20/20

True Crime Vault: The DNA Detective

2010.111

Up next, hear from a woman from DJ Freeze's past.

20/20

True Crime Vault: The DNA Detective

205.174

This is horrible. Christy Merak, seen here in her yearbook photo, grew up in Pennsylvania, in cold country, the middle child of a close-knit family and older sister to Vince. What was she like as a sister?

20/20

True Crime Vault: The DNA Detective

2084.406

Lancaster, Pennsylvania, a city coming to grips with the realization that the man accused of the horrific rape and murder of Christy Murack has been living among them.

20/20

True Crime Vault: The DNA Detective

2096.452

He had played at their weddings, their kids' elementary school parties, their high school graduation dances.

20/20

True Crime Vault: The DNA Detective

2113.297

Nobody saw that coming. When you started learning more about what his life was like, what was your reaction?

20/20

True Crime Vault: The DNA Detective

2131.067

The other part of this that strikes me as ironic is he spent all this time in the middle of people's celebration of the milestones of their life. And yet, if he is the person that did this, he didn't give Christy that same chance.

20/20

True Crime Vault: The DNA Detective

2165.563

For that tight-knit professional wedding community, it is utter disbelief. The DJ and friend they had been working side by side with is now being charged with criminal homicide.

20/20

True Crime Vault: The DNA Detective

2199.694

Emily Noble dated Raymond Rowe in 1996, four years after the murder of Christy, while they both worked at the Chameleon Club. Noble looking eerily similar to Merak.

20/20

True Crime Vault: The DNA Detective

2229.961

The two shared a love of rap music. A favorite, the Sugar Hill Gang. One of the soundtracks for their courtship.

20/20

True Crime Vault: The DNA Detective

2262.468

Although Emily said he wasn't violent, he became controlling and emotionally abusive.

20/20

True Crime Vault: The DNA Detective

2279.594

Emily says Roe hated that she smoked and once caught her sneaking a cigarette.

20/20

True Crime Vault: The DNA Detective

2300.891

Emily says during an outing at Red Lobster, celebrating Mother's Day with Ro's mother and his daughter, she showed up in an outfit that set him off.

20/20

True Crime Vault: The DNA Detective

232.167

Annie Adams was one of Christy's best friends.

20/20

True Crime Vault: The DNA Detective

2331.118

Eventually, Emily moved away to New Mexico. And when she got the call that Roe had been arrested decades after the relationship, it gave her chills.

20/20

True Crime Vault: The DNA Detective

2351.164

So was there a relationship between Christy Murack and Raymond Roe? It's a mystery everyone is trying to unwind. Do you think she knew Raymond Roe?

20/20

True Crime Vault: The DNA Detective

2379.181

Investigators hope they will be able to piece together the connection before trial. But even if they can't, they are feeling extremely confident about the DNA evidence.

20/20

True Crime Vault: The DNA Detective

2413.467

Roe is being held without bail. His lawyer did not return 2020's calls asking for comment. CeCe Moore says cases like this should put potential criminals on notice.

20/20

True Crime Vault: The DNA Detective

2439.963

Coming up next, an emotional surprise for the victim's brother, Vince.

20/20

True Crime Vault: The DNA Detective

2457.479

It's been an arduous 26-year journey for Vince Merak. That's 26 Christmases, 26 birthdays, and hundreds of other life milestones without his radiant sister by his side. No matter what happens at the trial, nothing will erase that heartbreak.

20/20

True Crime Vault: The DNA Detective

2501.775

Today, Vince is getting the chance to meet that woman whose tireless determination led to the arrest in Christy's case and provided him with a small measure of relief after all these years. Cece Moore.

20/20

True Crime Vault: The DNA Detective

257.962

That's Christy on the right, next to Annie. By December of 1992, she was living in Lancaster, Pennsylvania.

20/20

True Crime Vault: The DNA Detective

2584.937

And that is exactly why CeCe and Parabon will continue to use genetic genealogy on other cold cases.

20/20

True Crime Vault: The DNA Detective

2602.242

Her work with Parabon has already led to breaks in 10 other cold cases, one just earlier today.

20/20

True Crime Vault: The DNA Detective

2614.046

And Vince has a message for those families out there searching for those answers who may be losing faith.

20/20

True Crime Vault: The DNA Detective

280.318

Teaching sixth grade at Roristown Elementary School, Principal Harry Goodman hired her.

20/20

True Crime Vault: The DNA Detective

309.413

December 18th, Christy has dinner with her brother Vince. It would be the last time he would see her.

20/20

True Crime Vault: The DNA Detective

324.301

The evening of December 20th, Christy is at home preparing for the holiday, wrapping copies of the book Miracles on Maple Hill for each of her 24 students. She wrote a message to them.

20/20

True Crime Vault: The DNA Detective

344.246

The next morning is a chilly one with temperatures below freezing. Christy is up before sunrise.

20/20

True Crime Vault: The DNA Detective

361.842

Her roommate leaves first at 7 a.m. Christy would usually leave shortly after by 7.45. But on this morning, she did not. In the next 45 minutes, something unspeakable would happen.

20/20

True Crime Vault: The DNA Detective

380.358

Over at Christy's school, Principal Goodman gets worried when she doesn't show up to her classroom.

20/20

True Crime Vault: The DNA Detective

433.44

When he walks up, he's horrified by the scene in the living room.

20/20

True Crime Vault: The DNA Detective

453.278

Joseph Maddenspacher is the Lancaster District Attorney in 1992.

20/20

True Crime Vault: The DNA Detective

474.208

What was your reaction when you heard that?

20/20

True Crime Vault: The DNA Detective

480.461

Officers begin to piece together what has just taken place. A horrific scene. Christy dead on the floor. Her head beaten. Her jaw broken. She had been raped and strangled.

20/20

True Crime Vault: The DNA Detective

500.18

She is still wearing her coat and gloves.

20/20

True Crime Vault: The DNA Detective

506.343

It is immediately clear to investigators that Christy was in a violent struggle for her life.

20/20

True Crime Vault: The DNA Detective

542.635

In that scene of destruction, police are able to collect multiple samples of the killer's DNA. And those Christmas presents she had so meticulously wrapped the night before are now strewn about the apartment.

20/20

True Crime Vault: The DNA Detective

571.744

At Christie's school, a classroom full of students is wondering why their teacher never showed up. Assistant Superintendent Bob Wildeson is there.

20/20

True Crime Vault: The DNA Detective

591.075

When 12-year-old Christina Butler gets off the bus that afternoon, her mother is waiting to break the news.

20/20

True Crime Vault: The DNA Detective

624.78

Who would do this? Still ahead, a disturbing visit the next day from a mystery man looking for Christy at school.

20/20

True Crime Vault: The DNA Detective

754.565

Drive a few miles out of downtown Lancaster, Pennsylvania, and you will find some of the most bucolic farmland in the country.

20/20

True Crime Vault: The DNA Detective

782.438

That sense of safety is shattered by the murder of 25-year-old schoolteacher Christy Murack just four days before Christmas in 1992. Her family is now planning her funeral. I understand that a priest at one point told you not to look at her.

20/20

True Crime Vault: The DNA Detective

80.842

I understand that a priest at one point told you not to look at her.

20/20

True Crime Vault: The DNA Detective

812.901

The day after Christy Murack's murder, teachers and students are mourning.

20/20

True Crime Vault: The DNA Detective

831.369

Her principal is grief-stricken, but he's also under suspicion.

20/20

True Crime Vault: The DNA Detective

841.815

As police launch their investigation, a suspicious visitor shows up at Christy's school, carrying flowers and heading for her classroom.

20/20

True Crime Vault: The DNA Detective

881.141

The assistant superintendent escorts him from the building and calls police. The visit seems even more suspicious the next day when the man calls Wilderson at home.

20/20

True Crime Vault: The DNA Detective

901.163

The man turns out to be Christy's secret boyfriend, 20 years her senior and married.

20/20

True Crime Vault: The DNA Detective

910.984

Those close to Christy are convinced her killer must be someone she knows. She never would have opened the door to a stranger. I understand that she was a stickler for safety.

20/20

True Crime Vault: The DNA Detective

932.637

Police run the DNA found at the crime scene through the National Law Enforcement Database. but there is no match. Investigators begin reading through everyone she knows.

20/20

True Crime Vault: The DNA Detective

963.019

Ultimately, both Principal Goodman and Christy's married boyfriend provide airtight alibis and are cleared. The suspect list grows shorter and shorter.

20/20

True Crime Vault: The DNA Detective

990.768

Weeks turn into months. Months into years.

20/20

True Crime Vault: Overboard

1139.436

I was concerned the day before Thanksgiving when I haven't heard from him.

20/20

True Crime Vault: Overboard

1191.963

His original name at birth was John Julius Jacobson.

20/20

True Crime Vault: Overboard

1278.24

You guys were great. Now the problem is, Skylar could never remember his lines. And his dad would yell at him on the set until the producers were basically like, get that guy out of here. He's really, he's upsetting Skylar, he's upsetting everyone else. And Skylar hated acting.

20/20

True Crime Vault: Overboard

1359.355

When he got out of the Marines, he wanted to change his name to Skyler DeLeon. On the paperwork, it says he doesn't want to be associated by the same name as his father because his father is a bad person and a criminal. It was right before he met Jennifer that he changed his name.

20/20

True Crime Vault: Overboard

1474.082

According to Jennifer's mother, she thinks that they got pregnant on their wedding night because the timing of it was just so. So, yeah, they had a little girl, Haley, and then they got pregnant again.

20/20

True Crime Vault: Overboard

1542.509

And Dave Byington goes, that's a kill kit if I ever heard one.

20/20

True Crime Vault: Overboard

1564.948

And they're expecting it to be Skyler. And they know what Skyler looks like because he's got a record and he's in the database, but it's not Skyler.

20/20

True Crime Vault: Overboard

183.294

He grew up on a farm with a brother, Jim Hawks. They liked to go surfing. They liked to go sailing.

20/20

True Crime Vault: Overboard

1872.529

Who would come up with a story that they used money laundered drug money to buy a boat unless it was really true?

20/20

True Crime Vault: Overboard

1908.496

This transaction allegedly occurred in the parking lot at the 15th Street dock, basically on the trunk of the car with a suitcase full of money.

20/20

True Crime Vault: Overboard

194.878

He became a probation officer. His brother became a police officer and then later a police chief. So he came from a law enforcement family.

20/20

True Crime Vault: Overboard

221.331

How close were you guys growing up even? Very close. My parents divorced when I was probably like five. He pretty much raised me all the way to adulthood and made me who I am today.

20/20

True Crime Vault: Overboard

235.445

Hi, honey. I'm so glad to be home.

20/20

True Crime Vault: Overboard

239.966

Jackie was a very down-to-earth, really sweet woman.

20/20

True Crime Vault: Overboard

2409.869

The biggest thing that we can do as a family was to reach out in the media and find someone maybe willing to talk, someone that maybe seen them, know of their last location, know about their safety. You know, I think something's wrong. I think something's missing. I think something's really wrong. But my first priority is to find about the whereabouts of my parents.

20/20

True Crime Vault: Overboard

2455.257

The biggest thing was their car, and if we could find their car, we know we could kind of backtrace their steps or what happened to them.

20/20

True Crime Vault: Overboard

2476.537

The next day, the police department gets a call from this woman who had seen the show. And she basically said, I'm looking at this car right now. I live in Mexico, and I'm in a trailer park, and it's in the parking lot.

20/20

True Crime Vault: Overboard

255.115

They had a lot of friends, 150 people at their wedding. The boys called her mom, even though their mother was still alive.

20/20

True Crime Vault: Overboard

2674.504

And this gal says, I'm looking at this car right now.

20/20

True Crime Vault: Overboard

2699.768

That car was the missing piece that we needed to solve the case.

20/20

True Crime Vault: Overboard

2764.129

They called me on their way up. It's like, yeah, we got it on the back of a flatbed truck. And that was a key person.

20/20

True Crime Vault: Overboard

2770.392

It was key. It was so essential.

20/20

True Crime Vault: Overboard

2785.81

They realized that Skyler DeLeon and Jennifer, who was also described, had been down there. They had now witnesses who knew them, and they said, they gave us this car.

20/20

True Crime Vault: Overboard

2814.725

I was about 99% sure that my parents were murdered. But I still had 1% hope. But when they found that car, that 1% was wiped out.

20/20

True Crime Vault: Overboard

2887.203

The baby suddenly spits up all over him, and so it interrupts the interview.

20/20

True Crime Vault: Overboard

2961.905

And the most heartbreaking part of all, they find a video camera.

20/20

True Crime Vault: Overboard

2979.691

And suddenly, the footage cuts to Skylar and Jennifer.

20/20

True Crime Vault: Overboard

3048.573

They get Skyler out of the house and arrest him, and they go inside.

20/20

True Crime Vault: Overboard

318.66

I love how they play with the boats. The well-deserved is a 55-foot trawler. It's kind of a smaller yacht, but you can live on it.

20/20

True Crime Vault: Overboard

335.533

They put in a lot of up-to-date equipment, the GPS system, and all kinds of other stuff that really made it nice.

20/20

True Crime Vault: Overboard

3403.637

And she finally says, no, we were not. in the parking lot, like I said before.

20/20

True Crime Vault: Overboard

3656.066

My stepmother definitely fell hook, line, and sinker for that woman and her baby.

20/20

True Crime Vault: Overboard

3905.447

Meanwhile, Skyler, he's upsetting the GPS to go out to the deepest point in the ocean. It's 3,500 feet. It's the deepest place.

20/20

True Crime Vault: Overboard

3948.637

The weight of the anchor, it goes tight. And suddenly, they're being pulled across the deck. Jackie's head knocks into the side. Boom, you can hear it.

20/20

True Crime Vault: Overboard

3975.566

The weight of the anchor pulls them down to the bottom of the deepest part of the sea.

20/20

True Crime Vault: Overboard

4007.635

Then Kennedy found a fishing pole.

20/20

True Crime Vault: Overboard

4067.559

She, at the time, she stuck by her man.

20/20

True Crime Vault: Overboard

4126.152

She had a chance to save herself, and she chose to stick by Skylar.

20/20

True Crime Vault: Overboard

4344.938

Although her family suffers because she's loved, they'll still get a chance to see her say their last words and say their thoughts. They'll be seeing her through plexiglass. But you know, to see my parents, I have to look through 3,600 of the cold Pacific Ocean.

20/20

True Crime Vault: Overboard

4523.564

My family and I have been waiting for this day for a long time.

20/20

True Crime Vault: Overboard

4546.383

I want him to know that I'm there. I want him to realize, you know, this is what he took from me and the rest of my family.

20/20

True Crime Vault: Overboard

466.238

I think it just hit home with him how important family was.

20/20

True Crime Vault: Overboard

4838.897

It's a big relief. We've been waiting for this for a very long time.

20/20

True Crime Vault: Overboard

4844.975

Skylar has finally, I think, become the person that she has always wanted to be.

20/20

True Crime Vault: Overboard

4907.171

Skylar has finally, I think, become the person that she has always wanted to be. Schuyler is now legally a woman. She has filed court papers and she has changed her name from Schuyler Julius de Leon to Schuyler Preciosa de Leon.

20/20

True Crime Vault: Overboard

4955.174

Over time, he was growing more and more effeminate looking. He asked for female underwear and a bra. And eventually, as the criminal justice system has been kind of changing with the culture, he She was allowed to start wearing those things. And she wants to be called a she.

20/20

True Crime Vault: Overboard

4985.919

take advantage of the system to get some sort of benefit that they think they deserve, we are sending the wrong message.

20/20

True Crime Vault: Overboard

505.708

They went on one last trip to Catalina Island. Jim Hawks, Tom's brother, brought his boat, and they all had this little party.

20/20

True Crime Vault: Overboard

549.918

Next thing you know is no one can get a hold of them. For them just to shut off their cell phones and drop off the face of the earth is extremely out of character.

20/20

True Crime Vault: Overboard

55.776

Next thing you know is no one can get a hold of him.

20/20

True Crime Vault: Overboard

619.625

My uncle knew something was wrong right away. Your dad didn't tie the dinghy, your dad didn't lift the motor down.

20/20

True Crime Vault: Overboard

714.559

They were excited. They thought we got a buyer. You know, we've got someone. We're going to sell this boat.

20/20

True Crime Vault: Overboard

844.793

Jennifer says, we don't know where the hawks are and we still wanted to find out where they are because we still need some information about how to use this boat that we now have. We bought the boat, they drove away. You know, we haven't heard from them and we don't know where they are either.

20/20

True Crime Vault: Overboard

984.638

Sergeant Dave Byington, he sends out a detective to go out to the boat. And so the guy gets to the boat, and he's looking around, and he sees this receipt. on the floor.

20/20

True Crime Vault: The Sinfluencer of Soho

667.013

Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?

20/20

True Crime Vault: The Sinfluencer of Soho

683.461

So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.

20/20

Death in the Dorms Season 2: Episode 2: Haley Anderson

900.327

Ryan Reynolds here from Mint Mobile with a message for everyone paying big wireless way too much. Please, for the love of everything good in this world, stop. With Mint, you can get premium wireless for just $15 a month. Of course, if you enjoy overpaying, no judgments, but that's weird. Okay, one judgment. Anyway, give it a try at mintmobile.com slash switch.

20/20

'Radioactive' - Ep. 5: The Phantom Vehicle

757.025

Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?

20/20

'Radioactive' - Ep. 5: The Phantom Vehicle

773.496

So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.

20/20

'The King Road Killings': 911 Call Released

30.228

Give it a try at mintmobile.com slash switch.

20/20

'The King Road Killings': 911 Call Released

9.431

Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what Big Wireless does. They charge you a lot. We charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right. We're cutting the price of Mint Unlimited from $30 a month to just $15 a month.

20/20

Small Town, Big Con

3741.069

Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what big wireless does. They charge you a lot. We charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right. We're cutting the price of Mint Unlimited from $30 a month to just $15 a month.

20/20

Small Town, Big Con

3761.866

Give it a try at mintmobile.com slash switch.

20/20

Mountain of Lies

0.299

Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what big wireless does. They charge you a lot. We charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right. We're cutting the price of Mint Unlimited from $30 a month to just $15 a month.

20/20

Mountain of Lies

21.098

Give it a try at mintmobile.com slash switch.

20/20

Mountain of Lies

3975.325

A Highlands ranch man already being investigated for murdering his first wife, arrested today accused of murdering his second wife.

48 Hours

Anchors Away

101.951

It took him like 45 minutes.

48 Hours

Anchors Away

120.302

I couldn't pitch with my father or anyone else or Jackie with anyone else. Jackie's coming today. Got the boat all cleaned up.

48 Hours

Anchors Away

1408.505

She couldn't stop crying. She was yelling at Skyler, saying, you this, you that. You took your baby daughter and your wife on our boat. How could you?

48 Hours

Anchors Away

1424.933

Ich glaube, das Einzige, was mein Vater bewegen konnte, waren seine Hände. Er hat mir die Hände von Jackie gestolpert, um ihr ein bisschen Ruhigkeit zu geben.

48 Hours

Anchors Away

1582.605

Er hat das Geräusch hundertmal gehört, und er hat gesagt, du Arschloch, sie werden uns nicht verlassen.

48 Hours

Anchors Away

1626.016

So that's where they are right now. They're 3,600 feet below the cold Pacific Ocean, tied to an anchor.

48 Hours

Anchors Away

1690.744

The higher ups are concerned about one thing, and that is avoiding scandal.

48 Hours

Anchors Away

1739.857

Ich habe zuerst meinen Vater angerufen. Dann habe ich Jackie angerufen. Und er hat nie von ihrem Telefon gesprochen. Was ging dir in den Kopf? Ich dachte, es wäre eine letzte-minütige Reise. Ich habe mit meinem Onkel Jim gesprochen. Er ist der Vertreter der Polizei Karlsbad.

48 Hours

Anchors Away

174.857

Das musste geschlossen werden. Mein Vater hat mich angerufen und gesagt, dein Vodafone ging in den E-Mail. Das ist wirklich seltsam. Mein Vater ist der Art von Mann, dem man einen Wagen anbauen kann. Ich habe meinen Bruder angerufen und gefragt, was ist denn los, Matt?

48 Hours

Anchors Away

222.217

Ich habe Schmerzen. Du würdest nicht denken, dass so etwas jemals passieren könnte.

48 Hours

Anchors Away

2464.477

Der Tod.

48 Hours

Anchors Away

2514.708

Es war nicht ein gutes Gefühl oder aufregend. Es war traurig, weil es alles vorbei war und meine Eltern immer noch nicht da waren. Ich werde niemals die Chance haben, sie zu töten. Ich werde niemals die Chance haben, sie zu verabschieden. Und das macht mich schmerzhaft.

48 Hours

Anchors Away

338.599

He was a man's man. He was very masculine, very outdoors. Tom's boys, Ryan and Matt.

48 Hours

Anchors Away

358.633

He would take us to Catalina Island. Do a lot of hiking. Some of my better times with him were on the water.

48 Hours

Anchors Away

371.662

Oh, it was an absolute great life.

48 Hours

Anchors Away

377.865

You know, stay strong. I remember if I wrecked or cried as a little kid, he'd be like, toughen up, boy, toughen up, come on, come on.

48 Hours

Anchors Away

385.643

Ich glaube, Tom hat wirklich genossen, mit Leuten zusammenzuarbeiten.

48 Hours

Anchors Away

397.569

Tom war der Art Probation-Officer, der einen echten Interesse auf die Probleme hatte, die seine Probationer hatten.

48 Hours

Anchors Away

413.116

Tom war ein guter Mann. Ich glaube, dass Toms Familienleben, wie die meisten von uns, sehr wichtig war für ihn.

48 Hours

Anchors Away

465.36

Ich erinnere mich, er nennt es seinen berühmten Gulasch. Er machte einen Pott davon für etwa eine Woche. Und jedes Mal, wenn wir zum Abendessen kamen, war er so, äh, wirklich, das wieder?

48 Hours

Anchors Away

498.763

Jackie, she's a real trooper. Most of the time when they do something, it's my father's idea. And Jackie never complains and she just goes with it.

48 Hours

Anchors Away

519.686

Toms Ziel im Leben war es, auf dem Meer zu wohnen, auf einem Fahrrad zu leben. Er sagte, das Leben ist zu kurz und es ist mein Leben und das ist unser Zeitpunkt. Und ich fühle, wenn ich versuche, wird es einfach gehen und ich werde es verpassen.

48 Hours

Anchors Away

561.442

This is Captain Tom Hawkson, well deserved.

48 Hours

Anchors Away

606.819

Ich würde am Arbeitstag sitzen, und ich würde E-Mails bekommen, wie, die Wasser ist 80 Grad, die Surfen pumpen, und Mama macht mich zum Abendessen. Und ich bin so, pff, das ist hart. Und da ist der Sonnenschein.

48 Hours

Anchors Away

627.824

Für sie war das Wasser eine Seltsamkeit. Es war, die Kurve der Erde zu sehen und die Sonne, die jede Nacht hinter ihr fallen würde.

48 Hours

Anchors Away

666.182

Ich habe noch nie so einen großen Mund gesehen.

48 Hours

Anchors Away

69.778

All of our family memories are pretty much on the water.

48 Hours

Anchors Away

72.919

How's it going, Ryan?

48 Hours

Anchors Away

78.34

The happier times were definitely when a boat was involved.

48 Hours

Anchors Away

91.663

If my father would introduce my brother and I, it would be, this isn't my son, this is my pride and joy.

48 Hours

A Deadly Family Secret

415.253

I've never seen anybody with that much sadness put it aside and just hold on to her kids and be the strong one for her children.

48 Hours

A Deadly Family Secret

685.53

I would never hurt my husband.

48 Hours

Marriage Secrets

52.802

Ryan Reynolds here for, I guess, my 100th Mint commercial. No, no, no, no, no, no, no, no, no. I mean, honestly, when I started this, I thought I'd only have to do like four of these. I mean, it's unlimited premium wireless for $15 a month. How are there still people paying two or three times that much? I'm sorry, I shouldn't be victim blaming here.

48 Hours

Marriage Secrets

70.681

Give it a try at mintmobile.com slash switch whenever you're ready.

48 Hours

The "Batman" Intruder

52.691

Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?

48 Hours

The "Batman" Intruder

69.142

So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.

Armchair Expert with Dax Shepard

Allison Jones (Award-Winning Casting Director)

4051.848

Ryan Reynolds here for, I guess, my 100th Mint commercial. No, no, no, no, no, no, no, no, no. I mean, honestly, when I started this, I thought I'd only have to do like four of these. I mean, it's unlimited premium wireless for $15 a month. How are there still people paying two or three times that much? I'm sorry, I shouldn't be victim blaming here.

Armchair Expert with Dax Shepard

Allison Jones (Award-Winning Casting Director)

4069.714

Give it a try at mintmobile.com slash switch whenever you're ready.

Armchair Expert with Dax Shepard

Allison Jones (Award-Winning Casting Director)

4549.055

Yeah. Yeah.

Candace

TRULY SICK: Ryan Reynolds Forced His 7-Year-Old Daughter To Say WHAT?! | Candace Ep 165

496.314

Guiltily, that is my daughter, Inez. I'm so sorry we had to admit that. And I am father of the year over here for allowing her to say such language, which, to her credit, she really didn't want to say, and then came back later and said, I want to say it now, when I started looking at other people to play it.

Candace

Judge Slaps Down Blake Lively. Colleen Hoover Returns. | Candace Ep 146

2512.817

Nope, I got it. I'll get it. Here, I can do that. You're not going to read it? I will then. Okay, thank you very much. That's the one. It says, Ryan would love to have a new dad to have a catch. And I think he could really use a man in his life. Hugh is no spring chicken anymore. Blink once for yes or blink once for I'd love to be your new dad. He blinked. He blinked. Is this hell?

Candace

HYPOCRISY: Blake Lively Improvised Grabbing Her Co-Star's Private Parts | Candace Ep 170

513.154

Guiltily, that is my daughter, Inez. I'm so sorry we have to admit that. And I am father of the year over here for allowing her to say such language, which, to her credit, she really didn't want to say, and then came back later and said, I want to say it now, when I started looking at other people to play it.

Digital Social Hour

AI's Game-Changing Role in Financial Planning | Lucas Winthrop DSH #1207

300.236

Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what Big Wireless does. They charge you a lot, we charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month.

Digital Social Hour

AI's Game-Changing Role in Financial Planning | Lucas Winthrop DSH #1207

321.028

Give it a try at mintmobile.com slash switch.

Digital Social Hour

The Truth About DEI & Why It’s Failing in America | Matt Dearden DSH #1214

0.149

Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?

Digital Social Hour

The Truth About DEI & Why It’s Failing in America | Matt Dearden DSH #1214

16.631

So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.

Digital Social Hour

From Homeless to Tequila Mogul | Metta Risdal DSH #1215

0.149

Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?

Digital Social Hour

From Homeless to Tequila Mogul | Metta Risdal DSH #1215

16.631

So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.

FloodCast

S10E07 - ¡ Ay, Dracula !

30.369

Ryan Reynolds here for, I guess, my 100th Mint commercial. No, no, no, no, no, no, no, no, no. I mean, honestly, when I started this, I thought I'd only have to do like four of these. I mean, it's unlimited premium wireless for $15 a month. How are there still people paying two or three times that much? I'm sorry, I shouldn't be victim blaming here.

FloodCast

S10E07 - ¡ Ay, Dracula !

3010.431

Phoebe's uncle.

FloodCast

S10E07 - ¡ Ay, Dracula !

48.247

Give it a try at mintmobile.com slash switch whenever you're ready.

FloodCast

S10E04 - Un Elephant en Pyjama

0.247

Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what big wireless does. They charge you a lot. We charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right. We're cutting the price of Mint Unlimited from $30 a month to just $15 a month.

FloodCast

S10E04 - Un Elephant en Pyjama

21.046

Give it a try at mintmobile.com slash switch.

Girls Gone Bible

A Servant’s Heart: Serving Others Like Jesus | Girls Gone Bible

0.265

Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what Big Wireless does. They charge you a lot, we charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month.

Girls Gone Bible

A Servant’s Heart: Serving Others Like Jesus | Girls Gone Bible

21.046

Give it a try at mintmobile.com slash switch.

Girls Gone Bible

A Servant’s Heart: Serving Others Like Jesus | Girls Gone Bible

4446.257

Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?

Girls Gone Bible

A Servant’s Heart: Serving Others Like Jesus | Girls Gone Bible

4462.717

So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.

Honestly with Bari Weiss

Trump’s Second Week: DeepSeek, DEI in the Military and . . . Baby Chickens?

0.289

Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what Big Wireless does. They charge you a lot, we charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month.

Honestly with Bari Weiss

Trump’s Second Week: DeepSeek, DEI in the Military and . . . Baby Chickens?

21.079

Give it a try at mintmobile.com slash switch.

Honestly with Bari Weiss

Sam Altman on His Feud with Elon Musk—and the Battle for AI's Future

93.993

Ryan Reynolds here for Mint Mobile. One of the perks about having four kids that you know about is actually getting a direct line to the big man up north. And this year, he wants you to know the best gift that you can give someone is the gift of Mint Mobile's unlimited wireless for $15 a month. Now, you don't even need to wrap it. Give it a try at mintmobile.com slash switch.

My Favorite Murder with Karen Kilgariff and Georgia Hardstark

Rewind with Karen & Georgia - Episode 28: I 28 His Liver With Some Fava Beans and A Nice Chianti

0.189

Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?

My Favorite Murder with Karen Kilgariff and Georgia Hardstark

Rewind with Karen & Georgia - Episode 28: I 28 His Liver With Some Fava Beans and A Nice Chianti

16.656

So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.

Not Gonna Lie with Kylie Kelce

Kylie & Chelsea Handler on Embarrassing Vegas Nights, Flip-Flop Aversions & Bikini Skiing | Ep. 12

2730.458

Ryan Reynolds here from Mint Mobile with a message for everyone paying big wireless way too much. Please, for the love of everything good in this world, stop. With Mint, you can get premium wireless for just $15 a month. Of course, if you enjoy overpaying, no judgments, but that's weird. Okay, one judgment. Anyway, give it a try at mintmobile.com slash switch.

Not Gonna Lie with Kylie Kelce

Kylie & Chelsea Handler on Embarrassing Vegas Nights, Flip-Flop Aversions & Bikini Skiing | Ep. 12

2751.827

Upfront payment of $45 for three-month plan, equivalent to $15 per month required. Intro rate first three months only, then full price plan options available. Taxes and fees extra. See full terms at mintmobile.com.

Not Gonna Lie with Kylie Kelce

Kylie on Marrying Into Fandom, Pop Culture Crash Course & Postpartum Lies with Amanda Hirsch | Ep. 7

0.168

Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?

Not Gonna Lie with Kylie Kelce

Kylie on Marrying Into Fandom, Pop Culture Crash Course & Postpartum Lies with Amanda Hirsch | Ep. 7

16.639

So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.

Not Gonna Lie with Kylie Kelce

Kylie & Michelle Obama on Prom at The White House, Destined Girl Dads & Roster Height Lies | Ep. 15

0.498

Ryan Reynolds here from Mint Mobile with a message for everyone paying big wireless way too much. Please, for the love of everything good in this world, stop. With Mint, you can get premium wireless for just $15 a month. Of course, if you enjoy overpaying, no judgments, but that's weird. Okay, one judgment. Anyway, give it a try at mintmobile.com slash switch.

Not Gonna Lie with Kylie Kelce

Kylie on Crazy Eagles Superstitions, TikTok Eulogy & Surrogacy Journey with Erin Andrews | Ep. 6

0.129

Hey there, Ryan Reynolds here. It's a new year, and you know what that means. No, not the diet. Resolutions. A way for us all to try and do a little bit better than we did last year. And my resolution, unlike Big Wireless, is to not be a raging a**hole. and raise the price of wireless on you every chance I get. Give it a try at mintmobile.com slash switch.

Not Gonna Lie with Kylie Kelce

Kylie on Crazy Eagles Superstitions, TikTok Eulogy & Surrogacy Journey with Erin Andrews | Ep. 6

20.824

$45 upfront payment required, equivalent to $15 per month. New customers on first three-month plan only. Taxes and fees extra. Speeds lower above 40 gigabytes on unlimited. See mintmobile.com for details.

Not Gonna Lie with Kylie Kelce

Kylie & Kat Dennings on Irish Dancing in Bars, Stage Name Origins & Kelce Cat Game Plan | Ep. 14

0.498

Ryan Reynolds here from Mint Mobile with a message for everyone paying big wireless way too much. Please, for the love of everything good in this world, stop. With Mint, you can get premium wireless for just $15 a month. Of course, if you enjoy overpaying, no judgments, but that's weird. Okay, one judgment. Anyway, give it a try at mintmobile.com slash switch.

Not Gonna Lie with Kylie Kelce

Kylie on How to Talk to Pregnant Women, USWNT Legacy & Retirement Surprise with Alex Morgan | Ep. 5

19.431

Upfront payment of $45 for three-month plan, equivalent to $15 per month required. Intro rate first three months only, then full price plan options available. Taxes and fees extra. See full terms at mintmobile.com. I'm not going to lie.

Not Gonna Lie with Kylie Kelce

Kylie & Kate Hudson on Makeup in the Delivery Room, Red Carpet Run-Ins & RomCom Queendom | Ep. 13

0.209

Ryan Reynolds here for Mint Mobile. I don't know if you knew this, but anyone can get the same premium wireless for $15 a month plan that I've been enjoying. It's not just for celebrities. So do like I did and have one of your assistant's assistants switch you to Mint Mobile today. I'm told it's super easy to do at mintmobile.com slash switch.

Not Gonna Lie with Kylie Kelce

Kylie on Inevitable Minivan Future, Online Clapbacks & Body Neutrality with Drew Afualo | Ep. 4

0.498

Ryan Reynolds here from Mint Mobile with a message for everyone paying big wireless way too much. Please, for the love of everything good in this world, stop. With Mint, you can get premium wireless for just $15 a month. Of course, if you enjoy overpaying, no judgments, but that's weird. Okay, one judgment. Anyway, give it a try at mintmobile.com slash switch.

Not Gonna Lie with Kylie Kelce

Kylie & Jason on Love Languages, Dating Red Flags & Valentine’s Day at the Eagles Parade | Ep. 10

0.209

Ryan Reynolds here for Mint Mobile. I don't know if you knew this, but anyone can get the same premium wireless for $15 a month plan that I've been enjoying. Not going to lie.

PBD Podcast

Fani Willis DISQUALIFIED, President Elon Musk, Luigi Mangione Indicted | PBD Podcast | Ep. 523

739.36

Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f**k are you talking about, you insane Hollywood a**hole?

PBD Podcast

Fani Willis DISQUALIFIED, President Elon Musk, Luigi Mangione Indicted | PBD Podcast | Ep. 523

755.833

So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com.

Radioactive: The Karen Silkwood Mystery

Ep. 5: The Phantom Vehicle

757.025

Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?

Radioactive: The Karen Silkwood Mystery

Ep. 5: The Phantom Vehicle

773.496

So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.

Sean Carroll's Mindscape: Science, Society, Philosophy, Culture, Arts, and Ideas

288 | Max Richter on the Meaning of Classical Music Today

101.246

Ryan Reynolds here from Mint Mobile. With the price of just about everything going up during inflation, we thought we'd bring our prices down. So to help us, we brought in a reverse auctioneer, which is apparently a thing. Give it a try at mintmobile.com slash switch.

Sean Carroll's Mindscape: Science, Society, Philosophy, Culture, Arts, and Ideas

AMA | October 2024

49.076

Ryan Reynolds here from Mint Mobile. With the price of just about everything going up during inflation, we thought we'd bring our prices down. So to help us, we brought in a reverse auctioneer, which is apparently a thing.

Small Town Murder

#552 - Too Many Dead Neighbors - Kerby, Oregon

0.149

Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?

Small Town Murder

#552 - Too Many Dead Neighbors - Kerby, Oregon

16.61

So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.

SmartLess

"Ariana Grande"

1765.589

Ah non, il y avait du jeu.

SmartLess

"Ariana Grande"

30.123

Ryan Reynolds here from Mint Mobile. I don't know if you knew this, but anyone can get the same premium wireless for $15 a month plan that I've been enjoying. It's not just for celebrities. So do like I did and have one of your assistant's assistants switch you to Mint Mobile today. I'm told it's super easy to do at mintmobile.com slash switch.

Something Was Wrong

S22 E9: How Dare You

2339.448

Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?

Something Was Wrong

S22 E9: How Dare You

2355.919

So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.

The Commercial Break

12 Days of TCB: Don't Stare At The Red Rocket

25.273

Ryan Reynolds here for Mint Mobile. One of the perks about having four kids that you know about is actually getting a direct line to the big man up north. And this year, he wants you to know the best gift that you can give someone is the gift of Mint Mobile's unlimited wireless for $15 a month. Now, you don't even need to wrap it. Give it a try at mintmobile.com slash switch.

The Jordan B. Peterson Podcast

The Birth of Christ | Biblical Series: The Gospels

0.289

Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what Big Wireless does. They charge you a lot, we charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month.

The Jordan B. Peterson Podcast

The Birth of Christ | Biblical Series: The Gospels

110.126

Upfront payment of $45 for three-month plan, equivalent to $15 per month required. Intro rate first three months only, then full price plan options available. Taxes and fees extra. See full terms at mintmobile.com.

The Jordan B. Peterson Podcast

The Birth of Christ | Biblical Series: The Gospels

21.079

Give it a try at mintmobile.com slash switch.

The Jordan B. Peterson Podcast

The Birth of Christ | Biblical Series: The Gospels

24.241

$45 upfront payment equivalent to $15 per month. New customers on first three-month plan only. Taxes and fees extra. Speeds lower above 40 gigabytes. See details.

The Jordan B. Peterson Podcast

The Birth of Christ | Biblical Series: The Gospels

90.905

Ryan Reynolds here from Mint Mobile. I don't know if you knew this, but anyone can get the same premium wireless for $15 a month plan that I've been enjoying. It's not just for celebrities. So do like I did and have one of your assistant's assistants switch you to Mint Mobile today. I'm told it's super easy to do at mintmobile.com slash switch.

The MeidasTouch Podcast

WOW! France DESTROYS Trump with MILITARY RESPONSE

58.914

Ryan Reynolds here from Mint Mobile. I don't know if you knew this, but anyone can get the same premium wireless for $15 a month plan that I've been enjoying. It's not just for celebrities. So do like I did and have one of your assistant's assistants switch you to Mint Mobile today. I'm told it's super easy to do at mintmobile.com slash switch.

The MeidasTouch Podcast

WOW! France DESTROYS Trump with MILITARY RESPONSE

78.112

Upfront payment of $45 for three month plan, equivalent to $15 per month required. Intro rate first three months only, then full price plan options available. Taxes and fees extra. See full terms at mintmobile.com.

The MeidasTouch Podcast

Zelenskyy Puts the Screws into Trump… from Kyiv!

835.336

Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?

The MeidasTouch Podcast

Zelenskyy Puts the Screws into Trump… from Kyiv!

851.778

So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.

The MeidasTouch Podcast

Trump Gets HUMILIATED by WORST Inauguration Ratings

0.149

Hey there, Ryan Reynolds here. It's a new year and you know what that means. No, not the diet. Resolutions. A way for us all to try and do a little bit better than we did last year. And my resolution, unlike big wireless, is to not be a raging a**hole and raise the price of wireless on you every chance I get. Give it a try at mintmobile.com slash switch.

The MeidasTouch Podcast

Trump has DISASTROUS Day 1 in Oval Office FIRST 24 HOURS

0.149

Hey there, Ryan Reynolds here. It's a new year and you know what that means. No, not the diet. Resolutions. A way for us all to try and do a little bit better than we did last year. And my resolution, unlike big wireless, is to not be a raging a**hole and raise the price of wireless on you every chance I get. Give it a try at mintmobile.com slash switch.

The MeidasTouch Podcast

Democratic Congressman Neguse on GOP Disaster CR

0.299

Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what big wireless does. They charge you a lot. We charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right. We're cutting the price of Mint Unlimited from $30 a month to just $15 a month.

The MeidasTouch Podcast

Democratic Congressman Neguse on GOP Disaster CR

21.098

Give it a try at mintmobile.com slash switch.

The MeidasTouch Podcast

Trumpers Get RUDE AWAKENING as they LOSE EVERYTHING

0.289

Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what Big Wireless does. They charge you a lot, we charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month.

The MeidasTouch Podcast

Trumpers Get RUDE AWAKENING as they LOSE EVERYTHING

21.079

Give it a try at mintmobile.com slash switch.

The MeidasTouch Podcast

MeidasTouch RESPONDS to BREAKING NEWS on Day 1 - 1/20/25

4381.052

Ryan Reynolds here from Mint Mobile, with a message for everyone paying big wireless way too much. Please, for the love of everything good in this world, stop. With Mint, you can get premium wireless for just $15 a month. Of course, if you enjoy overpaying, no judgments, but that's weird. Okay, one judgment. Anyway, give it a try at mintmobile.com slash switch.

The MeidasTouch Podcast

MeidasTouch RESPONDS to BREAKING NEWS on Day 1 - 1/20/25

509.992

Boy, is that striking.

The MeidasTouch Podcast

Judge SLAPS Trump DOWN on Immunity + MORE

0.169

Ryan Reynolds here for Mint Mobile. You know, one of the perks about having four kids that you know about is actually getting a direct line to the big man up north. And this year, he wants you to know the best gift that you can give someone is the gift of Mint Mobile's unlimited wireless for $15 a month. Now, you don't even need to wrap it. Give it a try at mintmobile.com slash switch.

The MeidasTouch Podcast

Trump THROWS Elon UNDER THE BUS for DISASTER

59.215

Ryan Reynolds here from Mint Mobile with a message for everyone paying big wireless way too much. Please, for the love of everything good in this world, stop. With Mint, you can get premium wireless for just $15 a month. Of course, if you enjoy overpaying, no judgments, but that's weird. Okay, one judgment. Anyway, give it a try at mintmobile.com slash switch.

The MeidasTouch Podcast

Congressman Jake Auchincloss on GOP Blunders

0.299

Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what big wireless does. They charge you a lot. We charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right. We're cutting the price of Mint Unlimited from $30 a month to just $15 a month.

The MeidasTouch Podcast

Congressman Jake Auchincloss on GOP Blunders

21.098

Give it a try at mintmobile.com slash switch.

The MeidasTouch Podcast

Trump Throws Tantrum as Bad News Grows

1195.199

Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?

The MeidasTouch Podcast

Trump Throws Tantrum as Bad News Grows

1211.645

So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.

The MeidasTouch Podcast

Trump’s First Cabinet Meeting Plunges Into Disaster

904.79

Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?

The MeidasTouch Podcast

Trump’s First Cabinet Meeting Plunges Into Disaster

921.244

So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.

The MeidasTouch Podcast

Canada Leaders Issues FINAL URGENT WARNING to Trump

0.149

Hey there, Ryan Reynolds here. It's a new year and you know what that means. No, not the diet. Resolutions. A way for us all to try and do a little bit better than we did last year. And my resolution, unlike big wireless, is to not be a raging a**hole and raise the price of wireless on you every chance I get. Give it a try at mintmobile.com slash switch.

The MeidasTouch Podcast

Canada Leaders Issues FINAL URGENT WARNING to Trump

20.847

$45 upfront payment required equivalent to $15 per month. New customers on first three month plan only. Taxes and fees extra. Speeds lower above 40 gigabytes on unlimited. See mintmobile.com for details.

The MeidasTouch Podcast

GOP House BLOWS ITSELF UP as MAGA Mike FIRES Top Member

0.149

Hey there, Ryan Reynolds here. It's a new year and you know what that means. No, not the diet. Resolutions. A way for us all to try and do a little bit better than we did last year. And my resolution, unlike big wireless, is to not be a raging a**hole and raise the price of wireless on you every chance I get. Give it a try at mintmobile.com slash switch.

The MeidasTouch Podcast

GOP House BLOWS ITSELF UP as MAGA Mike FIRES Top Member

662.123

As you know, Donald Trump has been on the sidelines saying he doesn't want to see that aid go to Ukraine unless it's in the form of a loan. But just very quickly, do you expect it to get a vote this week, Congressman?

The MeidasTouch Podcast

Newsom GOES BALLISTIC on Trump in STUNNING RESPONSE

0.189

Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?

The MeidasTouch Podcast

Newsom GOES BALLISTIC on Trump in STUNNING RESPONSE

16.656

So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.

The MeidasTouch Podcast

How to Fight Back with Messaging Guru Anat Shenker-Osorio

1833.612

Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what big wireless does. They charge you a lot. We charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right. We're cutting the price of Mint Unlimited from $30 a month to just $15 a month.

The MeidasTouch Podcast

How to Fight Back with Messaging Guru Anat Shenker-Osorio

1854.408

Give it a try at mintmobile.com slash switch.

The MeidasTouch Podcast

Panicked Trump Screws Himself as Term Collapses

0.299

Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what big wireless does. They charge you a lot. We charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right. We're cutting the price of Mint Unlimited from $30 a month to just $15 a month.

The MeidasTouch Podcast

Panicked Trump Screws Himself as Term Collapses

21.098

Give it a try at mintmobile.com slash switch.

The MeidasTouch Podcast

Mexico President PUTS Trump TO SHAME in Public

0.249

Ryan Reynolds here for Mint Mobile. I don't know if you knew this, but anyone can get the same premium wireless for $15 a month plan that I've been enjoying. It's not just for celebrities. So do like I did and have one of your assistant's assistants switch you to Mint Mobile today. I'm told it's super easy to do at mintmobile.com slash switch.

The MeidasTouch Podcast

Dems Call Trump’s BLUFF with PERFECT TRAP in NEW YEAR

0.535

Ryan Reynolds here from Mint Mobile with a message for everyone paying big wireless way too much. Please, for the love of everything good in this world, stop. With Mint, you can get premium wireless for just $15 a month. Of course, if you enjoy overpaying, no judgments, but that's weird. Okay, one judgment. Anyway, give it a try at mintmobile.com slash switch.

The MeidasTouch Podcast

Trump Union Voters GET FACES EATEN by MAGA Leopards

61.452

Ryan Reynolds here from Mint Mobile. I don't know if you knew this, but anyone can get the same premium wireless for $15 a month plan that I've been enjoying. It's not just for celebrities. So do like I did and have one of your assistant's assistants switch you to Mint Mobile today. I'm told it's super easy to do at mintmobile.com slash switch.

The MeidasTouch Podcast

Denmark UNLEASHES FURY at Trump after CALL FROM HELL

0.189

Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?

The MeidasTouch Podcast

Denmark UNLEASHES FURY at Trump after CALL FROM HELL

16.667

So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.

The MeidasTouch Podcast

Trump DESTROYS Lives of HIS Voters who TRUSTED HIM MOST

0.149

Hey there, Ryan Reynolds here. It's a new year, and you know what that means. No, not the diet. Resolutions. A way for us all to try and do a little bit better than we did last year. And my resolution, unlike big wireless, is to not be a raging a**hole and raise the price of wireless on you every chance I get. Give it a try at mintmobile.com slash switch.

The MeidasTouch Podcast

Panicked Trump Gets Frantic as Tables Turn

0.219

Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?

The MeidasTouch Podcast

Panicked Trump Gets Frantic as Tables Turn

16.676

So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.

The MeidasTouch Podcast

Trump Gets Destroyed by Dem Govs in Public

1009.38

Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?

The MeidasTouch Podcast

Trump Gets Destroyed by Dem Govs in Public

1025.826

So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.

The MeidasTouch Podcast

Trump Runs to Golf Like a Coward as USA Rises Up

0.219

Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?

The MeidasTouch Podcast

Trump Runs to Golf Like a Coward as USA Rises Up

16.676

So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.

The MeidasTouch Podcast

World Leaders Put the Screws in Trump as He Secretly Begs

0.219

Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?

The MeidasTouch Podcast

World Leaders Put the Screws in Trump as He Secretly Begs

16.67

So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.

The MeidasTouch Podcast

Sen. Mark Kelly on Trump’s ‘Worst 50 Days’

0.196

Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?

The MeidasTouch Podcast

Sen. Mark Kelly on Trump’s ‘Worst 50 Days’

16.689

So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.

The MeidasTouch Podcast

BOOM! Newsom THROWS DOWN on Trump in PUBLIC

0.249

Ryan Reynolds here for Mint Mobile. I don't know if you knew this, but anyone can get the same premium wireless for $15 a month plan that I've been enjoying. It's not just for celebrities. So do like I did and have one of your assistant's assistants switch you to Mint Mobile today. I'm told it's super easy to do at mintmobile.com slash switch.

The MeidasTouch Podcast

World Leaders DESTROY Trump as he SCREWS AMERICA

0.229

Ryan Reynolds here from Mint Mobile. I don't know if you knew this, but anyone can get the same premium wireless for $15 a month plan that I've been enjoying. It's not just for celebrities. So do like I did and have one of your assistant's assistants switch you to Mint Mobile today. I'm told it's super easy to do at mintmobile.com slash switch.

The MeidasTouch Podcast

Latino Trump Voters SOBBING IN TEARS as Trump BETRAYS THEM

59.215

Ryan Reynolds here from Mint Mobile with a message for everyone paying big wireless way too much. Please, for the love of everything good in this world, stop. With Mint, you can get premium wireless for just $15 a month. Of course, if you enjoy overpaying, no judgments, but that's weird. Okay, one judgment. Anyway, give it a try at mintmobile.com slash switch.

The MeidasTouch Podcast

Colombia Prez THROWS Trump into TOTAL TANTRUM

0.189

Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?

The MeidasTouch Podcast

Colombia Prez THROWS Trump into TOTAL TANTRUM

1009.426

Ryan Reynolds here from Mint Mobile. I don't know if you knew this, but anyone can get the same premium wireless for $15 a month plan that I've been enjoying. It's not just for celebrities. So do like I did and have one of your assistant's assistants switch you to Mint Mobile today. I'm told it's super easy to do at mintmobile.com slash switch.

The MeidasTouch Podcast

Colombia Prez THROWS Trump into TOTAL TANTRUM

16.659

So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.

The MeidasTouch Podcast

Zelenskyy Punches Back at Trump Hard After Sell Out

1395.162

Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what big wireless does. They charge you a lot. We charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right. We're cutting the price of Mint Unlimited from $30 a month to just $15 a month.

The MeidasTouch Podcast

Zelenskyy Punches Back at Trump Hard After Sell Out

1415.961

Give it a try at mintmobile.com slash switch.

The MeidasTouch Podcast

Trump PSYCHOTIC MELTDOWN gets EVEN WORSE

0.532

Ryan Reynolds here from Mint Mobile with a message for everyone paying big wireless way too much. Please, for the love of everything good in this world, stop. With Mint, you can get premium wireless for just $15 a month. Of course, if you enjoy overpaying, no judgments, but that's weird. Okay, one judgment. Anyway, give it a try at mintmobile.com slash switch.

The MeidasTouch Podcast

Trump has DISASTROUS Christmas as MAGA IMPLODES

30.635

Ryan Reynolds here from Mint Mobile with a message for everyone paying big wireless way too much. Please, for the love of everything good in this world, stop. With Mint, you can get premium wireless for just $15 a month. Of course, if you enjoy overpaying, no judgments, but that's weird. Okay, one judgment. Anyway, give it a try at mintmobile.com slash switch.

The MeidasTouch Podcast

MeidasTouch RESPONDS to Trump COLLAPSING TERM

0.149

Hey there, Ryan Reynolds here. It's a new year and you know what that means. No, not the diet. Resolutions. A way for us all to try and do a little bit better than we did last year. And my resolution, unlike big wireless, is to not be a raging a**hole and raise the price of wireless on you every chance I get. Give it a try at mintmobile.com slash switch.

The MeidasTouch Podcast

MeidasTouch RESPONDS to BREAKING NEWS before DAY 1 - 1/16/25

0.189

Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?

The MeidasTouch Podcast

MeidasTouch RESPONDS to BREAKING NEWS before DAY 1 - 1/16/25

16.656

So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.

The MeidasTouch Podcast

MeidasTouch Full Podcast - 3/7/25

0.299

Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what big wireless does. They charge you a lot. We charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right. We're cutting the price of Mint Unlimited from $30 a month to just $15 a month.

The MeidasTouch Podcast

MeidasTouch Full Podcast - 3/7/25

21.098

Give it a try at mintmobile.com slash switch.

The MeidasTouch Podcast

MeidasTouch Full Podcast - 3/7/25

2315.692

Right. I may have taken away Ebola for a little bit. And, you know, I don't know. You want to know my phone number? It's boob. 8088 boob.

The MeidasTouch Podcast

MeidasTouch Full Podcast - 3/7/25

2470.444

Hamas is saying, oh, Donald Trump, did you hear?

The Rest Is History

535. Emperors of Rome: Tiberius, Slaughter and Scandal (Part 2)

53.855

Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?

The Rest Is History

535. Emperors of Rome: Tiberius, Slaughter and Scandal (Part 2)

70.325

So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.

The Tucker Carlson Show

Matt Taibbi: All the Top Secret Information Trump Is Releasing & What He Should Declassify Next

1143.609

Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?

The Tucker Carlson Show

Matt Taibbi: All the Top Secret Information Trump Is Releasing & What He Should Declassify Next

1160.063

So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.

The Tucker Carlson Show

Sean Davis: Trump Shooting Update, & the Real Reason Congress Refuses to Investigate

1169.48

Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what big wireless does. They charge you a lot. We charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right. We're cutting the price of Mint Unlimited from $30 a month to just $15 a month.

The Tucker Carlson Show

Sean Davis: Trump Shooting Update, & the Real Reason Congress Refuses to Investigate

1190.276

Give it a try at mintmobile.com slash switch.

The Viall Files

E899 Going Deeper with Emmy and Will

0.149

Hey, I'm Ryan Reynolds. Recently, I asked Mint Mobile's legal team if big wireless companies are allowed to raise prices due to inflation. They said yes. And then when I asked if raising prices technically violates those onerous two-year contracts, they said, what the f*** are you talking about, you insane Hollywood a**hole?

The Viall Files

E899 Going Deeper with Emmy and Will

16.631

So to recap, we're cutting the price of Mint Unlimited from $30 a month to just $15 a month. Give it a try at mintmobile.com slash switch.

The Viall Files

E899 Going Deeper with Emmy and Will

3349.36

Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what big wireless does. They charge you a lot. We charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right. We're cutting the price of Mint Unlimited from $30 a month to just $15 a month.

The Viall Files

E899 Going Deeper with Emmy and Will

3370.159

Give it a try at mintmobile.com slash switch.

The Viall Files

E899 Going Deeper with Emmy and Will

4912.349

Hey, I'm Ryan Reynolds. At Mint Mobile, we like to do the opposite of what big wireless does. They charge you a lot. We charge you a little. So naturally, when they announced they'd be raising their prices due to inflation, we decided to deflate our prices due to not hating you. That's right. We're cutting the price of Mint Unlimited from $30 a month to just $15 a month.

The Viall Files

E899 Going Deeper with Emmy and Will

4933.146

Give it a try at mintmobile.com slash switch.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

1110.698

I had a conversation with him and it was probably the most productive a conversation has felt. And like, I'm just such at my breaking point that I will take anything, any effort to And we came up with a big three, which was, I don't expect you to do the deep cleans. I honestly find those days to be very enjoyable.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

1131.912

I put my headphones in, I get down and dirty, you know, and his big three could be helping with the dishes, taking the trash out and like just general pick up your clothes off the floor kind of thing. That conversation was probably two or three weeks ago. And I felt like it was a very tangible, he could, that was a three things he could check off and it still hasn't gotten any better.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

119.978

And he has not ever touched a dish. He only takes the trash out if I ask. He is, I want to also say like kind in a thousand other ways, but like for some reason things can never be 50-50. And I've asked plenty of times for, you know, a little bit of help and whatnot and don't get any.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

1331.111

Uh, I don't want to, I really don't, but yeah, you want him to help out.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

1380.848

Yes, you're totally right. And you're, when you say like, it is almost just a slap in the face at this point, if he doesn't do it, because I, You know, it's almost embarrassing for me at this point that like I have a boyfriend who I'm begging and pleading for help. And no matter what I say or do, he knows that I'm not going to go anywhere.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

1402.059

And yeah, I think you're right that it does need to be something drastic. I don't want to break up and I don't want to move out. But like, what other option do I have? You know, because clearly his words don't have any value at this point and neither do mine.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

1438.845

Yeah. Yeah. I don't, I've really struggled with like where to go from here. Um, but I, And I've wanted to avoid any breakup ultimatum talks of any kind. But I think it's at the point where that's kind of just what I have to do.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

1481.669

Like I said, I told him we had a conversation about this literally last night and I told him that, you know, I just straight up don't believe him anymore, that his words at this point hold no value to me when he says that he'll do something different because they haven't changed in the last four months. So why would it change now kind of thing? And that I just don't trust what he says anymore.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

150.642

Yeah. Like any household responsibility, whether it is paying utilities, taking the trash out.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

1505.236

And it has started to fester into every other aspect of our relationship, like things that we we never had a problem with our sex life before. And now like, why would I want to sleep with you when I'm tired and exhausted? the last thing I want to do is like touch your penis. I can't, I can't do it. I'm tired.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

1569.372

Yeah. And he's mentioned, you know, in the same way that I feel like I'm not being listened to or anything like that. He does feel like I just nag him all the time and that I'm so hyper focused on it. And he feels insecure because we don't have sex as much as we used to, you know, and I, and I've told him like, yeah, I'm probably not a joy to be around. I'm probably a bitch half the time.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

159.564

He feeds the dogs. We share the finances. We're very intertwined in a team when it comes to those things. But even just the simple task of like, hey, the Wi-Fi is due and hopping on there and doing it, that is something that falls on my plate. Or if we just moved recently, trying to communicate with landlords, things like that. Those are all responsibilities that I take care of.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

1595.868

But like, I don't know what you would want me to do any differently. Like until things get better, I am going to continue to be frustrated and it's going to just get worse.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

1608.874

He agrees. He's never told me that what I'm saying is wrong. That's the hard part is he doesn't ever disagree with me on anything. It's very annoying. And I've told him I almost feel crazy at this point that my expectations are so far out there and unobtainable that I literally think I'm going insane because I must just be such a crazy, clean freak. girlfriend, whatever.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

1637.289

And I know I'm not, but I told him that you make me feel that way. And he's like, well, that's not my intention. And, you know, I never want to make you feel like you're crazy and your expectations aren't too far out there and it is doable and I will do better. And it, yeah, those words are just so nice to hear, but they don't mean shit anymore.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

1661.523

Sitting on the couch.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

1665.077

Yeah. Watching me on his phone, whatever.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

1674.102

Yeah. And usually if I say something, he will like, I'm like, hey, trying to clean things up around here. Do you think you can maybe do the dishes? And, you know, I roll and he'll go up and do it. And that's great and all. And yeah, that took it off my plate today. But what happens next week and like constantly having to ask for help gets very, very exhausting.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

1699.054

Like he's never anytime I ask, he will do it. But I don't want to have to ask anymore.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

1735.615

do it which one would you choose that sounds like a miserable life i would probably opt to break up if i knew that that was what my future was going to be i would opt to break up even if he what if he jumped right up and said sure no problem when you asked still seems frustrating still seems like i'm his mom And maybe that's unrealistic. I don't know. But I'm sure not. It's not unrealistic.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

1764.324

Natalie has to ask you to do the dishes.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

1785.168

Yeah. And I think there's blue and pink jobs of how silly that sounds. But if I'm going to clean and do the laundry and whatever, that's fine. But go change the oil in my car. If that's what it is, or hang the shelf, or do the things that if you want to be a man, do the things that a man does. But the problem is, is that I am independent and I handle my own shit. And

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

1810.883

I've told him, I was like, if you don't want to clean and you don't want to do that, that's fine. But when it comes to mowing the lawn and changing the oil in our cars and things like that.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

1826.327

At our last rental, our landlord mowed it for us. And at this one, there's someone else that now mows it as well, which is good. I guess that takes something off of, but just in the concept of life, like To me, if I'm gonna do everything else, those are some other things that you could do. Or clean the garage, maybe that's your job. But at this point, they're all my jobs.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

189.954

It's just decoration.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

195.216

Yeah, I would. And like I said, in every other aspect of our life.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

2007.641

I feared that that's what you were going to say.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

2018.68

Yeah. I don't think you're totally wrong. And I do think that he thinks I'm a clean freak. I promise I'm, I like a clean home. I do, but I'm not, I have three dogs. They sleep in our bed. They sit on our couch. They drink out of our toilet. Like there are dishes in the sink sometimes. And that's cool. Like I'm not a freak by any means. I know I'm not.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

2040.57

Uh, but sometimes it like, he makes me feel like I am.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

206.623

You're like, I mean that with my heart.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

2092.289

Like, okay. So I told you we've been dating for a year and a half ish. Valentine's day was what a month ago. Yeah. The first time he ever cooked me dinner in our entire relationship was this Valentine's day.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

2119.486

It was fine. It was steak. Yeah. And if that's what, and I've told him there's nights that I work late, later.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

2130.791

Yeah. I would love that. Yeah. I, there's nights that I work late and whatever. And I've told him, you know, if I, work from eight in the morning until nine o'clock at night, it'd be really nice to come home.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

214.577

He is truly like such a kind person. human being. We are such a good team together on every other aspect of life. Another little background is we both work at the same company, um, kind of on different sides of it, but like we do that very well together. We live together. Well, our families blend together.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

2142.078

And it could truly at this point, if it was Kraft mac and cheese sitting there waiting for me, like I would be over the moon at this point because like, it's just one thing to take off my plate, you know?

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

234.789

Well, he's kind to his nieces and nephews and, you know, like he goes out of his way to be just a good person. He really is. So I don't know why this simple task of just like being a team in the house is so hard.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

2387.455

Thank you. Thank you.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

2660.848

cle cle cle cle cle cle cle cle cle cle cle cle cle cle cle cle cle cle cle cleacacacacacacacacacacac cle cle cle cle cle cle cle cle cle cle cle cle cle cle cle cle cle cle cle cle cle cleacacacacacacac cle Athlet cle cle Athlet Athlet cle cle Athlet Athlet cle cle Athlet Athletacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacac cle cle disputos disput disputacacacac disputacac disputacac disputacac disputacac disputacac disputacac disputacac disputacac disputacac disputacac disputacac disputacac disputacac disputacac disputacac disputacac disputacac disputacac disputacac disputacac disputacac disputacac disputosket

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

308.941

Yeah. And I think like communication, like we do very well on too. We, he's very much the kind of person that if we have an issue, I can feel comfortable like bringing it up. We sit, we chat about it, none of those things. But then when it comes to this, it feels like it's in one ear and out the other. because there's no action to follow, if that makes sense.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

415.265

The bed, broom, and the... The budget, right?

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

462.494

To be quite frank, I think that his mom has always done everything for him. I actually had a conversation with his older sister about this. Truly, I was at my breaking point, came to his older sister and was like, here's where we're at. Do you have any insight? And she was like, growing up, he never had to. My mom did everything for us. She does the dishes, she handles things, and she...

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

489.502

We live in the same town as his parents now. And they she still does the same thing. You know, like if there's something that maybe I can't handle that day and he thinks he doesn't have time for, like his mom will just drop everything and go do it. And so I think it's just, he's never had to lift a finger. And so here I am, like, I truly have begged and pleaded in every way I can.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

510.725

I've been angry. I've been sad, like everything. And it just feels like it's in one ear, not the other. I mean, like this, we've, we've had a hundred conversations about it and I kind of get the same response every time that it's okay. I'm so sorry that you feel that way. I will do better. I will be better. I like, I will. And then a week, two weeks goes by. I'm still kind of handling everything.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

534.927

And I've tried to give him plenty of like opportunities, you know, like leave the dishes a little extra long and see if anything changes. And it just doesn't. And I think it's just because he's never had to before.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

552.628

I don't know. I have no idea.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

564.774

No, that's my fear is, you know, I would like to be a mom someday. And like having the responsibility of that on top of handling everything else scares the shit out of me.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

575.919

I mean, you already have that.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

579.389

No, I would like to someday. I'm telling you.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

599.417

Yeah. No, I think it would just make it worse.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

702.54

very 50, 50, it's just the act of like hopping on and doing it. But I have told him like, you know, Hey babe, can you run down and get this title thing figured out for, you know, my truck or whatever the case is. And I've straight up just said, no, I work and I don't have time.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

719.044

Like, and I have told him, and sometimes it feels like he's just adding more onto my plate, you know, of even the smallest, he can ask me, you know, where's the forks at

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

730.564

And my knee-jerk reaction at this point is just to be like, I don't know, you fucking find them yourself kind of thing because it's just festered so long that the simple tasks, I'm just like, if you did the dishes, maybe you would know.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

747.329

50-50, I would say.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

762.759

I don't know. I think that's what I'm having a hard time with. Like I said, he is such a good person in so many other ways. So I haven't wanted to ultimatum him up until this point because I just think it seems dirty to me. I don't know. So I'm just having a hard time deciding, like, when do I draw the line, you know?

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

800.571

Yeah. And I will say I have told him like, this is not a situation that I'm comfortable like continuing forward with in the future. I will not marry someone that can't. Help.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

814.907

I just won't do it. Uh, probably about a year and a half. Okay.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

820.571

Uh, we just started it, so it won't be up again until next February.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

830.584

We've talked about it. Yeah.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

87.213

Good. My name's Ryan. I'm 24 years old and my boyfriend can't do the dishes.

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

917.929

I've definitely, I guess I don't know if I've voiced this to him, but my own personal thoughts have slowed down a lot on my engagement timeline solely for these reasons. I'm a pretty self-aware person, I think. And so I've kind of halted my brain on moving forward with a

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

939.918

engagement like i truly think if he asked me tomorrow i would probably say no um just because i there's not been any actions to follow up his words okay that's good to know yeah i hope so i yeah i don't want to marry someone that can't help so i just don't like is this something that he will grow out of or is this definitely is you know well it's who he is today and i don't think he'll grow out of it he's certainly capable

The Viall Files

E905 Ask Nick - Hope is Not Your Friend

95.973

Little context. We've been dating for a little over a year. We did like move in very quickly. I would say like within a couple of months, it was just the most practical thing at the time. So kind of from jump, I'm a homemaker. I cook, I clean, you know, that's just who I am. And you're in the honeymoon phase. You want to be sweet and do all those things. Now it's been like a year and a half.

This Past Weekend w/ Theo Von

E558 Katt Williams

3953.609

Hey there, Ryan Reynolds here. It's a new year, and you know what that means. No, not the diet. Resolutions. A way for us all to try and do a little bit better than we did last year. And my resolution, unlike big wireless, is to not be a raging a**hole and raise the price of wireless on you every chance I get. Give it a try at mintmobile.com slash switch.

Unfiltered Soccer with Landon Donovan and Tim Howard

USMNT vs Venezuela Recap, Everton Shock Spurs, and the Worst Manchester United Team Ever?!

3156.271

Hey there, Ryan Reynolds here. It's a new year, and you know what that means. No, not the diet. Resolutions. A way for us all to try and do a little bit better than we did last year. And my resolution, unlike Big Wireless, is to not be a raging a**hole. and raise the price of wireless on you every chance I get. Give it a try at mintmobile.com slash switch.

Unfiltered Soccer with Landon Donovan and Tim Howard

Promotion and Relegation with Adam Crafton

3442.992

Ryan Reynolds here from Mint Mobile. I don't know if you knew this, but anyone can get the same premium wireless for $15 a month plan that I've been enjoying. It's not just for celebrities. So do like I did and have one of your assistant's assistants switch you to Mint Mobile today. I'm told it's super easy to do at mintmobile.com slash switch.