Kristen
π€ PersonPodcast Appearances
It's valid. Speaking of Catch-22's Kale, as his mom, but also as a public figure yourself, this entire episode, but also Elliot's life on TV, social media, what is this like for you? To know it, but then also have a child that wants to go through it, so you're looking at it as a parent. What is this like for you?
Have a conversation, keep spatial awareness. And that goes for not even just you, not even just your mom, anybody in general. You see somebody that you are absolutely loving their content or their media presence or an actor, an actress, it does not matter.
Just don't grab anyone. Don't grab an adult. Don't grab an elderly individual. Don't grab children. Don't grab a pregnant belly. Don't grab anything.
Not even animals. Let's not touch animals, you know? Like, well, just don't do it. No touching. Agreed. Love that.
Elliot, we're obviously referencing you as Elliot.
And that's what you would like to be called moving forward. And that's what we all call you in your personal life. Can you share with us why you go by Elliot now?
Does it bother you? when people that you've told you want to be called Elliot to don't do that? Oh, yeah.
No, that makes sense to me. When you say to someone, you know, my name's Elliot and they've known you as Isaac and they actively just choose not to use Elliot, do you view it as disrespect? I think I would.
Elliot, what kind of support do young people like yourself need when making the decision to come out? Do you even feel like it's necessary to actually come out? What are your thoughts around that?
What kind of support do you feel like you've had that other kids do not have and could use like any, I don't want to say tips, but for parents out there, like how, how best can we support our children who are part of the queer community?
I have way too much free time, said no one ever. Work, appointments, family and friends, life is nonstop. And trying to find a new place on top of all that, completely overwhelming. That's where Apartments.com comes in.
If you want to make time for the things you love, but you still need to find your next home, Apartments.com has tools to make your home search so much easier, and it's all on one site.
With 3D virtual tours to get a peek at a rental listing, online tour scheduling, plus the ability to see the exact unit you're interested in and apply for a place with one click, renters can handle it all on Apartments.com.
Whether you're looking for a three bedroom condo downtown, a two bedroom duplex in a quiet neighborhood, a cozy studio in a walkable city, or even a single family home in a cul-de-sac, you can find a place that checks all the right boxes. So whichever stage of life you're in, settle down in your perfect home by using Apartments.com.
Make your move from the comfort of anywhere and make more time for you. Join the millions of happy runners and visit Apartments.com, the place to find a place.
That's, in my opinion, because people... There's still a stigma around it, and it goes against the nuclear family bullshit that we're all fed from a very, very young age, and that it's wrong if you're gay, or it's like... It's a very weird thing, at least coming from me as a straight person. I see it to me.
It's also like it's mostly coming from people that are not comfortable within their own sexuality. Right. That perpetuated.
Or with your generation, have they taken those roles and the stereotypes more out of it than how your mom and I grew up? Like, is it looked at the same where everything your mom just explained about Elijah? Do you even identify that as masculine in your generation? Because you might not.
Okay. So some of it still bled through to your generation. But some of it is not necessarily identifying this trait as masculine or feminine. Like, if you saw a man crying, would you say that they're feminine?
So I know this episode was planned out for a while. Yeah. And you had had a lot of conversations with mom and things like that. And then unfortunately your plans were disrupted by somebody publicly posting some photos that were shared on a private Facebook page from prom. Do you want to talk about that? How it made you feel? The impact that took on people around you?
And just take us through what that was like.
We've got a nice little closed production today.
Elliot, it was super important for you to set some expectations with the listeners and viewers of this episode. Do you want to go into a little bit of detail about that?
You guys were planning the episode before that happened. Yes.
And that was on your terms that was having conversations like what we're having now, which I'm very glad that you still wanted to, you know, share it this way and have everything out in your own words. I know you had told me that you went to mom about wanting to post something immediately.
In depth?
So after the incident with your information and your private pictures being leaked online, you had shared with me that you went back to mom and you wanted to immediately post something.
Mom shared with me that she... it was a very interesting position. I would love for you to speak on that kale because you've had a lot of us tell you sleep on it. Don't do that. Now you're going to regret it and you hate every bit of it every time. So what was that?
What was that like for you, for you to be in that position when you have already had the feelings and the experiences of us telling, you know, while you were saying that I pulled up the conversation between Elliot and myself.
what was that like having to tell him, like give him the advice that you've been given and hated? What was that like?
If you take anything from this experience, looking at someone who's been on the emotional side with your mom for a very long time and also seeing how public reacts, you're never going to be able to. People are going to perceive things however they choose to, whether they come in with their own narrative or their own issues and they're triggered and whatever.
1000%.
Those make-outs that should have been breakouts. The drops that were cemented in pop. I'm talking Bennifer. Tyra vs. Naomi. Tom Cruise jumping on that couch. And so much more, so please rate us, subscribe to us on Apple Podcasts, Spotify, or anywhere you get audio-related content. We also take memo. And cash app. ACH? Or credit card number as well. We're malleable, you know? We're gay today.
Agree. We got to have a phone conversation about what you wanted to talk about in this episode. And something that you shared was that it's really important to you to enforce boundaries within your private life. And you're also trying to do that within your public life now. Do you want to talk about that a little bit?
Kayla, you said something really interesting that you want to put all of your stuff out there. Do you feel like that's actually the case or do you feel like you have to before someone else does?
Elliot, do you feel like watching your mom go through this? At what point do you feel like you started paying attention to the things that she goes through specifically on social media? Take the TV out of it and like the filming aspect. But at what point do you feel like you started paying attention and deciding for yourself when you decided to go on social media? I want to operate this way.
I don't want to operate that way. Maybe in your personal life, you talked about the boundaries that you have for the people around you. When did you decide to start having those and like implementing them?
For when you decided to start having your boundaries within your personal life, at what point do you feel like you gained the confidence to start doing that and implement those? And was it because of things that you've watched? Or was it like you were like, I need this for myself?
Yeah, because I feel like if you were doing like this, it would be hitting at an angle.
Yeah, because you have to get your, you would have to have your hand like this, basically.
When I was trying to see like things that there were to do there to like send some suggestions, it, everything that I was finding was saying that it's not like the most family friendly thing.
like place to go for an extended period of time there's just like not too much to like do and um it's funny because i was talking to alessandra about it and i was like telling her about like the ski thing that i had found and you were like you have to own your own skis and she was like well it kind of makes sense in europe like because that like people would have snow gear and stuff like that and they spend it's so easy for them to travel country to country to country in europe
it's not like we're not used to that. So like for us, it's foreign for them. It's not.
That's usually a good question. Cause I have never like the only trains that I've ever taken in my life are literally to New York city. And I only take the express because I don't want to be on it for like an extended period of time. So like, I don't know, but I know train traveling by train is so popular in other countries. Like that is like their main method of transportation and stuff.
And I'm like, what would that be like? Like I've never investigated like train routes to anywhere else besides New York.
12 days, I feel like, is such a long time. And, okay, so let's get into the soccer portion for Lincoln. Because, like, I've gotten zero updates. Like, is he loving it? Does he not care? Is he, like, thriving? Is he not? Like, what? I need to know all the things.
Which is so not a thing for you guys because you and Javi are like at every practice. So how are you guys dealing with that?
I think that's also really cool for Lincoln that all of you guys got to come for him.
And you had walks there and Creed there, like his, some of his siblings came. Like, I don't think this is, I think Lincoln will always remember this. I don't think this is something like that he'll ever forget.
I think too, like, maybe if you knew how much you would not have seen Lincoln.
So is this the picture that you were going to send me? And I was like, don't do that to me.
You have had strep in 13 years? Yes. At least 15 times. Do you know how many times I've had strep in those same 13 years? Never. Hasn't happened. It's not, it's not common. Like in adults, it's not common at all. I do know a little bit about strep, like bacteria or whatever. It is so like, It is everywhere. It is so everywhere. So I think personally, you are so affected by lack of sleep.
The way that I would have been traumatized.
Lux was- Oh my God, you had the kids. I did not even like, wow, wow.
It's so interesting to me because we've had conversations before about how I have someone in my family that he is Puerto Rican and Egyptian. And his dad's Egyptian. His dad's also Muslim. So his dad does. Yeah, they don't do pork. So out of respect, he does not eat pork in front of his dad or around his dad. He has a twin brother and neither one of them will do it.
And I was telling you about it because I didn't understand. And you were saying how like poor Muslim people. It was something about pork is, like, dirty.
So, like, here, you're somewhere else, and they, like, it seems like it's, like, a delicacy.
That's so interesting to me. Like, just in, like, how some, you could literally have both sides of pork.
Oh, my God. I never, I, because I literally have never left the country, I've never even, like, researched, like, other cultures.
so i'm just like now that makes me want to know like what foods do y'all not eat compared to like food oh that's a good question so that is really intriguing to me because like i wonder if it's the same thing with like i wonder if there's anywhere that doesn't eat chicken i'm sure i'm sure there's places that don't i mean i don't know that's a good question i don't know food poisoning is big around here
When I Googled that and found that out, I was like, no, I'm telling this bitch immediately because she's got kids that'll be puking everywhere.
So when I was looking stuff up, it seems like it was a collective understanding that like we didn't know that Spain's food is like notoriously not good.
Okay, so did you think that though going in?
Because you're pretty like well-versed, I would say, when it comes to different shit like that. Because you tell me this shit all the time and I find it so fascinating. You don't know the difference. I literally, in my head, it's a category of like, this is spicy. And it's crude. And that's just Spanish.
Like I think there's a lot of things that affect people differently. I don't think not sleeping is good for any of us, but like I can handle not sleeping. Like it doesn't do to me what it does to you. Like my brain will be foggy, but like you get fucked up like you immediately.
Is it probably lunchtime over there? It's 1.18pm here, so it's 7.18pm where you are.
But I don't understand why anyone cares what you're eating in Spain. We should be eating at Olive Garden in America.
Okay. Okay. Yeah. You can always find Asian cuisine somewhere, like everywhere you've been. Maybe.
That's what I'm saying. Like, I don't understand why anybody would care what the fuck you're eating. Like, did I initially think you were crazy when you were like, I'm getting like a burger. But then you told me about the seasoning problem and I was like, well, you got to try it all until you find something you can eat or else you're going to starve.
What else? So what else has been different? You were telling me about like, there's no like, um,
And it's actually crazy now that I put this connection together, because when you were texting me about your neck and your throat and whatever, I'm out here thinking like COVID or the flu or something like that.
I was shocked. Like when you were initially telling me like all the things I was so shocked. But that's like because I'm naive because I live where I live. You know what I mean? Like I have a Wawa on every single corner. If I don't have Wawa, I have 7-Eleven.
Never did I think strep, even though I knew your ass has been up all the time because we've literally texted basically the whole time you've been gone at every single hour that I've been awake. So I didn't put the connection together, but like, and you get strep bad. Like I have never in my life seen someone's tonsils swell to the size. I don't know how you breathe.
But a Coke, you can get a Coke anywhere. Which we love. But you did tell me it is not the same thing as a Mexican Coke.
They are good, but... I was going to say, like, whose is better, Spain's or Mexico's?
I mean, think about our lifestyles. We are, most of us, unless you are like working on your feet and with your hands and things like that, most of us have office jobs to some degree where we're completely sedentary. Then we get in, what do we get in? Cars, trains, buses, whatever, to subway system, all that, all those things to get home. What are we doing? We're sitting again.
What is like a huge pastime for people? Sitting and watching TV, sitting and watching sports, scrolling on our phone. Like everything is about like sitting here. It seems like Europe in general is the complete opposite.
No. And truly, I feel like even softball, like anytime I'm trying to think of people that I know that play like group sports as adults, like everything I know about them is they also like proceed to get wasted either like before, during, after, maybe all of it. So I feel like that's counterproductive, you know?
They look like balls, literal balls in your throat.
Yeah. No, I would agree. I would wholeheartedly agree. I mean, I have my own thoughts on the drinking age. I think it's insane that you can sign up for the military and do a bunch of things at 18, but you can't legally drink till 21. We've got it ass backwards on a variety of levels in the United States.
How fucked up do you think you're going to be coming home?
Yeah. So dinner, should have already eaten something for the day, haven't, but I'm about to eat some leftovers.
I feel like if you can get a direct flight, get that.
Elijah, tell me, tell me how you feel about space. Wait, what are you reading? Let me see that.
So who read it first? You read it first and then Elijah's reading it now?
So Elijah, when are you going to come on chapter seven book club?
You're not going to gain 20 pounds. You're definitely probably going to gain at least five from everything that I know from people's like stories about Europe. They lose a shit ton of weight when they go. And then of course, like our food's disgusting, like with chemicals and preservatives and whatever. So they gain it back when they get home. Plus you're not walking as much.
You're not doing all the things. So you probably will gain a little bit of weight. You're probably going to swell a little bit just because we have nasty stuff.
Yeah. How excited are we about the boob job? How excited are we about the boob job?
I think you're going to be a C. I would like to be whatever Lindsay is. I think Lindsay's a full C. She's like small D, full C, for sure.
now that we had our little guest appearance from Elijah. So like, how has it been? This is your first time traveling internationally with each other. So like, how has that been?
But that's, I mean, that's the time of year as a whole. I think everyone is ready.
for a break everyone's ready to like rip someone's head off because none of i don't know anybody in my personal life that like i know a few people in my personal life that slow down but i don't know that many people that slow down even when your bodies and we as women are so bad at that like that was like one of the first things that my neurologist told me he was like um with everything going on with like the ms and whatever he was like um
MS is a women's disease. It affects mostly women in their early 30s. It's usually when you start getting symptoms and things like that. And there's huge links between living life of trauma and doing for others instead of paying attention to yourself. And that's just diseases as a whole. When you don't listen, your body is going to deteriorate.
But you had also done it. You had been flying so many times before you decided to bring all the kids. You know what I mean? So I think that that's different. I'm sure that traveling with kids, I mean, having kids in general is like a whole different beast, but I'm sure that like
Adding travel to that, like international travel is hard enough, but then adding kids to that because they do have way more energy than we do. So like, they're not going to want to just sit there. Like they don't want to have relaxing days. Like they don't, they haven't hit that phase in their life where they like naps yet. You know what I mean? Yeah.
No, that is, that's actually really cool. Cause I'm very interested to see if you guys continue reading similar books or if you only did because like, that's what you had. But like, I wonder if he's going to pick his own books. Like I want to know Elijah's TBR.
That's going to be what you tackle when you get home is reorganizing your books.
I mean, I'm not a proponent of spending extra, but it looks like you might need to.
No, I think that's so cute. I think there's always, I mean, there's negatives and positives with every trip, right? Like, even not internationally, but I think that while the experience of Spain itself, like as Spain might not have been great, it seems like you've had a lot of other things coming from being in Spain that are good.
Like, yeah, exactly. Who knows? Like funny jokes down the road. You know, I think that, I don't know. I think about like, just like, like I will, my dad always was like the vacation planner. And this one time he sent me and my mom to this, like, basically it was essentially an Airbnb before Airbnb was a thing that he had booked. And we went with my mom's friend.
And like the way we still talk about that shit to this day, because we thought me, my mom and her friend and her daughter all thought we were getting murdered on that trip. Like we still talk about it. It was the worst trip I've ever been on. Shit was horrific. Our door had bullet holes in it.
horrific horrific yeah it was like our the door to the thing had bullet holes in it um the the owners were just incredibly creepy there was there was like a girl hiding in a locked staircase it was there was like a I'll have to tell you one day but We think about that to this day. And like, that was a trip my dad wasn't even on. So it was a horrible trip. My dad wasn't there.
Tell me about that. Like what? So I know you signed up for Thanksgiving dinner the same day that you had whatever the pig experience was. So What was Thanksgiving in Spain?
So you thought you were going to go to the hospital and die. I was like, we're finding someone to like concierge medicine.
It was, um, if I read the menu correctly, I think it had truffle in it.
And maybe people can recommend places to go that have better food.
collectively we will not be back to this location yeah i mean it's a it's a one and done it's a one-time experience once in a lifetime i cannot wait to get home do you think they still sell whole turkeys after thanksgiving wait back the fuck up did you hear about the whole butterball turkey incident that was going on what did you not see this all over tiktok no
It was like factually proven, this is not alleged, that Butterball turkey, like Butterball, was, they were getting, I don't even know the politically correct term for this, but men at the warehouse were having sexual relations. No, they weren't. With the Butterball turkeys prior to Thanksgiving. No, they weren't. Yeah, they were.
I ate prime rib multiple men yes ma'am in multiple warehouses or in the same one um I don't know if it was multiple where I'm about to look this up for you um ma'am how were they caught and what the fuck is going on I I don't know um I don't know so I'm pulling this up right now you gotta be fucking with me right now Something was getting fucked and it's not me fucking with you. So PETA.
Wait, before they were alive? I mean, before they were dead? They came out with a YouTube video talking about it's not just Butterball, the disturbing abuse of animals. Animal sexual abuse on farms happens every day across the country. Our investigators have witnessed these acts.
I think yes, and probably also while dead, if I had to guess. If there's people sexually abusing corpses, I'm gonna go... Like, human corpses, I'm gonna go with... They've probably done it to animals as well.
Yeah, I found it. Okay. On November 5th, the nonprofit organization posted an interview clip with an unidentified investigator who claimed he witnessed harrowing instances of sexual assault against the live turkeys at the Butterball plant. In the graphic video, the undercover worker accused a Butterball employee of shoving his finger up a turkey's cloaca.
Another worker allegedly humped a turkey while it was restrained. So you're not missing much in the United States right now.
I don't know, but yes, they sell them. Don't get a butterball. Cause I don't know who's been in it. Um, but we ate prime rib. We didn't do the turkey this year.
of having like in it yeah that scared the shit out of me which it's funny because when I was like looking at where you were to find like restaurants and stuff and I was like on your location I already had found the nearest hospital which was across the highway but then when I googled it it had bad reviews so I was like we're not sending her there I always get prescribed prednisone when I have it because my my tonsils get so big so it helps the swelling and I was like
I'm not entirely sure what's going on. I'll have to do some follow-up investigating on that one. But I literally was like, you know what's sad? This shit didn't even really shock me. Like, there is not much in life anymore, especially with human beings, that shocks me.
No, it is. I'm so desensitized that it's not even funny. And I think, like, that's just us as a generation across the fucking board. And that's, like, really scary to think about. But I literally was just like, for what? Like, why would you do that? Like, what is wrong with a brain that would make you think that that was a great idea?
I was disgusted, so I was just like, okay. So we skipped out on the turkey this year.
And honestly, I'm not really a turkey fan anyway. So I always say I'm a sidesgiving type of bitch because I don't fuck with turkey. So I do all the sides and no meat. But this year, we didn't even have groceries until Wednesday night, so we did prime ribs.
Life has just been lifing. And like, I feel like just across the board, I was, we were so unprepared for Thanksgiving. Like we had plans like a month ago, what we were going to do. And then it just started getting closer and, Life is just life. And I was like, hey, guys, like, what are we doing on Wednesday? I called Corey at work. I'm like something about groceries.
Well, first of all, I was down sick for like a solid 24 over 24 hours puking my guts out the Monday preceding Thanksgiving. So I was like, I don't even know if I'm going to even be eating anything at that point or if I'll be alive. I didn't know because it was so late.
It was really, really bad. So I was like, I don't know. And then Wednesday hits and I was like, hey, like, what's the plan? And Corey's like, oh, your mom got groceries. And I'm like, no, she didn't. And he's like, she told me she was going to. So I call my mom at work and she's like, no, I didn't. And I was like, okay, so we're going to- One thousand percent.
I was like, our communication is trash in this house right now. So we just whipped it together. And I was like, OK, well, fuck the turkey. Let's do prime rib. Yeah. Well, that's like actually awful, given what I just said. Not not do that to the turkey. But we're going to skip the turkey. And what if we did like first I said steak, but it was going to it was nasty here on Thanksgiving.
Like it was so rainy. No, it was just pouring rain. So I was like, let's do steak. And then I was like, nah. And then I'm like, oh, why don't we do prime rib? Usually prime rib is our Christmas day dinner thing. That's the only time of year we eat it. So I was like, well, what if we just did it now?
And then usually we do mashed potatoes, but I had this like recipe for scalloped potatoes in the crock pot that I wanted to try. So we did that. And then I wanted green bean casserole. So I made that. Mom wanted her candied sweets. She did that. Corey wanted asparagus with like panko and Parmesan. He did that. Corey ended up cooking everything yesterday.
You got to try it. It's so good. It's like our favorite way to eat it. And you like put it in the oven so it like crisps up.
I've been in my crock pot era lately, so I have a lot of recipes to send to you to try.
Crock pot's the way to go. So we had two crock pots going. I did, I did my, um, green bean casserole in a crock pot. And then I did my, um, I did, we did the scallop potatoes. So freaking good. Totally worth it. We made like a beef stew like two weeks ago. Best thing ever. Corey made this like cheesy chicken and broccoli rice thing. Bomb. Like we've been killing it with the crock pot thing.
So I'm so tired of eating out. And like, it's the same thing every single day. It's like, nobody wants to think about dinner. Until it's like four o'clock, five o'clock, six o'clock at night. What are we doing for dinner? Well, now there's nothing taken out. Nobody prepped anything. No one's in the mood to cook. Like it's just annoying.
So we, I was just like, no, we're going to start crock potting. And I've been sending Corey recipes that I find on Facebook. He's doing the majority of the cooking and stuff because he gets done work like usually earlier than I do. So he's been doing that and we've been fucking thriving. It's been great.
Try two weeks. Sounds good. In theory. I used to try to be on prep for two weeks and get all the stuff for it. A lot of stuff would go bad. So try it for like, do like one, one week.
You know, you guys deserve it after the lack of seasoning experience. I also wonder if you guys have been like off seasoning for this long when you get home and try like and season like what you're going to think. Like I wonder if your taste buds are going to change.
When you told me how fast they were coming, I was like, what? we couldn't, that would never happen here. That would never happen here.
So I was like very thankful, but also very jealous. Cause I was like, damn it.
But literally could never be us. I had to tell you.
This was one of my birthday gifts from Corbin.
I am with, especially with, your handy dandy straw toppers that you got me?
I'm not. I, this is me when, if it, if it's like, if he forgets to put one in and it sat there for a little bit, I'm like,
Replace the straw. Yep. I am so suspect about it. I don't know why. I'm just like, there's definitely a bug in here. I don't know.
I think that really did me in. Like, for you. Thanks. Thank you. I think that really, I'm also eating alongside you. This would be Thanksgiving leftovers.
I need to know why. Go ahead. Is it seasoning? Is it spice? Is it flavor? Like, what is bad?
I feel like now. Your next big invention is going to be, like, travel-sized condiments. Because, like, it's got to be. It has to be, like, a universal problem, I feel like. Like, there's got to be more countries and stuff that have, like, no seasoning.
Which is, I mean, they say that Europe has, like, the healthiest food and stuff. And I love that. Do we feel like you've lost weight? Because your face looks thinner.
I mean, probably. Like I'm probably eating chemical-filled things at this exact moment, and I made them from scratch. But I made them with things that weren't from scratch.
I was so, I was also just very impressed. like so impressed. Like I love resourceful people. I follow so many resourceful people. Cause I feel like it teaches me stuff and I love learning new stuff all the time.
We, and I not to that level, but like we, like I'm talking like within the last six years, we used to dollar store food shop, like to just put it together with whatever we could do. And some of those meals were like, probably not the best for you, but like,
They fed me. Yeah. Literally no complaints. That's why I'm always like, I think people forget about dollar stores for like anything in general. Yeah. It's not a dollar anymore, obviously with like inflation and stuff, but like, I think people do forget that they exist. No, for sure. To a lot of people.
I hate that shit. Nothing. I don't think anybody that's ever sharing anything deserves to get any type of like hate. I don't believe in that at all. To me, I'm just the type of person that's like, if I don't agree with something, I might shit talk about it to you.
Like I'll send it to you, but I'm not going to comment on their shit or I'll just keep scrolling and be like, that was the dumbest shit I've ever seen. Like it doesn't apply to me and I'll keep going.
why is that such a difficult concept like why does everybody feel the need to like project negativity and bullshit on everybody all the time well they don't have to leave it in the comment section like it's so to your friends or do you not have any because you're a shit person i don't know That seems like it's, it could be that too.
Tell me all the things that you've done in Spain so far.
It's so funny you say that because I actually stumbled on a TikTok that was showing Abraham Lincoln's deathbed. Okay. I didn't even realize that he died in a bed. I thought the story ended at he got shot at the theater.
Okay. So never, I didn't go past the got shot part ever. Like just didn't. So I was like, what the fuck are they talking about? So I'm like looking at it and they like have the bedroom supposedly like, like it looks like a bedroom. Like it's just a place you can go, like go see is like the bed thing. But I'm like, I'm confused at like why the bed looks fine. Like the bed's made and stuff.
There's no like bloodstains, like that really confused. I'm like, if you're going to like make it into like a artifact type thing, why would you not leave it as is? Like, so I was thinking the same thing. So now that you're saying it about like the royal palace, I'm like, okay, at least I'm not crazy. So I didn't think anyone else was thinking the way I was thinking.
Should we talk about why you got strep throat? Because it's absolutely because you haven't been sleeping.
Well, there was a read receipt.
Well, I mean, we met through mutual friends and, you know, we just kind of clicked and we went to a concert together and I thought we had a great time. And yeah, I haven't heard it from him ever since. And, you know, I'm trying to figure out maybe why that happened. And I'm yeah, I'm at a loss.
So we went to a concert and we had a couple of drinks and we made out and I think he was looking for something maybe a little more And I kind of backed out. You know, I'm not kind of looking for a hookup right now. You know, I think maybe I sang too loud and got a little drunk. Maybe he didn't like my singing. I can get a little loud and boisterous. So maybe that maybe scared him.
I mean, that's what you're supposed to do at a concert.
I mean, I thought it seemed okay, but now that I haven't heard from him, I'm really trying to rule out what the possibilities were. And, you know, I wish he'd be an adult and, you know, have a conversation if there was an issue. Maybe it's just he wanted to hook up.
I guess, you know, and it's a real bummer that he couldn't just be up front and tell me that, you know, if that was what he was looking for and, you know, I wasn't giving what he wants. He could just be an adult and say like, hey, you know, for whatever reason, I'm not interested and be gracious about it as opposed to just hiding.
Yeah. Yeah, he was kind of handsy and, you know, kind of got a little below the equator. Okay. And, you know, I kind of pulled his hand away and I'm like, I don't know if I'm ready for this quite now, you know. We ended the night on a nice note and, you know, I didn't really want to take it any further for the first date.
Yeah, no, no, no. You know, I mean, he wasn't thrilled about it, obviously. But yeah, I just, I don't know why he ghosts me about it. He could have just been upfront about it.
at the beginning you know and that's kind of what I want to find out a little bit more about and you know if there's a good reason why he ghosted me then you know, I'd be really interested in potentially having a second date, but you know, I guess we'll have to find out why.
Yeah, so Garrett and I met through mutual friends. We went out on a date because we clicked almost instantly. And we went to a concert and... After the show, he ghosted me. It's been three days. I sent him a text. He left me on read. And yeah, I want to figure out why. Like, did I get a little bit too drunk? Was my singing really loud and bad? Or was it just that he was looking to hook up?
And I'm not too sure which one it was, but he seemed a little bit upset when we were making out and his hands started to go a little bit south. And I told him I wasn't looking for that. So I want to figure out why. And if there's a good reason, then, you know, I'd love to have a second date.
Yeah, OK.
Nice to hear from you. Yeah, I didn't know I would. What happened? You know, I texted you three days ago and, you know, I said I had a nice time and you disappear and ghost me. Like, what's up with that?
Yeah, well, I mean, the thing was, like, we met through friends, and if you wanted to hook up and we were drinking that first night, why didn't you just take me home with you? Like, I don't understand, like, why would you go to a concert and make it an event? You know what I mean? Like, if you wanted to hook up, we could have done it that night when we were just drinking together.
Like, you bought concert tickets. You picked me up. Like, we went to a show. I thought maybe you were a little more interested.
This conversation is wild. You can't text me back like an adult and say, Hey, I had a nice time, but you know, maybe we're not looking for the same thing. Like you could at least be courteous. Everyone's on their phone the entire time. Like everybody's on social media and you say you're too busy to respond to a text. Like that doesn't apply.
The most obvious form of ghosting.
I mean, he could have just been up front, you know, and just said, hey, like, you know, I'm looking for this. And if I said I wasn't looking for it, then it's like, okay, well, we can't give each other the same thing. Have a great, you know, life.
It's supposed to be implied. Okay, you think I'm a mind reader? Like, what's up with that? That's so rude.
Thank you for your honesty, but yeah, I just, you know, you could have had better communication.
Well, Garrett, how would you feel if I said I actually want to sleep with you? I just didn't want to do it on the first date.
All of a sudden, no. Yeah. Not on the first night. So what does that mean then? Is this going to happen?
Hi, I'm, besides being ghosted, doing great. How are you doing?
Like three days. Well, that's not too bad. Well, around the three-day mark, I don't know. I feel like he's probably not interested, and I want to kind of figure out why.
And for a body such as TDLR to be overseeing and determining what kind of education is best, what kind of practices are best, and determining the consequences for if you steer outside of your practice scope, it's laughable.
How this works is that you go to TDLR's website, there's a complaint portal, or you can go to the midwifery licensee section of their website, and then there's an area for you to file a complaint. So you can file a complaint online or written online. I actually didn't know that you could file a complaint online.
So I wrote out my complaint and then submitted it, but then it wasn't getting any traction. Like I didn't hear back from TDLR. So I went back and did that online complaint. And that's kind of when things started rolling. Me and Markita submitted our complaints just a couple of weeks apart from each other, maybe not even that. So how that process works is they accept your complaint,
You get an email or even a mailed in letter stating that we have received your complaint. The next step here is going to be an investigation. An investigator will call you to record details of your complaint. That's what happened. She asked me to recount my story and tell her all the areas where things had gone wrong.
I told her my story top to bottom, including labs and medical discrepancies, things of that nature. She recorded that and then it gets investigated. And during the investigation period, they look at all of the records that you send over to them. They ask you to submit any records that you have pertaining to origins.
And then they will also ask you for a release of medical records so they can contact the facility and the hospital that you were seen at. I'm not sure what entirely goes into the investigation process. I believe that they fact check and then they compare your story to their admin code. There are specific admin codes for midwives that they cannot violate.
And if they violate it, it's a direct breach of TDR's policy. then they will start an internal prosecution for this. Let's say I charted incorrectly. The disciplinary action for that would be $500 and a continued education on proper charting. And that is just an example. That's not a quote directly from the admin code or even from TDLR's rules, which are available on their website.
You can see disciplinary action and its correspondence to the violation that it cites and what those typically look like. From my own story, I mean, some of the violations were like some of the worst things that you can do in terms of violating any of those rules or admin code. I believe this took a few months of investigation. And then finally, it was submitted to prosecution.
Me and Markita began to meet up. We poured over her records and my records. I was trying to understand where legally they had messed up and where they had violated a direct code from their bylaws. And then also trying to help Marquita with that as well, because what happened to her son was absolutely preventable.
My case has been in prosecution for a year now, and there still is no conclusion to what is going to happen. I have reached out to TDLR several times. In regards to new things that I learned about my case, for example, when I found out that the financial director of Origins was balance billing people willingly and knowingly and then refusing to send me my medical records.
I sent a long email to the prosecutor on my case stating that I had a few concerns. My complaint against Jennifer Crawford suggested that she was practicing medicine without a license during the duration of my pregnancy, not just with me, but with every patient that was at Origins Birth and Wellness until 5-22 when Jennifer was licensed by the state.
I had concerns about how TDLR will handle that because practicing medicine without a license in the state of Texas is a felony. You can be jailed for up to 10 years of your life. It's a very serious thing. However, that particular criminal charge is overseen by the Texas Medical Board, and it is used on people who are practicing medicine, such as nurses or doctors, without a license.
Technically, midwives are not in their jurisdictions. There would need to be a thorough investigation of every patient's records from when Jennifer allegedly started working for Origins to determine the severity of the policies in the admin code that she violated. She was seeing many people unattended without her preceptor.
When me and Markito were discovering this, we had a lot of hope in the system that if we made these reports, that the right things would happen and we would receive justice. TDLR spoke to me directly about my case. So this was their response to me. Thank you for your email. I am working on your case right now to answer a few questions that you asked previously.
Our role at TDLR is purely on license violations rather than criminal activity, even though they can be intertwined. I'm aware that there are other state agencies looking into this matter as well. I do not have any details. You are always welcome to contact law enforcement and make a report to them in regards to criminal activity.
We do have subject matter experts that we contract with to help us determine violations when needed. We also have rules relating to billing and medical records, which we will look at when determining any violations. My response to that email was, thank you. From what I read in this email, TDLR is not required to report criminal activity that has been found in complaints, question mark.
Also, are subject matter experts only licensed midwives? Then I stated that seems very strange, such as in my case, I had severe preeclampsia and other high-risk conditions in my pregnancy. Licensed midwives specialized in low-risk pregnancy are not trained to assess high-risk conditions. Therefore, they are not experts. They are not experts in prenatal pathology.
Is TDLR qualified to assess these medical intricacies of maternal and neonatal health? I understand TDLR's purview is to oversee licensing policies, but there is so much at stake in these complaints. My prosecutor's response to that was, based on the limited authority that our agency has, we do not have a requirement to report suspected criminal activity.
However, there is nothing that prohibits you from being able to file a complaint to law enforcement. you are welcome to share that TDLR has an open administrative case as well. We use subject matter experts that are licensed by TDLR as it would be improper to use medical experts with greater education than our licensees.
And I also wanted her to get recourse, knowing that I couldn't get recourse myself criminally or through malpractice insurance. We poured over her records and my records. They went so far as to falsify my records by signing off on my records saying that they were Jennifer's preceptor. I had never met Gina or Caitlin ever. They were never in clinic with me.
We prefer the case to be reviewed by someone with the same expertise and training as our licensees to properly evaluate the standard of care and whether it was violated in this case.
TDLR licensed experts know the applicable laws and rules from the administrative licensing side, whereas using an expert that has a different regulatory agency with different rules and laws than ours would be inappropriate. So it is another licensed midwife who are overseeing these cases. I'll tell you why it doesn't make sense. You have people who do not specialize in
who are not trained or educated in the pathology of these abnormalities associated with maternal or fetal health. Reviewing these cases, reviewing these charts that are often incomplete. My charts are not complete. People who were charting were leaving out symptoms. Even my BP was different in a couple of cases.
And I think it's important to note that per NARM, the North American Registry of Midwives, they state that every midwife has to come up with their own guidelines for their practice. So of these contracted expert witnesses, you have people who by and large have their own standards. There is no standard that they're both looking at together and going, ooh, that is preeclampsia.
Is it preeclampsia to one? Sure. Is it preeclampsia to another? Maybe not. I don't have a lot of trust in that part. And they completely will not hire any doctors or certified nurse midwives or anybody who is an expert in those fields to look at these cases.
I think it is inappropriate to have people who potentially don't understand the pathologies that they're looking at making judgment on these cases. I find that inappropriate and actually unethical because you're not getting true justice here. The midwifery community in Texas is very small.
And the midwives that are on the board that are usually used as expert witnesses, if you're friends with that expert witness and you know that they're an expert witness, is your case being taken seriously? Is that friend just going to push your case along or close it because they were good friends with the midwife that you were complaining against?
We realized that TDLR doesn't have the resources that they need to be able to really investigate these types of cases adequately. We were very disappointed when we found out that TDLR specializes in giving admin fines and things like that for violated terms. They don't charge criminally.
They can send off cases to the OAG or to a law enforcement agency, but they're not required to, from what I was told. So it's up to their discretion to decide what kind of accountability disciplinary actions are adequate for these types of situations. I went through the hoops. I contacted Dallas PD. I contacted the Texas Medical Board. I also tried to connect with the district attorney's office.
I also contacted the OAG's office, all of which said that it is up to the licensing agency to submit reports and to lift these cases up for criminal prosecution. I could not do that myself. The Dallas PD was like, that's not something that we can do for you. The TMB, the Texas Medical Board, said they are not under our jurisdiction. We cannot prosecute midwives because we do not regulate them.
The DA's office said that the report cannot come from a civilian. It would have to come from a law enforcement agency or some sort of licensing entity such as TDLR. So I believe that TDLR has the capacity. They just can choose.
I don't know all the ins and outs of what that looks like and what would prevent TDLR from raising a case like this to people who can prosecute criminally, which I think that's something that needs to be looked at within itself.
I think especially a state entity, if you are presented with a complaint or a case, I think that is your duty to your consumers to report that crime because it leaves people like us civilians with no restitution.
I also discovered that if Jennifer is found guilty of what she did, the maximum disciplinary action she'd receive would be up to a year of revocation of her license and admin fees, however much they decided would be adequate for the situation. So that was very disappointing for us. We really had a lot of hope and stock put into TDLR.
Yes. There was a larger investigation that was opened for all of Origins cases that is ongoing as well right now. And so I think my case may be hung up until that one comes to a resolution as well. I reported Origins for committing Medicaid fraud. I want to say March of last year. Maybe it was a little later than that.
But I contacted the Medicaid fraud unit in Dallas and spoke to one of their sergeants. Essentially, I told them they have been using newborn test kits that are for Medicaid patients only. When you order newborn screening kits, you can order for self-pay and insured patients, and then you can order for Medicaid patients. Medicaid patients are completely free. They were ordering the Medicaid ones.
using them on self-pay and insured clients and then charging insurance and those self-pay clients for those free Medicaid newborn screening kits that they were receiving from the state. He was like, how do you know this? So I told him my story and some of the stories of the people that I know gave information about basically the fraudulent activities that Origins had been part of.
Well, this sergeant wanted to take on the patient negligence and other things and began interviewing several different people who had negative outcomes with origins. But there was a jurisdiction issue where he was only supposed to do investigations on Medicaid fraud. And it was outside of his jurisdiction to also investigate patient abuse and negligence and insurance fraud. So he went to TDLR.
and gave them the case and all the information that he had already garnered and said, hey, this is what's going on. And so TDLR opened up a larger investigation that is still ongoing right now. To the best of my knowledge, Markita's review is still in prosecution as mine is.
Around 2-7-24, I emailed Morgan, an investigative journalist, and I also emailed a whole bunch of other news outlets. Every news outlet in the area, like locally, I sent them a little op-ed. Popular birth center exposed for shady practices was my tagline. Morgan actually emailed me the same day. I was extremely surprised. I didn't expect anybody to reach back out.
We did get a storyline with WFAA. She did reach out to Gina and Caitlin for comment. The first segment, State Investigating Dallas Birth Center and Midwives Following Multiple Complaints from Patients, aired March 29th of 2024.
Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you.
οΏ½οΏ½οΏ½οΏ½οΏ½οΏ½οΏ½οΏ½οΏ½acacacacacacacacacacacacacacacacacacacacacacacacacacacacac Athlet Athlet Athlet Athlet Athlet Athlet Athlet Athlet Athlet Athlet Athlet Athlet Athlet Athlet Athlet Athletacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacac Athlet Athlet Athlet Athlet Athlet Athletahacacac Athletahacacacahacacacahacacacahacacacahacacah cle cle cle cle cleacac Athlet AthletacketketTVketTVketaceniacketTVketac Cl ClacTVketTV Cl ClacTVketTVketaceniacketaceniacketaceniacketacacTV Cl ClacTVketTV ClacacacTVketaceniacketTVacketketTVacketetchachachaTV Cl Clenicha
Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. ,,,,,,, ,,,,,,,
This is how they started out their career together. It tells me a lot. There's something so very disturbing about this because they seem to feel they can just get away with it all.
Yes. What we found for midwifery in the state of Texas is that there are many ways to become a midwife. And it's really based off of relying on people's integrity. You're relying on the accountability of the people around you. There is documentation. The preceptor will sign off on the things that you've done throughout your training, but who's to say you actually did those things?
There's no hierarchy there. There's no one checking to make sure that you did what you said you did. The board which prosecuted her then was dissolved. So Gina's probably one of the last cases that they ever made any kind of disciplinary action on. At every point that me, Markita, or Amanda had found something, we brought it to the group.
So if anybody wanted to, those resources were there for you, not that you had to. And I always made that very clear in the post. You don't have to be on this bandwagon to bring justice to origins, but if you want to, here are your resources.
We started sharing information from an ex-employee in the group about how Origins had been stealing from patients, essentially charging them more than what they owed per their insurance and then not giving any refunds. Origins charged globally and you paid all of your fees up front. You paid what they quoted you would be charged through your insurance. And that was it.
So if you were overcharged or you paid more for certain services that you shouldn't have paid for or they messed up the billing somewhere somehow, unless you went back and looked through your verification of benefits, you went through your insurance bill and then compared it to your bill from Origins, you wouldn't know that you'd been overcharged.
In total, I paid over $3,000 to Origins, which was well over the amount that I owed them originally. the financial director for Origins Birth and Wellness. She was a placenta encapsulator. Well, she balance billed people regularly. Balance billing is typically done for out-of-network people.
Balance billing occurs when a health plan doesn't pay the full amount charged by an out-of-network provider, and the provider sends the patient a bill for the remaining amount. What essentially balanced billing is, is you're not allowed to charge a patient more than what their insurance finds them responsible for, even if it's out of network.
No surprise bills, essentially, is what the state of Texas has declared.
I had an anonymous person reach out to me who used to be an employee of Origins. And they knew a lot about insurance and they knew a lot about how Origins operated behind the scenes. And they walked me through how to look at my bill, what information I needed to get from my insurance and from Origins to be able to assess whether or not I had been overcharged.
Also, I have text messages where the financial director, specifically on my case, instructed an employee to balance bill me. Like she uses those words, balance bill it, which I thought was absolutely wild. So I was owed a refund. I sent many emails and left many voicemails
She never responded to me outside of sending me two itemized bills, one which stated the amount that I paid to Origins, and then she sent me another one. After I had asked for insurance audits to see the claims that they filed, she sent me another bill stating that I owed them $400, but they weren't going to pursue it.
They charged me like $350 for an office visit, which was actually a phone call with Jennifer, an unlicensed student. And so in my emails, I was like, you can't charge me $350 for an office visit that was a phone call with an unlicensed, uncredentialed provider. I asked for a meeting with her. I asked to speak with her on the phone. She just point blank did not respond to my emails.
Nobody ever followed up with you about that? No, not at all.
Yes, actually. Everyone started asking for their medical records, which the bookkeeper was proposing a $25 admin fee for people to receive their medical records, which were digital documents, by the way. It wasn't like she was printing and mailing out packets of medical information. Not everybody got the email saying that they would have to pay $25 for their medical records.
And of course, that was circulated around and women who had had bad experiences and women who had had good experiences were like, WTF? This isn't fair. I never received my records. I did ask multiple times and they refused. I would like to point out that my doctor, she gave me the records that were sent to her.
I did file a report with TDI, which is the Texas Department of Insurance for balance billing. TDI is responsible for insurance fraud and stuff like that. Whoever I talked to on the phone, I let them know. I was like, listen, they did this for however long. In the last year alone, they had owed, I believe, $100,000 in refunds. Refunds for overbilling? Yes, overpaying.
And the guy that I talked to through TDI said, that's something that you're going to have to take up with your individual insurance. You're going to have to tell them that they balance billed you. I was like, what is my insurance going to do about that? My insurance isn't going to give me the money that they took from me and didn't refund to me.
So that was kind of a dead end, which was really disappointing.
Texas doesn't have any laws or requirements on what kind of building can be considered a birth center. To open up any business or to even operate a business, you must have a CO or are subject to being shut down. HHS is the body that regulates birth centers.
I filed a complaint with HHS and they did an investigation and there was nothing done, even though there is records of Jennifer operating without a license and things like that. Mostly the state looks for cleanliness and make sure things are labeled the way that they're supposed to. Biological waste is taken care of in the appropriate manner and so on and so forth.
They don't really look into patient negligence and things of that nature.
We started digging into Texas admin code for midwives. I realized that I could report to TDLR, Texas Department of Licensing and Regulation. The same committee regulates sanitarians, barbers, and tow truck drivers, regulate direct entry midwives. It was really shocking because I was an esthetician.
I was licensed by TDLR and the fact that being an esthetician, someone who gives people facials and waxes people, was regulated by the same body who regulates direct entry midwives who are literally in charge of life and death. Being a first-time pregnant person, what I didn't understand was that there are a lot of things that happen to your body.
during the course of your pregnancy, labor and delivery. There's a whole slew of unfathomable things that I could list off to you that can occur during pregnancy, labor and delivery, even if you had a perfectly healthy pregnancy that would put you or your child at risk.
I started forming this group called Survivors of Origins Birth and Wellness. It was a little quiet at first. Nobody was really saying their stories or anything, but then we started getting multiple responses. to join the group a day. Eventually, Markita responded to me and she joined the group.
And then I posted my story in the group and then she posted hers and then other people started to post theirs. Talking about all kinds of different things happening in pregnancy. Failures to address abnormalities and concerns and near misses.
Eventually, Markita responded to me and she joined the group. And then I posted my story in the group and then she posted hers. And then other people started to post theirs. Talking about all kinds of different things happening in pregnancy. Failures to assess gestational diabetes and address other abnormalities and concerns and near misses.
Dating back years, some of these people had births in the 20-teens. under different care, under ownership when it was Amy, Tate and Gina and Caitlin. For example, in one story, her baby was born after mine. We were there at the same time and she was being seen by Jennifer as well. She didn't know that she was unlicensed.
And during her time as well, Jennifer was also supervising another midwife and saying that this midwife was a midwife in training. While Jennifer herself was the student. Yes, she was training other midwives. This is someone I met through the group. We'll call her Jane. Jane had reported this to me through direct message. She was saying how in her birth class, one of them lost their baby.
It was really shocking and so sad to see all of these negative experiences. I did not know Amanda at the time, but Markita knew Amanda. They were at Origins together. They were pregnant at the same time, in the same birth class. Their due dates were like days apart. That's how Markita knew Amanda and brought Amanda to us. At first I was skeptical. I was like, I don't know.
Not because of Amanda, but I was just skeptical of anybody at that point because I knew that Origins was trying to figure out what we were talking about, figure out what we were doing. Origins Birth and Wellness, they had what they called a community group, which was private. You could enter through requesting to enter the group. And you had to be an origins client.
Everybody that was in the survivors group was in the origins group. At one point in time, various of us left at different times for different reasons. For me, I left pretty soon after I gave birth to my son just because I couldn't bear to see the word origins pop up on my feed every time I opened up Facebook. But there were some that stayed in there forever.
Because the moms would talk about all kinds of stuff, crunchy solutions or their births. There is also community gatherings and things like that. I mean, Origins created a very large client pool and made sure that they were all interconnected through their Origins community. And they did a lot together. They talked a lot together.
When I started the survivors group, November of last year, there were several members who were still a part of that origins group and they used their own identity. So every mom was welcome. They just hadn't been very vocal about their experiences because it was pretty widely known amongst the community that if you spoke out about your experience or shed any kind of
negative feelings towards Origins that you would be contacted by Gina and Caitlin directly. And anybody who had supported us in any kind of way or anyone they even thought supported us, they started booting from the group. Worst case scenarios, they slapped a few cease and desist orders on a couple of people from what I understand.
This was a response concerning the birth of my son from Gina and Caitlin. It says, Dear Kristen, we are saddened by the recent developments on social media regarding your birth experience with Origins. We would have loved the opportunity to process with you personally to address your concerns.
Please note Origins has and always will maintain thorough policies and procedure protocols for managing pregnancy, labor, and delivery. Thank you so much for joining us. and followed up with you on January 19th to ensure you were getting the care that you and your baby needed.
As far as your concerns regarding having an unlicensed provider involved in your care, all our midwifery interns work under the supervision of a licensed NARM-approved preceptor who oversees every patient interaction through your care with us. We are so very sorry you had a traumatic birth experience, but are very grateful that you and your baby got the emergent care that you needed.
If there's anything we can do to help you on your healing journey, please reach out to us personally. This is our direct email address and contact information. Gina Thompson, CPM LM and Caitlin Wages, CPM LM, co-founders of Origins Birth and Wellness Collective Dallas. That was their response to my review. But they also knew you had started this Facebook group.
Yes, they knew because I had become public. All they said was that they follow ACOG guidelines in adherence with Texas's bylaws for midwifery and that their students are never without supervision. So without really saying it, saying you're lying, we don't believe you. But this is what was happening. This is what happened to me. I know I'm not crazy.
I know that I saw Jennifer in that room several times by herself without anyone else present.
Honestly, it doesn't make me as angry as it used to. It's just really sad because they're outright lying. And I know that. It is really disappointing to see people who were held in such high regard in the community be so callous and to lie so blatantly to someone who trusted them. And paid them for good care.
I see that as an insincere attempt to give some sort of politically correct statement and to cover their own liabilities. I think they knew what they had done. I really do. And they were just trying to convince me that they didn't do it. Gina and Caitlin were very quick to disregard us on their social media platforms, especially.
They really denounced us in those groups, saying that we were just angry moms that weren't happy with the experiences that we had had. There's a lot of biblical references used in these groups. Caitlin, she made two or three posts citing our group. One of them, she was like, you are probably aware, but there are a small group of women who are very, very vocal on social media.
This is upsetting to say the least and disheartening. They can neither confirm or deny our claims because of our privacy, HIPAA and whatnot. But essentially... What she says is, it is our passion to be in service to you, the women who run the world.
We are coming to you to ask that you remember who we really are, to remember that the words being used against us are not a universal truth, and that a conversation requires two parts. What is being portrayed is only one part of a larger picture. This is a very trying time for Origins team as a whole, and your love, support, and words of encouragement are always appreciated.
We're just one piece of a larger picture. She is completely brushing underneath the rug death. We're talking about negligent death and saying, ah, this is just something that happens. This is just a part of our story. You know who we really are. She also states in that specific post that conversations are two parts. Well, she didn't want to have conversations with us.
If anything, she's drawing more attention to it. That's what we thought, too. But we were like, that's fine. Let her. Even though it hurt to see her continually deny and misconstrue our real lived experiences. In other posts, she asks for Origins moms to tell their stories. And the responses from these moms, they came up in the arms of
It was very disturbing to see what some of these women were saying about us. I mean, one of them even saying that how she had wanted to physically attack us for saying anything negative about origins at all, and that origins were sunshine and rainbows. Other moms commenting under Caitlyn's post saying how they're the sacrificial lamb and that they'll get through this.
Another mom on there saying that we just need to make our stories go viral and redeem origins. And mind you, at this point, all we had done was share our stories on Facebook platforms, like on mom groups and things like that. As a response to these, how would you call these posts? They're like testaments to action.
You know, she's like rallying her troops, getting these moms all riled up about what these angry moms are saying about her and her teammates. The amount of like brainwashing or echo chamber that was kind of happening here where Caitlin and Gina had all of this social power over this large group of women and were able just to say something.
And to those women, it was just true enough for them to completely disregard severe cases. Caitlin had people trying to get into our group. We actually had an ex-employee we didn't know. And she had gotten into our group claiming she had a bad birth with origins and birth trauma and all this stuff. She was sending screenshots to Caitlin and Gina and the nurse practitioner.
We were able to narrow down who that was. And I kicked her out. She left me like crazy voice messages, blew up my phone for an hour. There were like 14 messages in between each one of my messages. But that is how serious Gina and Caitlin were taking our accusations, so much so that they wanted people inside of our group to tell them what was going on there.
And that wasn't fair because the group was built for women like us to have a safe place to talk without someone running to Caitlin and Gina and telling them what we said. I mean, we're talking about vulnerable things. You're talking about birthing a human and all of the things that go wrong in that. And there's a lot of very sensitive information in there.
And so for someone to be in that group, it's a violation of one, the group rules, but two of the privacy of everybody that is there. Can we talk about the Facebook post? that big Facebook post that Jennifer made? Yes. She starts with saying, super vulnerable post.
So many times I have thought of what I would write when I could share my side, although very lengthy, it's not even close to every detail. I did seek legal counsel prior to finally speaking out. Finding an attorney to actually speak to me was difficult as there has never been a malpractice case. I actually prayed for one so my side could be heard.
HIPAA has not been violated as these families have publicly opened up for discussion with previews on every platform. And then she goes on to say it's even harder to open up after being called a racist midwife, a perpetrator, a liar, stupid, incompetent, and the list could go on and on. They say as a midwife, it's not if it happens, it's when.
As a student, I witnessed transfers and even heartbreaking bad outcomes. Bad outcomes do not equal bad midwives. Bad outcomes happen all the time in the hospital, yet oftentimes the hospital is quick to throw midwives under the bus. With that being said, it's not all hospitals or hospital staff are like that. Thankful for the collaboration I do have.
She goes on to say, I believe it's a lack of relationship that she had with me, Markita and Amanda, because they had such a high volume of clients that they've encountered so much hate. Even when their numbers dropped, there was no way to give clients the time they needed to build a relationship compared to small practices.
Clients that truly know me and my heart know that I would never put a client or baby in danger. There are risks associated with out-of-hospital birth. There are situations that can turn quickly, and shared decision-making is made when pink flags pop up. She goes on to say, you know, she works hard not to practice in fear and remain calm.
She says she finished her primary birth numbers in October of 2020. Her apprenticeship was not easy. It was one of the hardest things she ever had to do with an unfaithful spouse and other personal issues. She was never home, gained over 50 pounds, no sleep, and she wasn't thriving. She loved her clients even before she was finishing her numbers.
She said, The births that didn't count even when I caught, but my heart in that moment was full.
And here is something I would like to say to that matter. Like a lot of people, they're like, well, I don't feel that way about the consequences that my actions caused. Like I had a heart full of love when I was neglecting you and your baby. Just because you feel good about what you're doing or you have the best intentions in mind doesn't mean that you're faultless.
Something very interesting that I see happen when you're talking to people who've perpetuated trauma or negligence and things of that nature, they say, oh, I would never hurt anybody. And maybe Jennifer never hurt anybody out of malice, but she did things knowingly that put me and many other people at more risk than we needed to be put in.
And she made those decisions without recognizing the fullest extent of the consequences of which these are very high stakes situations. Consequences are death and severe injury. So that's where fault lies, regardless of how you feel about it. Okay. So she kind of outs herself too. She said, I was doing full clinic alone in 2021 and was paid a very small amount to do so.
So she was attending clinic alone in 2021 without her license. She was not a licensed midwife. She apparently had finished all of her births in October of 2020, but by 2021... She still was not a licensed midwife. She still had not passed her examinations or completed her education to become licensed.
And then she says, September 2021, my preceptor was going to leave the practice by the end of the year. She was put on call with a brand new CNM who ended up quitting in the middle of the night and I was left to cover her shift with no sleep. Then a client complained it was me because she asked for the CNM. who would be my assistant and come towards the pushing stage.
She delivered clients who were no student on their forms, but I was reassured that I was a graduate student. So here she's stating that she was reassured that she was a graduate student, even though she was not legally licensed by the state. I was surprised she said this part. This is how many DFW midwives practice where I worked. I can name at least five off the top of my head.
So she can name at least five people who operated illegally as students with origins. all have seen what is happening to me and none have reached out. And then she says, my original preceptor asked me to have the other owners be my preceptors and I agreed. This was after a devastating loss, literally that day. I didn't even get a day off to process. People only cared about covering themselves.
She cites a loss that happened during that time that she was unlicensed and operating by herself.
Oh, you're telling me. If you talk to any midwife in the area, it usually takes years with proper education and guidance to become a licensed midwife. So I don't think that she got the proper education that she needed. I don't believe that Gina and Caitlin were doing her any kind of good.
And somehow that means that we can exclude that information from the clients that you're seeing, that your clients don't want to be assured that you're licensed by the state. And then she says they said it was fine. She signed her charts accordingly. And state guidelines allegedly were followed with a licensed midwife during the actual delivery. And my preceptor within an hour away.
Preceptors are supposed to be in clinic with you all the time.
And honestly, like I could not be more grateful that she aired out all the things she did. She damned herself and then damned everyone around her.
Yes, that is a lot too. I mean, think of it from an outside perspective. You have Jennifer here who probably feels like she has to do her best. She has to be in all the places at once. She has to be at work because if she's not there, we're going to fail all of these women and their babies.
Thank you. Thank you. Thank you. Thank you. Thank you. Thank you.
I stumbled across Markita's review, which was written in August that year. So I was writing my review about a month or two later. I don't remember exactly what Markita's review said verbatim, but it essentially talks about how her perfectly healthy son Malik was in the womb for nine months. She went into labor naturally, was at the birth center for many, many, many, many hours.
I called many attorneys. In the state of Texas, statute of limitations for malpractice is two years. Before my son turned two years old, I reamped the efforts to find an attorney. We came across a family friend who did malpractice insurance, and I told him my story. And he said, Kristen, I'll tell you what no one else is going to tell you.
They're not going to take it because one, these people don't carry malpractice insurance. Two, it's very, very hard to sue for malpractice in the state of Texas. To point out here that honestly, it doesn't matter. Even if they did have us sign something that says that we can't sue them for malpractice, licensed midwives in the state of Texas are not required to carry malpractice insurance.
Attorneys are not going to take cases where they're not going to get paid out anything. Me and Markita started meeting whenever we could. I mean, she's a nurse and me working part time and then also caring for my son full time. It could get difficult at times, but we would bring our laptops, all of our medical paperwork and things like that.
And we'd sit at a table in a coffee shop and just dive into this stuff. The big question that we were trying to figure out, how did we get here? I was trying to understand where legally they had messed up and where they had violated a direct code. Also trying to help Markita with that as well, because what happened to her son was absolutely preventable.
And I also wanted her to get recourse, knowing that I couldn't get recourse myself through malpractice insurance.
And her son was in distress. There was thick meconium present. And her midwife, Jennifer Crawford, was barely present and hardly monitoring her during this time. Jennifer was able to get her license through the state of Texas in May of 2022, a few months after my son was born.
In the prosecutor's email to me alleging that they do not have to report criminal activity, she also discusses how they contract expert witnesses. So it is another licensed midwife who are overseeing these cases.
I wanted to do everything that I could to prevent this from happening. So I figured I would talk to the powers who could possibly change that. I went to the Texas Medical Association with Markita and Amanda. We told them our stories. And that is what set us on the road to legislation.
We don't know. When Markita had thick meconium coming out and was using all the towels available to them, Jennifer didn't even come in to ask why they were using all the towels in the room. That's something that sticks out with me a lot, is her... utter disregard and lack of urgency during Markita's labor. It was almost as if nothing could go wrong during labor and delivery.
Jennifer was actually one of my favorite midwives and I trusted her more than anyone else. I felt like I had grown a relationship with her more than anyone else. Markita did not feel that way. She was very cold and aloof towards Markita. Markita and her best friend, they arrive at the ER at Baylor University Medical Center Jennifer didn't go with Markita. What was Jennifer doing?
During these hours of time that had passed, was she texting somebody? Was she playing Candy Crush on her phone? What was she doing while this little boy was in Markita's womb and struggling to survive? These are things that stick out to me in hearing Markita's story and then comparing it to mine.
But something that is quite the same is Jennifer's lack of understanding or recognizing when something is wrong. And something was very wrong in both of our cases. And she failed to realize it, whether that's from her lack of training, lack of regard. I don't know, but it's cost people everything. Markita left her review and they responded. This is what they said.
We hesitate on responding to this as a mother's grieving heart is something we would never wish upon anyone. We would love the opportunity to go over your birth with another midwife as a mediator if that is ever a possibility. At this point, we cannot continue to remain quiet without being able to defend ourselves. We would like to reply to your statements.
Giving the birthing mother and partner space to build oxytocin is a common recommendation for labor. If at any time the mother desires to have all support people present, she can. It was a suggestion due to a loud birth space. The suggestion is brought up in prenatal care. The waiting room and the birth suite were separated by a door that was purposely not shut all the way.
Midwifery team was outside the door on the other side of the suite. All vitals show we were in the suite very often, more when needed. So this particular statement is responding to Markita's claim that Jennifer was hardly ever in the room.
And I would like to combat this last little tidbit that they leave responding to Markita's review saying, all vitals show we were in the suite very often, more when needed. This is not true.
If they were in the room as often, instead of sending a student or whoever their assistant midwife was in to tell Markita to stop using towels for the meconium that she was leaking, Jennifer would have known that Markita was leaking thick meconium and that that is a sign of distress. Let's pause there and let's talk about meconium. Meconium is when a baby releases its bowels in the womb.
Even if the meconium is not thick, that baby could still aspirate meconium and still could have its lungs filled and blocked with meconium. Markito was using all of the towels and origins to mop up the meconium that was being leaked. It's not like it was just a little bit here and there, copious amounts.
I'm not a medical professional, but from what I understand about meconium and stories I've heard about meconium, this tells me that this was definitely something that needed to be taken more seriously. And for whatever reason, it was not. but we'll continue. Your midwifery care team consisted of a primary LMCPM Jen, a birth assistant, also LMCPM, and student.
Jen was the only person not of color on your birth team that day. Grace had nothing to do with any treatment or medical decisions. Jen went to the only white person of Marikita's birth team and said, you're the only person that I can talk to. So to move on, their response to Markita's review, electronic medical records cannot be altered and edit audit can clearly be shown.
Charting was also done by others. Meconium was discussed per protocol. Shared decision making was made by you and your partner opting to stay at the birth center when it was first discovered. I think it's important to note here that Origins used a charting system called Maternity Neighborhood, where they had one login where every midwife could use to log in and make charts and edits as needed.
Right. They were supposed to sign their names at the bottom of appointment interactions. But sometimes it was your loving midwives or on mine, it was just Jen. It's not foolproof. People could go in and they could lie. And we would like to think that people don't do that. So moving on, I feel confident no rules or regulations were broken.
When something went out of my scope and birth was not imminent, I immediately initiated a transfer of care by having a student call EMS and every protocol was followed. I opted to not wait for EMS, which was taking too long. My frustration is when the other midwife was ignored when directing your driver to the proper location for a higher level of care or hospital staff was waiting outside for you.
This delayed critical treatment. So you can tell that it is Jennifer responding to this because at this point she says, I. I immediately initiated da-da-da-da-da-da. According to Markita, the midwife that was there didn't know what to say to the ER physician that came to them.
So that tells me that you all were not present in the room enough to know what had been happening in the last several hours of Markita being at Origins. And Markita was in labor for a long time. Now, it's also important to note that Origins often contracts their assistant midwives. So these assistant midwives do not actually work for Origins.
Now, whether or not they're familiar with Baylor, that's up for speculation. We don't know.
It depends on who you talk to. When Markita left her review, Origins... only a couple days later, created a post either on their public page or within their private page offering Myers cocktails and I believe $100 to anyone who left five-star reviews.
It's an IV solution. Origins offered her a lot more than just birthing services, and IV therapy was one of them. I actually have the post right now. It's a screenshot. It's in the Origins birth community posted by Caitlin Wages. Exciting post. Good morning, beautiful Origins community. It's time for another review contest.
This must be completed by August 31st, but we know y'all will be racing to the finish line quicker than that. The first 10 people that have not already done so, if you have, get your partner, mom, doula, etc. To leave us a Google review about your amazing experience at Origins for both locations, receive a free Myers cocktail valued at $1.99.
It must actually have a written review and not just stars. Everyone else gets $100 Origins bucks to use for anything we offer at Origins. This can be supplements, labs, massage therapy, chiropractic care, et cetera, et cetera. Not only do you help us spread awareness about the beauty of midwifery care, but you can get extra healthy in the process. Go post your reviews and comment here when done.
And then they cited the links below. I think someone counted like over 20 reviews that had flooded in after that post was made. I did look for other reviews and I did read some. These are very serious stories and ours wasn't the first and it wasn't the last. I began finding these people and messaging them. I looked for them on Yelp because you can message people on Yelp.
I looked for them on Facebook. And I direct messaged them there. I was joining every DFW, crunchy mom, natural birth group that I could. And I was posting my story in every mom group that I could be a part of in the Dallas, Texas region. And Origins found out. People were sending them screenshots, letting them know that, hey, this woman is starting to speak out about her story.
I started forming this group called Survivors of Origins Birth and Wellness. So anytime anyone looked up Origins, they would also see our group, which I'd hoped would make people at least stop for a second and look and think, hmm, that's strange. I wonder what this is about. I don't exactly remember who joined first. It was a few women and it was a little quiet at first.
Nobody was really saying their stories or anything, but then we started getting more and more people joining or trying to join our group. I messaged Markita. I found her through Facebook while I was forming the group. So I first messaged her November 10th of 2023. I just pulled up our messages. I was like, my name is Kristen.
I was a patient at Origins almost two years ago, and I barely, nearly lost my son in my life due to their lack of competence and knowledge. I saw your review for them. I apologized for what had happened to her and that Jennifer was involved.
After what had happened to me and I told her, you know, if she just wanted somebody to talk to, I was here or she wanted to join our group that I had made a group for women like her and like me to come together and maybe find some justice. At first, all of this was about if we could just turn one person away, that's potentially like one person that we've saved.
But I don't understand why they're not forthcoming with providing us the refunds that were due and the apologies probably that were due. Our insurance was frauded technically.
They got paid double because I paid them and then my insurance paid them, but they never refunded me the money that I paid that was covered by insurance, if that makes sense, because they charged us ahead of time and they said they would refund us once insurance kicked in and my insurance kicked in and paid, but I never got the money back. I still have not gotten the refund that we're owed.
I know there's a lot of women that paid a lot of money that are due a refund just as I was. Why are they withholding that stuff if they're not just out to make money off of us and move on? It literally says in our contract that they'll perform an audit and refund us the money that we're due if we're due any money. The trauma that I went through and processing it all.
The last thing on my mind was going through my contract and reading that thing about the fact that they're supposed to do an audit. So I didn't even start thinking about that until someone brought it up. And I was like, oh, no one ever audited my chart. No one ever audited my finances. And once I went through and pulled all of my insurance statements, I found a lot of money that I'm owed.
I was in contact with them several months ago, the financial person. She was actually at the point of being willing to send me a refund check, which was still not the full refund that I was due, but it was a portion. And I was like, I'll take that portion, you know, and at least then fight for the rest later. I already knew that they were being a little hesitant about giving people their refunds.
I also found an additional receipt that I hadn't tacked on to the refund amount that they actually owed me. And so then I emailed back and I said, here's the receipt for some more that I paid that I'm owed back per your contract. I never received correspondence from her from then on. That was my first experience with birth. The beauty of birth, it was stolen from me.
If the worst had happened, if I had torn, if I had hemorrhaged, would I have died at the birth center? It didn't happen, thank God, but my mind goes there sometimes. I was putting my life in their hands. I was just drowning in anxiety, fear, feeling violated, and then feeling angry. I myself was a medical professional. I mean, I worked in the NICU. Why did I miss the red flags?
Was I being oblivious? Was I being too proud and thinking like, well, I'm going to be just fine? Those emotions really ate at me. Some of it was the embarrassment that I had chosen to go there and that I had failed. It was like my body failed me. I failed me. Those first few months are a blur to me.
I think I blacked out a lot of those memories, honestly, because it was just such a dichotomy between the anger and the trauma at the same time having this cute, beautiful, amazing little thing that's like all mine that my body made. It was too much for my brain to handle. And it makes me so sad now looking back at pictures of him when he was little and being like, oh, I forgot that that happened.
People talk about the glow you have as a first time mom. I didn't have that. I was just out of my brains and I'll never get that time back. I felt like that was stolen from me. They stole a lot of time from me and they stole a lot of memories from me. And they stole this piece of me that I never consented to them taking. It was like no one understood what we had gone through.
Those months following were the hardest months of my life. I went several months feeling isolated, abandoned, forgotten. All of these negative thoughts that just swarm in your mind.
I know that we're on edge all the time as first-time parents, but for me, after that had happened and after I realized how close we were to having something really devastating happen, or at least it seemed like it was that close, any little thing that happened to him, any little like snot in his nose, any little cry that he had, which he cried a lot because we found out later that he had a dairy protein allergy.
I was eating dairy and breastfeeding and he was having a bad reaction to my milk. There was never a moment in time where really we had quiet except for the times when he was sleeping, which was rare because he was in pain a lot. And nursing, that was a challenge too. We struggled for four months nursing. I struggled with massive engorgement. I mean, I had clogs all the time.
It was the constant fear of mastitis. But any little thing that happened to him, my brain immediately went to, oh my gosh, he's going to die. That's so fatiguing for your brain to just never have a moment of rest. It's constant fight or flight and never knowing who to go to. And I was afraid that people would think that I was freaking out. I have to get past that. I can't hold on to that.
My baby was born at 10 o'clock that morning. With the history of what was going on, they called in some NICU personnel. They did care for him after he was born. He was not breathing. I was terrified. Then also it's like starting up this new massive amount of fear of like what's ahead of us. My OB, she was the delivery OB and then she was the one that followed up on me until I was discharged.
And I'm trying. It's sitting in that grief. And I don't know how long that will take. I couldn't really talk to somebody. I couldn't really relate. And I was no longer able to go out and be in community with people. I withdrew from society. It didn't feel safe for me to leave my house. I'd go out to go run errands as needed, but I didn't want to interact with people. I was in my own bubble.
I was hurting so badly. I guess I didn't trust anybody. And I didn't want to open up and just lay my heart out to somebody who wouldn't understand. It's almost like it would just re-hurt it. I suddenly found myself in my house with a guy that I had married a year before and he had dated not that much longer before that. So he was kind of new to me too.
We're learning this marriage thing and we're learning ourselves. I was a fish out of water, I realized. I've never been so lonely in my life. It felt like there was nobody there.
I felt like if I went back to my coworkers at the hospital and told them what happened, I feel like I would have had guilt from that, too, because they would have sat there and wagged their finger and said, well, we told you, you should have known better. No one ever did that. But I heard the comments made behind mom's backs when I had worked there.
And so I anticipated that that's probably what would have been said. So I didn't feel like I could go to anybody. It affected my relationship with my kid, obviously. It affected my relationship with me. I learned kind of to not like myself. It affected my relationship with my husband.
He wanted to support me because he knew that was my dream to have the baby there and that I had given so much of myself. He didn't want to disappoint me. He thought that he would have dashed my dreams. He is upset with himself that he didn't advocate for me. He said he's never been so afraid in his life. His face is burned in my mind. The fear in his eyes.
He was so helpless and no one's guiding him. No one's telling him what's going on. He has no idea. I had no idea. But I know that he carries a lot of hurt and a lot of shame and guilt. I mean, none of it's deserved. My husband was also a victim. And I know that I was the one that everyone was scared about and my baby was the one that everyone was scared about in that moment.
Yeah, and I think that sometimes his is overlooked. He's had to deal with my emotional outbursts or all of the mess and the muck that has come of this because he, such a good man that he is, feels like I need to have my wounds healed first and my pain and my trauma needs to be addressed first because it's been so debilitating and he's put himself to the side.
But he still carries it and yet no one's really asked him. It wasn't until May of 2023, seven months later, I finally had a point where I was like, I'm living in desolation. I'm living in this black cloud that just surrounds my days. I wake up in fear. I go to bed in tears. I literally don't recognize myself anymore. I realized something had to be done.
And that's when I reached out to a counselor. I also told myself I have to put myself out there. I started going to mom's groups through various churches. But then I met this new emotion when I would put myself out there. Resentment of other moms because I was so heated to realize what I missed out on. birth is so lovely and it's beautiful and like your body was made to do this.
I had so much resentment when I heard people talk about their good birth stories. I was happy for them, obviously, in one sense. I would wish nothing like what I had on anybody. But then there was also this side of me that was so resentful. I didn't want to hear those stories.
I didn't want to hear someone else rave about, especially a birth center birth or even a home birth, that those things worked out for somebody else, but not for me. I started counseling and was able to start talking about it. I literally up until this point for months thought I was the only one that had gone through this at Origins. I was scrolling social media one day.
I thought she was good during delivery. I had no concerns. I actually felt quite comfortable and safe with her there when I was being discharged from the hospital. My OB came in with my discharge paperwork to go over it. I wanted to know where I was in terms of the spectrum of severity because I feel pretty torn up. She looked at me and she said, you did push for two and a half hours.
At this time, I had already moved out of Texas and saw a news report out of Texas that some women were gathering and they were going to be demonstrating outside of an Origins location. I clicked on the article and read it, and sure enough, it was Origins Dallas. And I thought, oh my gosh, I'm not the only one. In the article, it was Amanda who had been interviewed by the reporter.
I was nervous reaching out to her, honestly. I didn't want to dredge up old memories, but I'm so glad I did. I reached out to Amanda online, and I think it was via the Origins page, because at the time, Origins was still running. And I just simply said, hey, I saw this review. It sounds like you had a bad experience.
I did too, but I didn't realize that other people were having bad experiences there. She said, oh, yep. There's been lots of bad things and we're starting to submit reports and we're going to get women together and we're going to let people know that there's something bad going on here. That's when I got added to the survivors page.
Within a span of that month of talking to her, I realized how much had gone wrong. I realized that someone had died under their care. I realized how many women had been transferring. I realized how much they had flubbed their transfer numbers. That's when I started getting involved with these women and started submitting reports to DDLR and to the Attorney General's office.
When I got added to the group, the survivors group, I've only really heard bits and pieces of people's stories. Kristen's was the first story that I heard in detail. It's shocking to me. All of the stuff that she went through was months prior to me. The time that her baby was born would have been right around the time that I actually started with Origins.
That kind of hits me in a different way because it's like, had I known, oh, I would have run for the hills. And when she was reflecting on the fact that they tried to sell you their chiropractic packages and their Botox and their masseuse packages and the IV therapy, I had actually forgotten about all that stuff.
But when she said that, I looked at my husband, I was like, yep, I remember all that stuff now. Hearing Kristen's story, I'm just amazed at how strong she was. My mom, I sent her this podcast and she listened to the first couple episodes. She called me and she said, I listened to the first two episodes with Kristen's story. I think I understand why it's been so hard for you.
She said, I think I get what you're feeling. I knew it was hard. I knew it was scary. I knew it was bad what happened. But she said, I think I understand now why it's been so hard. And it's because you've had to be so strong through this. No one understands how strong you've had to be even to get to this point and basically have powered through this.
And to hear her say that, that she thought I was strong, because I feel like half of me thinks I've been strong and then the other half of me thinks I'm just being a wimp. And so to hear her say that she thought I'd been strong was just really meaningful. I think it validated that piece of me that wants to give myself grace and yet hasn't been able to.
I've realized that hearing the people that went through it, that had the same midwives, that were in that same building, that saw the same OB, their words that they speak when they reiterate their story and share it, it's what I feel. We really were treated extremely poorly and I need to stop excusing them. It's feeling comfort in the empathy from somebody else.
I hate that they had to go through it, but it's like someone else went through it too and they're surviving and I'm going to also. It's not a misery loves company thing. It's just knowing that someone else can empathize. I'm not lonely anymore.
That's kind of the max that we'll let people go to. I mean, you're pretty bad. I was like, yeah, kind of rolling my eyes. Plus the six hours I pushed at the birth center. She looked at me and she said, what do you mean you pushed at the birth center? And I said, I thought that was why my cervix was so swollen. Obviously, she wasn't given this information by Origins. She was shocked.
I am in no way anti-midwifery. I still love the midwifery model. And in fact, with my second baby, I went with midwives. They were all CNMs. They all delivered in a hospital setting. I don't regret that at all. They were amazing, lovely people who knew their stuff. They absolutely came through for me. They did a great job with my second, but the trauma still came back.
I really wanted to try to have a redemptive birth experience to prove to myself that my body could do it. There's also this reality that we have to confront, which is that we don't know how your body is going to react in any situation, really. The sad thing is, as much as I thought I had worked through that trauma, as the time got closer to having my second, I started having irrational thoughts.
Like, I don't think I'm going to make it out the other side of this. I think I'm going to go into that hospital and be in labor and I'm going to die. And then once we were there at the hospital in labor, I wanted so desperately to try to do it all by myself. The contractions got so bad and I knew it was nearing that time and I thought, I can't do this again.
I ultimately opted for an epidural again, and it was the greatest thing. It was amazing to come out of the hospital the second time and say, that's how birth is supposed to go. That's how you're supposed to be treated by the people that are caring for you.
I wanted to share my story just to bring awareness, but also to try to bring justice to all the women that were wronged by origins and the people that worked there. Such a vulnerable time, obviously, birth, and we put our full trust in the providers and in the system.
The reason I wanted to talk about this was hopefully to bring some closure, but to encourage people to keep an open mind and to recognize the risks and the benefits of any decision. If I was telling somebody weighing their options, particularly in Texas, go into it with a clear knowledge of what the credentials mean. Also understand and have the humility to realize that
You can have a plan in mind and it can go completely wrong. And if they do go awry, you need to make sure that you trust the people that you're with and that you've vetted them. I have all the admiration and support for anyone who wants to go the birth center route or even a home birth. To my younger self, I would have said, weigh all the options.
There's so many things you learn the first time you go through any experience. Why would you not want to be in a place where all of the modalities to keep you safe, the knowledge to keep you safe, all of that stuff is there if you need it? I don't want to find myself or my friends in a position, again, where we have no recourse, really.
She said, you're not supposed to push until you're fully dilated, 10 centimeters. You weren't fully dilated when you got here. So why were you pushing? She said, do you know what could have happened? You could have torn your cervix. And I later found out that if you tear a cervix, you can hemorrhage and bleed out. I lost it.
At the end of the day, you have to be confident in your choices and you have to do what you think is best for you, but recognize that there are implications and I'm living proof, all the survivors are living proof that there are a lot bigger implications than just physical harm. There's psychological harm that's going to reverberate for a long time.
One thing that Kristen said that stuck with me so deeply was that she talked about generational trauma. It cut me deeply. That is another point of guilt, honestly, that I carry with me is that my son didn't deserve that. He didn't deserve a mom that wasn't emotionally available anymore.
that was in tears all the time, that couldn't handle his screams, that couldn't love on him the way that he needed to be loved on. That pains me so much that that was, again, taken from me. That was something that was stolen. I couldn't even look at my notes. The anxiety that I felt having to look at my notes was excruciating. It was overwhelming. It's a piece of paper with words on it.
Why does this matter to me so much? But I think I was afraid of reading the numbers, the words, And finding something else hidden in those words that was wrong, that I hadn't caught before. Sharing the story was the same way. It was like, I don't want to relive those memories. I don't want to think about it. I just want to put it in a box and walk away and just forget about it. But I couldn't.
And part of me worries that when I share my story too much, it sounds like I'm complaining or whining. I'm a broken record. There's this big, yucky pit in my heart that's just like brimming with the emotion of I don't know how else to say it. I'm searching for this salve for my heart, this big gaping wound in my heart. Sharing my story, it helps a little bit.
When she told me that, that was the moment that everything changed for the rest of my life. We went home Tuesday evening late. Those days following, I was unable to take deep breaths. I could only take shallow breaths for days. It was terrifying. It was like I was hyperventilating almost.
And I brought that up to the OB and she said, well, I would attribute to the fact that you probably have some swelling in your lungs. Your muscles are sore. You fatigued your muscles. She said, I would not be surprised if you injured yourself. a lot more in your abdomen than you realize.
Not only are my reproductive parts messed up, you expect those parts to be inflamed and swollen, beat up and bruised, but you wouldn't expect your lungs. Maybe that was naive of me, but I had never heard of anybody else that complained of having an elephant on their chest for several days post birth.
A few days after the birth happened, I felt like something was seriously wrong with the way that they treated us. So I actually had my husband go on to my portal and take screenshots of the notes. I just need a record of everything that happened. My husband downloaded these notes on the 16th of October, and my baby was born the 10th.
Six days after, I definitely felt like something was very much wrong. Ashlyn did reach out at one point to say, Kurt, it wasn't great. Would love to chat about it. Hope you and your son are doing well. But I never responded to that text because I was so angry.
Part of our contract was that two days after giving birth, we would have a visit from a home nurse that would come and check on mom and baby. I reached out and I said, hey, when do I expect the home nurse visit? And they said, oh, well, you have to come in to the birth center for your visit because you're out of bounds. Our nurse won't travel to you. I said, no, that's false.
I confirmed the fact that I was in bounds when I toured your facility when I was 20 weeks pregnant. I've paid that money because it's like a $200 nurse visit that's allegedly covered by insurance. But then of course we found out that it's not. It was just one thing after the other.
I very firmly let them know that I was extremely unhappy and that I thought it was an injustice that they were doing this. I am not physically getting into my car after I'm torn up after this whole ordeal. Like, it's not happening. And eventually, back and forth, they sent her out. So I did get care from the home nurse. So did you contact the patient advocate?
The home nurse contacted them and let them know. The patient advocate reached out to me and she said, hey, we heard you didn't have a great experience. We'd like you to come in and basically hash it out with the midwives and get some closure. I told her that I'd love to. We had a date scheduled to come into Origins in a couple of weeks.
So I would have a little bit of time to heal, a little bit of time to come down from the emotion. During that time, however, I started having complications. About day 10, I suddenly lost the ability to pee immediately.
I had been urinating okay up to that point and slowly but surely I started noticing that my stream was becoming weaker and weaker even though my bladder was like super duper full and painfully full. I would sit on the toilet and try to get something out for minutes. I started freaking out, which of course is not great either because then you tense up and you really can't pee at that point.
But I was constantly in the bathroom. I thought, oh my gosh, I'm going to have to start cathing myself. This is going to back up and become a kidney infection. Like all these things are going through my head. My mom, who is a nurse, she was there at the time that this was happening, but I went to her and I can't pee, mom, what's going on? And she said, maybe you have a UTI. You're so swollen.
It could be that you have a lot going on down there right now, but go get checked out. So I went to a local minute clinic. She's like, yeah, it kind of looks cloudy. So my guess is you have a UTI, but it was a Friday. So she was going to send the culture in, but it wouldn't come back until Monday. So she sent me with an antibiotic that I started taking that day.
Who knows if it was the right antibiotic or not, but we started it. But I called my OB. I wanted to keep her updated. She said, what do you mean you started an antibiotic today? You should have been on antibiotics since I discharged you. Why were you not taking your antibiotics? I was like, you didn't prescribe me antibiotics. I haven't been taking them because I was never prescribed them.
I pulled out my discharge paperwork that she gave me and we went over that she marked on with her pen. And I said, there's an iron supplement on here and an ibuprofen recommendation. She claimed I was supposed to be on an antibiotic because I had an infection at birth. That's what she said to me. That was not in my paperwork anywhere.
So don't really know if she thought I was a different patient, but the antibiotic helped. I was able to start peeing again a few days later. Thank God. I went in for my two-week visit with her then. Already a little bit on edge because she acted like I was lying that there was no antibiotic mentioned in my paperwork.
But I went in by myself because my husband was working and I got on the bed in the office. My OB comes in, her happy self, and takes a look down there. You can't make this stuff up. And I have to laugh at it now, otherwise I just get angry. But she looked down and pops up and she's like, well, there's been a separation of church and state down here. That's what she said to me.
And those words stick out in my mind because it was just so nonchalant and to me insensitive because I'm in pain. I'm scared. I'm hurting. I don't know who's got my back and who doesn't because it seems like all these care providers are somehow just like skipping over important things. So when she said that, I thought, are you kidding me? That's what you're going to say to me after all this?
I had a second degree tear at delivery that she stitched. She's like, well, it looks like your stitch has failed. Your tear's open. That doesn't sound great. What are the implications of this thing? And so she told me that I would need to be put under to have it repaired.
And the anesthesia meant that I would need to pump and dump and that it would prolong my recovery time, which also didn't sound great. But then being put under didn't sound wonderful. I'd had it. I don't want to see another hospital or doctor. I don't want to at this point. I don't trust anybody. Why would I want to go under and have you operate on me when it seems like you've already failed me?
Everything would be fine. We're just going to fix it. I went home and I remember walking in my door and my husband and my mom were there and I didn't even say a word. I just collapsed into my husband's arms and started bawling my eyes out.
The thing that was so frustrating to me is that that visit was on a Friday because she claimed that she was going to get me on the schedule probably Friday at the earliest. So it was going to be another week or so. It might be a little bit longer, but I got to see if I can find us an operation room. I said that to my husband and my mom.
And my mom was like, she needs to find you a time like tomorrow. And my husband called back and very kindly but firmly told them that they needed to find a room ASAP. So they called back and got a room the next day. But in that time, I didn't trust them. So I went and got a second opinion from an OB in the office that I had started with at the very start of my pregnancy journey.
It was a different OB. They'd hired a new OB in the time that I was away. I went to this new OB, told her my story. She took a look. And what she told me was that, yes, very swollen. You're healing. You do have a second degree tear. But what she didn't tell you was that you have granulation tissue forming already.
And I didn't know what that meant, but I guess what granulation tissue is a sign of is that the open part of the tear is already healing. If my OB had put me under, the success rate of restitching it would only have been 50-50 because of the granulation tissue. I guess granulation tissue doesn't adhere well. There's a chance it could, but there's also the high chance that it might not.
So she's like, the potential that you go under and encounter another surgery and it failing is pretty high. She said either that or her plan was to scrape off the granulation tissue, stitch you back up, and then that would probably be a more high success rate. But the thing is, then you're prolonging your healing even that much further. Or your other option is just to let it go.
I'd have an unrepaired tear, but I could function. Basically, I'd be okay. And if in the future I decided that I wanted to go under and have it repaired, I could. She was the only one that extended compassion in that moment and said, you know what? I think you've been through enough already. I don't think it's a bad idea just to let it go. Reassess months from now, years from now, potentially.
She's like, it's not going to inhibit you from all the things that probably people think of. You just will have an unrepaired tear. And that's just the way it is. And I trusted her to this day. It's unrepaired. and it did not pose issues with my second baby. I do have scar tissue there that I had to go through pelvic therapy PT for.
I would have gone through anyways, but that scar tissue did pose some problems in the fact that it's a little more tender. We had a date scheduled to come into Origins the day that I was supposed to go in and meet with Origins. I went to go get the second opinion. My head was spinning. I was like, time is of the essence.
And so I canceled the meeting with Origins and said that I've had some complications come up. I'm not going to be able to meet with you guys today, but that I'd like to find another time. She said, no problem. We're here for you when you need us. Reach back out when it's time and we'll put something on the books.
I reached back out November 2nd and said I was interested, and I've never gotten a response to this day. Which was probably a good thing, honestly, because knowing what I know now and having learned stuff, maybe it was for the best. I think that I could have been level-headed. I didn't want to go in and have them... gaslight me, to be quite frank.
I felt like it was definitely a meeting for them to tell me all the ways that my labor went wrong, cover their behinds. I have the strong hunch that that's what the meeting would have been. I have moved on since then and had another baby, but that nightmare of an experience still hangs on in my mind.
I feel like I did not have full knowledge of what I was putting myself into and the danger that I was getting into. But really, I shouldn't have been in that danger because I was told something that wasn't actually true. I was putting my faith in people who obviously didn't have my best interests at heart, even though they claimed to. Was it more malicious negligence?
Was it that we're money hungry and we have to do these things not to pass the patient over so that we don't get the full reimbursement? Like, I have no idea. I don't know. I can't propose to understand all of the implications. The story is so convoluted. The ways that they tried to pull the wool over people's heads... It makes me think that it was just literally a scam to get money.
That's all it feels like at the end of the day. Maybe they started with good intentions. They had women's best interests at heart, but power and money corrupt. And I'd like to give them the benefit of the doubt in a way and say they were just lazy and didn't know what they were doing.
This next part of the story, I will be telling from a second person point of view. because I was not cognizant for anything that happens next. My son is delivered via emergency cesarean. I receive a full classical incision to deliver my son because of how he was positioned. He was wedged underneath my diaphragm, so the normal transverse incision that you see as a typical cesarean section
was not enough to be able to pull him out, so I received a full classical belly button to pelvis incision to retrieve him. He had his cord wrapped around his neck twice, and he was born stunned and white. He had a low APGAR score. They had to use a CPAP to resuscitate him after he was born.
He was taken up to high level NICU to be assessed for brain damage as well as infection because I had a very severe uterine infection. Dr. Fuller is quoted to say that when she opened me up, the room smelled foul. That is how bad my uterine infection was. They are looking at my son for signs of sepsis, brain damage, organ failure, the works.
I'd had multiple high BP readings. I had started to swell pretty severely. At this point, I had abnormal lab results at 36 weeks. My hemoglobin was low. My hemocrit was abnormal as well. So all of these things were suggesting that there was something more going on than just a normal pregnancy. When you have preeclampsia, your body is beginning to deteriorate.
And it's during this time that my preeclampsia really shows its ugly head. And I go into a hyperintensive crisis. My blood pressure shoots into the 180s over 130s. My team's afraid I'm going to stroke out on the table. I'm given drugs to counteract what is happening to my body, and I'm sewn back up. Then I don't wake up after.
The medical team thought I had a clamped-type seizure or a stroke on the table. What none of us knew was that I had this very rare condition called pseudocoline and esterase deficiency. which is a genetic deficiency that is passed down through family that makes a person unable to break down a specific type of paralytic called sexacoline. Sexacoline is typically used, especially in trauma cases.
What I had was an extremely, extremely rare thing. Due to this, I woke up inside of my own body still paralyzed. I could not move. I could not open my eyes. It was like one of those movies where someone's in a coma and they're awake in their body and then they can't tell anybody they're there. I come to as like someone flipped on a light switch and all of a sudden I was conscious.
I realized that I couldn't breathe on my own. One of the reasons I couldn't breathe on my own is because I'd gone into respiratory failure because of the condition that I had. And I was on a ventilator. And so I was freaking out internally thinking I'm going to die. I cannot breathe.
And so I'm trying my best inside of my body to move, to do anything, to let the doctors and people around me know that I was in there and I was alive and I needed help. I could hear the doctors around me. My eyebrows started to kind of wiggle a little bit. And then I heard other people going, she's seizing. She's having a seizure right now.
I hear my husband, Thomas, and I hear Dr. Fuller in my ear saying, your honey's here, Kristen. Thomas, your husband, he's here. And I hear Thomas's voice. When Dr. Fuller and Thomas were talking to me, and Thomas will say this, other doctors and medical professionals around him were verbally saying, she is not awake. She's having a seizure and she cannot hear you. But I could. I could hear them.
Your kidneys are not functioning normally. Your liver is not functioning normally. In worst case scenario, you have seizure-like episodes. Looking back at my records, I don't understand why I wasn't referred. Even at 36 weeks and four days, I was not referred to an OBGYN. Because my son was breech, they did refer me for what is called an ECV, which is a medical procedure that moves the baby.
When my husband arrived and he started talking to me and he grabbed my hand, It was like, finally, someone will be able to see me. Someone will be able to hear me. And my body moved. And it was upon hearing Thomas's voice that I have this visceral reaction. My entire left arm shoots across my body and grabs his hand. I spend the next 36 hours in neurological ICU.
About 14 of those hours I spent on a ventilator, unable to breathe on my own. They monitored me for neurological damage because they had assumed that I had still seized. And honestly, to this day, we don't know if I had a seizure or not. And I had severe preeclampsia and had a hyperintensive crisis on the table. But I did not suffer any brain damage or organ damage.
At this time, I thought that what I had gone through, that crisis, oh my God, we got to get your baby out right now. I thought that was the mountain. What I didn't realize is that my recovery was the mountain. When I was in ICU, I was in more pain than I had ever been in my life.
Thomas authorized for the medical staff to give me nerve blockers and even having nerve blockers and being prescribed Dilaudid, I was still in an incredible amount of pain. Some of the first things I remember while on the ventilator is asking if I could see my son, asking if he was alive. I put my arms across my chest, like you cradle a baby, and I rocked my arms back and forth.
And there was one other medical staff in there at the moment, and they were like, oh, are you cold? I shook my head no, and I did my arms again, asking about my baby. At this point, I thought my son had died. I was told my son was in NICU. Thomas told me that so far there wasn't any signs of damage or anything like that. He asked if I wanted to see pictures. I shook my head, no.
In my head, I was going to see my baby very soon. I didn't want to see pictures of him. I wanted to hold him. And so after that, I fought to get out of the ICU. I was fighting to regain mobility because it was very hard. I was in an extreme amount of pain.
I had ended up getting into an argument with my neurologist who was not convinced that I did not seize and that I was capable of being able to hold my son and have full faculties.
My mom and Thomas were in the room and he was only talking to them as if I didn't exist and telling them what he thought had happened to me, regardless of evidence that my genetic condition, pseudocoline and esterase deficiency caused me not to wake up from anesthesia. That was extremely frustrating moment.
God bless that lactation consultant because she walked in right as I was laying into this neurologist. Honestly, that was one of the worst days of my life. Ever since I'd gotten out of surgery, I was fighting to see my son. Understandably, because it's been what, almost 48 hours now? And I remember being jealous and I was angry that someone else was taking care of my child.
Someone else was changing his diapers. Someone else was holding him. Someone else was feeding him. Someone else was loving on him. And I hadn't even seen him yet. That was very hard for me. I'm very grateful for the nurses and the staff that took care of my son. But this was my internal struggle. I struggled deeply with the situation that I was in. I was so beside myself. I was so defeated.
And Thomas was there and he said, do you want to go see Theodore, our son? And I said, no, I don't want to go anywhere. I felt like I didn't deserve to see him even at that point. My husband, he knew I was defeated. I just wanted to literally crawl into a hole and die is how I felt. He saw me deteriorating emotionally and he was like, we need to go see our son.
And I shook my head at first and he was like, come on, we'll do it together. He helps me get into a wheelchair. He rolls me down to NICU, which was a couple of hallways away.
So I'm scheduled for this, but also at the same time, I'm told to perform like a spinning babies exercise. Spinning babies is like a natural program or philosophy that if you do these exercises, sometimes you can naturally turn your baby over. There's one night where I feel like my son is like jumping up and down in my womb.
My son was in high level NICU, the same area where they keep preemie babies. So as I'm being wheeled down the room, I'm passing little babies that are 27 weeks old who are on ventilators and all kinds of monitors and little boxes and things like that.
It is one of the most horrific and surreal moments of my life, realizing that this is where we were and how much it changed in the past 48 hours even. And we roll up To my son, who is in a bassinet, he has a feeding tube in and is hooked up to monitors, and there is a nurse there. She's young. She's very nice.
She helped me wheel up next to his bassinet, and me and my husband, we held his hands, and he gripped my finger, and I honestly didn't feel much of anything. You hear... These moments of when moms meet their children for the first time and they're filled with love and awe and they're crying. And it's a very emotional experience.
And for me, I was completely shut down and completely numb to what was happening around me. And I felt disconnected. I looked at him and it's like I didn't recognize that he was my son. But I went through the motions. I was like, this is what you need to be doing. And when I was in ICU, that's all I wanted.
I don't know how to explain my reaction to seeing my son, but the nurse helped me hold him and I breastfed him for the first time. From there, my feelings for him started to resurface. A lot of it was moving through the motions at first. I knew that this is what I was supposed to be doing. This is what I needed to be doing. And I'm so thankful to the staff at Baylor.
Shout out to all the nurses and doctors who were taking care of my son and were on my case because I wanted to breastfeed my child, but because of how everything had happened to me and how traumatic my delivery was, it was unlikely that I was going to be able to breastfeed. My nurses were in my room every couple hours helping me pump, delivering my colostrum to my son for him to be fed.
The NICU team was using donor milk for my son. They also used a little bit of formula too because they knew I wasn't really producing just yet. So they wanted to make sure there was a brand that did well with him before they sent us home to make sure that he was eating. And five days later, after the birth of my son, I was producing fully. That has everything to do with the staff at Baylor.
And I'm very grateful for that because breastfeeding for me, I think was one of the integral parts to me really developing a deep connection with my son and bonding with him, even through that traumatic event and that disconnection at birth. And it was a way to kind of help me feel like I was doing something for him. I was taking care of him.
On the third day of February, I talked to Dr. Fuller and she lays out what had happened, that I had severe preeclampsia and essentially I wasn't out of the woods. That moment was really hard for me. I realized that I could still die, that I wasn't safe yet. She was very careful in how she spoke to me about origins, but she was very, very clear.
So I call the midwives the next day and I say, hey, I think my son turned over. Can I come in and have my baby looked at? I think it was Elizabeth who felt around for my baby. She proclaimed after doing a manual examination, pressing down on my abdomen, things like that, that my son had turned over, that he was no longer breech and he was in the right position.
And she pulled my records out in front of me and she took her pen and she circled places throughout my medical history where she felt like I should have been referred. And one point, for example, was when I had that BP reading of 127 over 90. It was over 20 points over my baseline, which is a sign for hypertension. She said that was the cutoff.
She said, you had other things before, but this was a cutoff for you.
Elizabeth Fuell and Jennifer Crawford. Elizabeth was the one who took the 127 over 90 BP. And she was the one that verbally suspected that I had preeclampsia and ran a liver panel, but then said it was inconclusive. Jennifer was their and responsible for not referring me when I had that placental abruption.
I'd also, I think, had labs done under her that were out of range, such as my glucose testing and uric acid were out of range. Both of these things suggesting that I was developing preeclampsia.
Also, Elizabeth threatened to put me on bed rest a couple weeks prior to that, too. There were multiple points where both Jennifer and Elizabeth verbalized that things were not right in my pregnancy, but neither one of them ever said, I want to refer you to an OBGYN. That never happened.
I was there for a total of five days, and my son was in NICU for, I believe, four and a half days. He was either released the day of or the night before we were sent home. When we were discharged, I remember seeing Baylor pass in the passenger window and just having this onset feeling of doom. I was terrified to be sent home with this child. We'd almost died.
This is kind of something that I'm realizing now. I didn't realize how much danger we were in when all of this happened. And now I was being sent home with this child who was very fragile and had just survived miraculously from something that was horrible for a newborn child to experience. And I was somehow supposed to watch over him and make sure that he was safe.
And I didn't feel like I could do that because I felt that I had... failed him already. When we brought him home that was kind of when things really got scary for me personally. First week of his life I felt like a failure as a mother and that I was incapable of making sure he was going to be safe. So in response to that I was extremely hypervigilant. I could not sleep.
No ultrasound was done to confirm that my son had flipped over at 36 weeks. And this is important to note because of how my labor and delivery will go. I think everything is well, all is good. At that time, I still felt like I was in good care. I was still feeling confident in my team. My mom was reassured that I was very, very close to Baylor, a hospital that she revered and knew was top notch.
I woke often just to make sure he was breathing. I was constantly terrified something bad was going to happen to him. Afraid that he was just going to stop breathing in his sleep. I was terrified of SIDS. I started doing all this research on what causes SIDS. And I remember coming across this study that suggested that possibly implicit with abnormalities can lead to SIDS.
I knew that because I had preeclampsia that my placenta had been faulty and was deteriorated and over-aged in the womb. The fear was insurmountable. And then I had to go back to the hospital because I was still running fevers. When I got home that night, I remember being stuck in the recliner with my baby on my chest. And I was taking oral antibiotics, but the fever didn't go down immediately.
About a week later, I was running about 104 degree fever and went into the hospital. We called Dr. Fuller and she told us to come in through like the physician's admittance area, but that area was closed at Baylor at the time. So the next thing we did was go into the ER and we said, hey, listen, like I need to be readmitted into the hospital.
I was readmitted for an additional four days and it was because of my severe uterine infection. I was given antibiotics for multiple days and they were concerned they would have to open me up again. That was worst case scenario. The antibiotics were not resolving the issue at first.
They were afraid that if things had progressed, then I would have needed to have had a hysterectomy at the age of 23. And that didn't happen, but that has happened to people before. Luckily, the antibiotics worked. I didn't have to undergo surgery again to resolve the issue. And I did not develop sepsis or anything of that nature, but it was a very scary prospect. I was no longer having fevers.
I was feeling much better. I was sent home, but I was monitored. They did discover what bacteria was in my uterus and it's kind of yucky. E. coli was what was causing my infection. Dr. Fuller was essentially like, you had your membranes open for 15 hours and the area where E. coli kind of lives is very close to the area where your baby comes out.
It's not unreasonable to think that some of that bacteria had just traveled and found its way into your uterus. This is my speculation, but after my membranes had broken, I took a bath and I wasn't told that I should not take a bath with broken membranes. And I didn't realize that in doing so, I was exposing my uterus to tons of bacteria.
I love Dr. Fuller and I'm extremely grateful for what she did to save my life and my son's life. I mean, hands down, she saved our lives, but it's hard. She was putting together puzzle pieces.
She didn't completely understand why I didn't wake up after surgery and was trying to pinpoint when I had gotten preeclampsia and trying to figure out how to resolve my raging uterine infection and also at the same time worrying and wondering if my son was going to make it. It was absolutely a lot. I don't know how much Origins talked to Dr. Fuller or not.
Origins did contact me a few times after everything happened That first week postpartum, they did send a postpartum nurse over to assess me and the baby, do a newborn check. But after I started to understand the scope of negligence that had occurred during my care, me and Thomas decided not to talk to them at all. That was it.
So at 39 weeks and five days, February 1st of 2022, my water breaks at 1 a.m. contractions ensue probably about an hour later. So I call the on-call line for the midwives and the on-call midwife at the time was Mariah, the CNM. And I tell them I'm going into labor. I monitor my contractions. I'm told to rest up as much as I can, eat, drink, and just wait it out.
But they did contact me multiple times, leaving voicemails saying that they would like to offer me a floral bath, that it could be a quite healing experience This is the funny part, because at the time they were asking me if I wanted to take a bath, I was taking showers in an office chair in my apartment. Thomas is just throwing water on me in the shower, you know?
I don't want your herbal tea bath, alright? Thanks. Part of me wonders if they wanted to get me in just to try to make it seem like they had done nothing wrong. We just didn't respond, honestly. Maybe we should have let them know how we were about what had happened to us, but we didn't want to deal with them anymore. We just didn't.
It was a very tough time in my life. It affected me in my work environment. I worked restaurant industry. I was in management beforehand and I was in a sticky work environment where I felt like I needed to prove myself to be seen in a managerial role to secure my position. After I had my son, I blamed myself for how hard I pushed myself, for how much I worked.
And I blamed my employment in some ways for putting that pressure on me. I didn't want to work management after that. I didn't want to work in the restaurant industry anymore after that. It was really, really difficult. I felt kind of anchorless with no purpose, no career, didn't know what I wanted to do anymore.
I felt like I couldn't either because my husband was a chef at a restaurant and was working like 70 hours a week. We couldn't both be working full-time management because who would take care of our son? Coming to those realizations was really hard for me. That created a lot of resentment in me towards my husband too. I felt like I was having to give up my career so he could keep his.
It really wasn't like that, but that's how it felt at the time for me. I withdrew from my other relationships. There was nobody I could talk to that understood me. what had happened to me or that could relate to what happened to me.
I would tell my story to people and you could see their eyes kind of glaze over and what I was telling them go straight over their head and be like, at least you made it. You don't even look like you had a baby, things like that. I learned just to keep it to myself and I raged within myself and I isolated. I ruminated.
I lost interest in everything that I liked to do before I lost interest in my career and I lost interest in my friends. My best friend, she was pregnant around the same time as I was and gave birth in May of that same year. And she had a beautiful, wonderful birth. And I remember talking to her while she was in labor and just being so afraid, just hoping that hers would be okay.
And it was, it was everything you would want a birth to be. It went completely normally, no issues whatsoever. I was happy for her, but I was upset that I didn't get that. That's hard too, because that's my best friend. I love her more than anything.
Oh yeah, that was real fun. I felt guilt. I felt like I couldn't tell her how I really felt. I was happy for her, but I was also so upset and so angry that that's not what we got. How does this happen? What was it about us that put us in that situation? It was difficult for me to hear about other people's birth stories. People will ask you too about your birth. And I think that's off limits.
You don't ask people that stuff. I learned that through my experience too. I was like, you do not ask people about their birth stories because you just don't know. It can be so triggering because it's such a deep and intimate thing that happens to you. It's such an emotional, vulnerable thing that happens to you.
It's not just like a chit chat, small talk kind of conversation or question to ask somebody. It is a great thing. It's a joyous thing. But I felt so isolated during that time. Postpartum was a very dark time.
I allot some of that to the medical trauma, absolutely. It's such a jarring thing to go from thinking that you're going to have this peaceful birth to what actually happened to us. That part was traumatic in having to jump through hoops and the getting better and how sick I was afterwards. I think what was more traumatic for me was the utter betrayal and distrust that I felt
I trusted these people with my life, with my son's life. And to find out that I had been lied to, I had been bamboozled. I felt like I'd been conned, honestly. I mean, it makes you question everything. Makes you question every decision that you make. Makes you wonder if you've done all your research, if you have good judgment.
You question yourself and then you begin to question everyone around you. Or at least that's how it was for me. I began to distrust the world. So that for me was more traumatic in a lot more ways than the actual event of it all, even though that was really traumatic within itself. I can't walk into a hospital without thinking of what happened to me.
For example, my grandmother, she died of dementia this year. And one of the last times I saw her, she was in hospital for malnutrition. She wasn't eating or drinking. And so my grandfather took her into the hospital to be evaluated. Upon walking through that ward, smelling the saline, hearing the beeping of monitors, I began to have a visceral reaction to being in that place.
I could feel my heart starting to pound in my chest. I felt like my throat was being constricted and I immediately thought of what it felt like to be on the ventilator. You know, the smell of hospitals is so sharp in your nose and it just brought me back to being there. So there is absolutely a great deal of trauma left from my experiences in the hospital.
I had a lot of trauma stored in my body, especially in my abdomen area. I felt like I couldn't exercise. I felt like I couldn't do things like that. Like we went skiing the year after my son was born. I nearly started crying because I didn't want to use my core to help me do the things. And I had weakened muscles between my legs. the tendons where your groin area is.
If I put too much pressure in one way or another, those tendons would lock up or they would hurt. So that was really affecting my ability to ski. And I had a ski instructor and she could tell that I was getting really frustrated. And she was like, hey, it's okay. It just takes some people longer than others.
And I remember getting really hot and having this visceral bodily reaction because my body was being triggered by what had happened to me medically. And I told her, I had this really traumatic thing happen to me a year ago. I'm lucky to be alive and that is affecting me today. It was good just to get that off my chest. And she was an older woman. She's like, I understand. You take your time.
We're going to do as much as you want to or don't want to do. And she was really supportive of me, but it helped me to just say what was going on in my head. But emotionally, I was still pretty hung up. For the most part, I had tried to forget what had happened, but it would sneak up on me. It was a dark, ugly monster that would lock in a closet.
And when I was least expecting it, when I was alone and my thoughts were quiet, it would tap on my shoulder and say, hey, remember me? It was like PTSD. I would have intrusive thoughts. I would have flashbacks about what had happened to me huge feelings of anger and betrayal about what had happened, even 18 months postpartum.
It took me a really long time to get emotionally well, which was the hardest part for me, to get in a place where I feel like myself again. And it wasn't like a me from before. It was whoever this new me is, the person that had been turned inside out and had all of her outsides on display and
This person who had survived this thing, who was a mother, who was also trying to deal with trauma at the same time and trying to repair her relationship with not only herself, but with her husband. When I finally started to feel like me again, though, it was like a big sigh of relief. It was like someone lifted these huge weights off of my shoulders. And it took a little bit at a time.
And while we were in the thick of recovering, within the first 18 months of my son's life, there were times where we were hitting rock bottom in our marriage. I was filled with postpartum rage. I was just enraged at everything.
The contractions, they start and they kind of peak and then they dissipate. They come in these like waves where they get the most intense at the top and then they kind of go back out. That's how mine felt anyway. I have a contraction monitor and I am recording my contractions. Probably about four hours in to my labor, I start feeling like my contractions are consistent with active labor.
We were two individuals who had gone through this extremely traumatic and life-altering event, just trying to recuperate, trying to heal, trying to make sense of what happened to us in our own ways. We were not always the best people to each other. It took a lot of work. At the end of the day, we really had to choose each other over what had happened to us. We went through a lot of counseling.
We talked about this so many times.
That's a good question. It was when we moved into our new house. So probably a little over two years ago. It's really helped us get to a place where we can talk about what happened to us. And we could talk about it with more ease than we were able to before. We communicate better now. We understand each other better now. And in ways we're closer than we ever were before.
There's more emotional intimacy there. I think a lot of because of going through what we went through, not just surviving, but learning to live after it. This has been really important key moments for us, choosing to love each other, even when it was hard. I appreciate all the work that he has done. Personally, I know I was not the best partner, not even a good friend during that time in my life.
It was very hard.
When you have a child that's born with a low APGAR score or is deprived of oxygen during delivery, you're worried about a number of things, right? My son was developmentally normal, developed words and no speech delays or anything like that. We're very lucky to be where we were at that point in time. It was September or October 2023.
The angry monster came out of the closet while I was driving home from work and was like, hey, you remember this really awful thing that happened to you? I ruminated over that on the way home. And I got home at like midnight. And I said, I'm going to write a review. I sit down on my couch. I'm typing out this review.
They're one minute long and three minutes apart consistently on the dot back to back to back. That's when I call them. I say, hey, I think I'm in active labor. The reason why active labor is so important is because origins will not take you in until you are at least three to four centimeters dilated and in active labor. This is the second time I'm speaking to Mariah.
And essentially, I tell them my story, all the places where I should have been sent away, all the places where they dropped the ball. And I told them how Jennifer was unlicensed. At the end, I essentially said that the owners do not care. They are insincere and they deny what happened to me, even though they were not present. They continue to lie about what had happened and deny my claims.
This place is dangerous. And if you value your life or the life of your child, go somewhere else because this place is not safe. That was essentially my review. It's also important to note that at this point in time, this is the first time I am writing my story. This is the very first time that my story is on written record for other people, the public to view.
And that is what kept me from writing a review for so long. I could not even think about the idea of someone else reading my review or reading my story and then nitpicking it apart. I didn't want salt to be rubbed in that open wound, but something came over me that night. I just said, I'm gonna do it. And so I wrote it. And then after I wrote it, I started reading reviews.
Me and my husband, we'd stayed up all night because we'd realized that we were not the fluke.
I started forming this group called Survivors of Origins Birth and Wellness. So anytime anyone looked up origins, they would also see our group, which I'd hoped would make people at least stop for a second and look and think, hmm, that's strange. I wonder what this is about.
Mariah says, you're a first time mom and you don't sound like you're in active labor. So I was told to take a cup of Benadryl and sleep it off. 8 a.m. rolls around and Jennifer Crawford is the midwife on call now. She calls me and said, let's get this baby out.
She said, I want you to perform a mile circuit, which is a series of different exercises that they want you to do, different positionings to kind of get things moving around.
It never even dawned on me that Jennifer was a student midwife. At this point, I do what Jennifer tells me to do. I'm at home. My doula comes. I love my doula. She's fantastic. She's hanging out with me. At about 10 a.m., I noticed my contractions stall. They were no longer peaking. I was getting these crampy feelings and then they started to become inconsistent.
They went from three minutes apart, one minute long to once every five minutes, once every 10 minutes, once every three minutes. It was just very sporadic. We wait a little longer. I noticed that my son isn't moving as much. I tell my doula this and she said, I think you should give your midwives a call. Somewhere between 11 and noon, I give Jennifer a call.
I tell her, hey, my contractions have been stalled for a couple hours, and I'm noticing that my son isn't moving as much as he was. And she goes, huh, okay. Well, why don't you come in around 4 p.m., four hours after I called her? We say, okay. I look back at this now and think, wow, how crazy that I didn't see that as a red flag and that I waited that long really to go in.
I wish at the time that I'd just gone to the hospital and said, you know what, my labor's not going normally anymore. And this I think would go to show like how trusting I was in my providers. And how long has it been since your water broke? Water broke at 1 a.m. So 4 p.m. We're looking at 15 hours.
Me, my doula and my husband are in the room with Jennifer. And she grabs a limited ultrasound. And then she was having a lot of trouble with the device. So she brought Elizabeth in. And Elizabeth uses this limited ultrasound to confirm that my son is still transverse breech. So he's laying across side to side in my belly instead of up and down. So he said, you know what?
We're sorry, but you're going to have to have a C-section because he's transverse and he's not compatible with vaginal delivery. I was pretty optimistic. I was disappointed a little bit, but I was like, I got to labor for this long. Things just didn't work out this way. And there was no tears or anything like that.
I was just like, we're going to have to go get a C-section and we're going to meet our son. I was nervous about the C-section part because anybody's nervous to go under the knife. But I asked her, I said, do I need a cervical exam? And Jennifer looks at me and she goes, no, you don't need a cervical exam. You're getting a C-section. So it doesn't matter. So she doesn't do a cervical check.
They refer me over to OBGYN Dr. Deborah Fuller. She works in her own private practice right across the street from Baylor. So we drive over there. We are dealing with the front desk. I had left all of my effects at home, all of my personal stuff. I left my phone. I left my wallet, my purse.
So we're in the office at Dr. Fuller's practice, the front desk, and my husband are chatting about insurance. They're wanting my ID and everything. Also, at the same time, my mom is getting off work and she was going to take our dog. So my husband, he's like, okay, well, let me run home real quick. And we live in downtown Dallas.
So our home wasn't more than 10 minutes away from Dr. Fuller's office. He runs home real quick, gives my mom the dog. During this time, I'm taken back to an exam room, me and my doula to see Dr. Fuller. I'm told to get undressed from the waist down, which I do. I hop on this table. I'm in stirrups, all this stuff. And Dr. Fuller, she does an ultrasound on me and she notices he's transverse.
She doesn't say anything. And she's like, okay, I'm going to do a cervical check now. And I said, do I need a cervical check? And she kind of looks at me bizarre. And she goes, yes, of course you need a cervical check. I need to know how dilated you are. I need to know where the baby's position, things like that. Like there's just things that I need to know that a cervical check will tell me.
And I said, okay, that's fine. She does a cervical check and this is when all hell breaks loose. Upon her exam, she finds that my son has a prolapse cord and prolapse extremities. Not only his umbilical cord was in my vaginal canal, so was his hand and his foot. This is a life-threatening emergency.
If we don't deliver this baby in the next few minutes, you are risking serious, serious harm and death. She runs out of the room and yells to her nurse to get me into her car. She's on the phone with Baylor, telling them everything that they need to know about me, that we're coming right now. I start to hyperventilate at this point. I remember the nurse getting in my face and going,
You're going to be okay. This is going to be fine. I need you to breathe. We're going to take care of you. She sits me on this office chair and they roll me down to Dr. Fuller's car. I'm put in the backseat of her vehicle and put on my side. And Dr. Fuller speeds out of that parking lot like nobody's business. And as Dr. Fuller is pulling out of the parking lot, my husband's pulling up.
And my doula's on the phone with my husband at this point, telling him what's wrong. He sees Dr. Fuller speeding away from the office, and he follows in pursuit. And they get up to Baylor.
As we get to Baylor, there is a stretcher waiting in the drive with two nurses and they open the door and they pull me out and they put me on the stretcher and we are running through the hospital. I'm being asked a million questions. Do you have any allergies? Any medical conditions we should be aware of? When's your date of birth?
We barge into an OR room that is filled with about a dozen people who are shouting. Things are moving around. People are talking to each other. You hear like ripping of plastic and things just being prepped and put on an OR table. There are many things happening to me at the same time. My stomach is being prepped for surgery. I have a catheter inserted.
At the same time, my anesthesiologist is putting an IV into my arm. There is a NICU doctor. on site. And I remember him coming into my field of vision and saying, ma'am, my name is Dr. Thomas, and I will be the head of your son's care when he is born. It's at this moment that I look at my nurses and I ask, am I going to be put under for this?
Because I don't want to be awake for what's about to happen next. And they say, yes, you're going to be put under. And it's right then that I have a
Malik's Law provides us with information that we previously don't have. We're often, as consumers of midwives, met with slogans such as, we are just as safe as any hospital and any OBGYN. And then it is up to the provider or the birth center to give us statistics, statistics that cannot be found through any national database. it leaves consumers really just relying on the word of their mouth.
midwives or their providers or the community to tell them how safe or unsafe certain things are in these settings. Malik's law would allow us to garner information for any indicators leading up to a mortality or a severe morbidity, such as decelerations or previous cesarean section or history of preeclampsia and other high-risk conditions that can occur
during pregnancy, labor, and delivery that can lead to adverse outcomes. So this will all be compiled through vital statistics, which compiles the information for our yearly maternal and infant mortality reports. And they will have a separate report or a report that goes alongside of current mortality statistics that are produced right now.
Currently, we're seeing only hospital statistics and it is a little deceiving because how can we do better and out of hospital settings when we don't have the data to see what's actually happening in the field?
Markita, I remember in the early days, us sitting in coffee shops and talking about how there is a need for more awareness around what is happening in out-of-hospital settings to recognize patterns, to recognize faults and gaps in care, and also a need to bridge out-of-hospital and in-hospital care. That's how Mama was born.
Mama was born to assess some of those disparities, to protect mothers and their babies, and to help provide them with information to make informed decisions for themselves. We're really big on education beforehand. The more knowledge you have will improve. better serve you throughout your pregnancy, labor and delivery, and even beforehand in helping you determine what provider is best for you.
The nuances and types of midwives in the US is often confusing for the consumer. And so really making sure that we Give foundational education on that and what that means for you and how that could potentially affect your care. Questions you should be asking your out-of-hospital providers.
What you should be looking for when you're looking at a birth center and what you should know if you're going to be choosing a home birth. Because this affects everybody. This doesn't just affect us. We're just the survivors. You never know if that's going to be you. low risk pregnancies are known to become unpredictable and become high risk.
And so preparing mothers for that, I think is paramount. Doing what we can to make sure that out of hospital options are held to a high level of professionalism is super important. Especially if we are considering out of hospital deliveries and out of hospital care, to be a bridge to the obstetrical deserts that we face here in Texas.
There really needs to be catch up in making sure that these providers are held to very high and similar standards that we hold our doctors, our nurses, and our hospitals to. and ensuring that there is collaboration.
We've done a lot of research on this and what we have found is the best outcomes come from environments where there were respectful and collaborative relationships between providers and there is a continuity of care.
I love that you brought that up, Markita, because that's really what we're focusing on this year as legislative session is soon to come to an end. We are really hoping to focus on community because that is something that we have all felt at some point in time. I know that freshly postpartum, I've never felt more isolated in my life. Unless you have adequate childcare and
and you have a good support system, and you are more than financially stable, you don't have access to important mental health resources. You don't have access to a community that can help you recover and heal through your postpartum period. And birth trauma happens everywhere. It happens in hospitals. It happens in out-of-hospital settings.
It happens even if you don't have a life-threatening issue that happens during your pregnancy, labor, and delivery. And all of those moments are important. Birth trauma, I wholeheartedly believe, affects the mother you're going to be and the person you grow into after.
So we're making a huge effort to collaborate with professionals from all different walks of this healthcare system to help us come up with some awesome solutions that would help us be able to reach people who previously did not have access to resources that could really help them recover and take the best foot forward in their postpartum and motherhood journey.
This episode actually made me cry, which is really strange because it was about Brittany and her experience as an ex-employee with Origins. But when she said, we had a mom in the ICU and I didn't even know it. I knew she was talking about me. And to hear how she spoke about how the center, these people didn't care about
about neonatal death, about babies dying and me being in the ICU, I knew they didn't care. That's been very clear to me from the beginning. But to hear it from someone else that she was the executive director of Origins and she didn't know I was in the ICU was just heartbreaking to think that my life and my son's life, all of our lives were treated just so callously.
It's awful to relive it and to hear it, but also it just gives me so much hope. There's something very unique about hearing our stories on this kind of platform, even hearing my own story, because living through it, being three years postpartum now, in a lot of ways, I feel detached from the person that that happened to. I feel almost like it's a movie in a way that
Listening to Markita's story anytime always has me in ugly sobs. Malik holds a very large part of my heart and I think about him every single day. It reminds me every day of why I get up and I do this, why I'm so invested in mama and learning more and trying to help. My mission is to help other moms and to prevent this from happening again. This podcast is a dream come true.
I'm incredibly grateful because what has been silenced and what has been pushed behind closed doors is now open into the light and people can make their own choices and they can make their own judgments on what happened. And maybe this sparks conversation to make changes.
Could not agree more. Thank you so much, Dr. Clark. I mean, it brings tears to my eyes just to hear you say that. This started with if we could just help one person, it would be enough. And I think we've done more than that. There seems to be this unequal scale for how we judge hospitals as opposed to how we judge out-of-hospital settings.
There is something very unique about trauma that comes out of hospital birth. someone probably told you that you shouldn't do that, that you should do what you are quote unquote supposed to do and just go to a hospital and just go see an OBGYN. So when you have this really bad outcome, you blame yourself.
And depending on the people that you interacted with, you may have been judged or treated differently during your care because of what you chose previously. And if something really bad happens, There's a lot of blame and a lot of guilt, I know personally. I'm relieved of that blame today. I don't fault myself for the choices I made with the knowledge that I had then.
But now I know better and I can help other people. Our stories are so important. If we are going to start making change in this part of the maternal health field, people are silent. And sometimes your providers are a part of your silence. That is also a problem.
And so I think collectively as a whole, survivors, people who had good outcomes in out-of-hospital settings, midwives, doctors, doulas, nurses, anybody who has a hand in this needs to really look at these stories and become introspective. And instead of saying, I'm sorry this happened to you, say, what can I do? How can I make sure
that this happens to no one else because this is absolutely unacceptable. We need to do better. That has been really awesome to see is how medical providers are reacting to our stories. And I think there's a certain amount of validation that is happening in obstetrical wards and maternity wards throughout the state. I know several hospital systems that are listening.
Every medical system in the DFW area is listening to this podcast. Every resident, every postpartum nurse, even anesthesiologists are listening to this podcast. And I think there's some amount of validation there that is happening. I could not be more grateful to be able to be a part of this.
Something I often see when people are talking about the benefits of out-of-hospital birth versus hospital birth are that physiological birth cannot be achieved in hospital settings and OBGYNs are not trained in physiological birth. I was just wondering if Dr. Shannon Clark could speak to that a little bit.
I'm so glad that you spoke about this on the podcast because I think it's really important. Physiological birth really feels like an enigma in a way or like a carrot that we're dangling in front of pregnant mothers going, you can have physiological birth, but when intervention happens or a birth didn't go as planned and you have to have a C-section for whatever reason,
that it almost seems like this unobtainable thing. And there's a certain amount of judgment. So I think it's really important to note and really make it clear that physiological birth is a lot of things. The definition changes based off of who you are talking to. And I think that mothers, what they should take away from this is that you should do what is best for you and your baby.
If that means that you said you didn't want an epidural, but you're 30 hours into your labor and you're not progressing or whatever, and you just need that epidural, get the epidural. There are options for you that can make labor and delivery easier for you or still get you to the mode in which you want to birth. And sometimes that doesn't happen, right? Sometimes we don't get what we want.
And I think that there's this really big emphasis right now on satisfaction versus safety.
This is something that really bothers us. My therapist, my OBGYN, my insert medical professional, is not in these support groups I'm a part of on Facebook. They're not friends with me on Facebook or they're not direct messaging me on Facebook.
What seems to be really common practice here is these professionals being in these groups that consumers use to get advice or even need to get recommendations on midwives, and they patrol those groups. And when someone tells their story in one of these groups to just warn other moms, other midwives will get on that post and they will make comments about it.
invalidating someone's lived experience, but also it's unethical to sit there and patrol what should be private safe spaces for these moms. There's just a lot of crossing in ethical, patient, provider relationships. There's not a whole lot of regulation there.
So if your midwife wants to call you and text you and harass you about you posting your story online, telling people about it, there's nothing really to stop them from doing that. Dr. Clark, did you want to add to that?
Thank you so much, Tiffany. And thank you so much, Dr. Clark, for being here today.
Hi. Yes, Dr. Clark, I heard your intro and I felt like I was watching another one of your reels on Instagram. It's wonderful to meet you. Postpartum, I did a lot of searching for answers. Part of that was done on social media platforms, looking at people who specialized in birth trauma and things of that nature. And I stumbled across
your social media platform and was just really enamored by the integrity and the mission to provide pregnant people with accurate information. breaking down some of the negative stigma around hot topics such as interventions, epidurals, or even being inside of a hospital.
That was healing for me to see a medical professional and OBGYN take a part of this movement that's happening to really safeguard pregnant people and their babies. So yes, I'm geeking out over here and I'm very excited.
Yeah. Dr. Clark, you say a lot of things that I talk about often whenever I am conversing with other professionals in the field. And something that I noticed about my care and every other survivor that I have encountered is that we are not given advice. all of the information that is needed for us to make good, well-rounded decisions for ourselves. That's the key part.
You go into a birth center and let's say I had a previous cesarean section. We're being told that this is pretty low risk information. But what they're not saying is one in 200 women have a rupture. And if you rupture in an out-of-hospital setting, we may not be able to get you to the care that you need in time to save your life and your baby's lives.
And that's imperative information for us to know. I was a first-time mom. I knew nothing about what was happening to my body. I knew nothing about pregnancy, labor, and delivery. I trusted my providers to tell me everything that I needed to know. And when red flags started to pop up throughout my care, I was always told by my providers that this was some variation of normal.
My providers chose not to refer me to a higher level of care where I could have had informed decision-making.
And I don't mean like the typical run-of-the-mill anxiety of, are they safe? The kind of anxiety I'm talking about is gripping. It is a direct fear of death. It is all-encompassing. It is an entire visceral feeling of my child is going to die at any moment. And that is something that is not normal. It is something that was done to me, how my body responds because of what happened to us.
And what happened to us was preventable. Several points within my care, my providers could have said, oh, hey, something is not right here. We want to make sure you're getting the best care that you can receive. And we want to refer you to an OBGYN to get checked out for more testing because the signs that you're presenting to us is outside of our scope.
There would have been nothing wrong with them saying that to me, and I would have had so much love and respect for them if that is what they chose to do, but they didn't for whatever reasons. Maybe they thought they could handle it. We could speculate all day long about the why, but reality is, they didn't. No matter what the reason, they didn't. Choices like that cost people everything.
Licensed or direct entry midwives, they are regulated by completely different systems than certified nurse midwives or even certified midwives, which certified midwives don't practice in the state of Texas. But either of those groups are regulated by vastly different foundations with vastly different ethical and clinical standards.
Direct entry midwives are nationally overseen by the North American Registry of Midwives, which is a institute or foundation for certified professional midwives. They suggest that direct entry midwives should decide on their own standards for care. So what that means to me is that let's say I'm a midwife and I won't take on anyone who has preeclampsia because preeclampsia is high risk.
So if I suspect that my client has preeclampsia, I will refer them out to an OBGYN. That doesn't stop midwife Jane over here from taking on that client. So it's left up to the individual to decide what is safe, what is not, what is acceptable, and what is not.
When you look at these medical systems that certified nurse midwives and certified midwives are involved in, their foundational institute is going to be the American College of Nurse Midwives. They all have to abide by the same exact standards. They specialize in low-risk birth and pregnancy and delivery as well.
So not only is there a huge variance in what standards are for care and what is acceptable for midwifery care, there's a huge difference in educational standards. Certified nurse midwives having to get a master's degree in nurse midwifery certified midwives going through a three-year collegiate level program to become a midwife.
direct entry midwives or licensed midwives or certified professional midwives. These are all within the same kind of group. And there's a lot more variation there. In the state of Texas, there are many ways to become a midwife. You can go through what is called the PEP portfolio ran by NARM, which is an apprenticeship model where a candidate for midwifery goes through a self-study method. And
is in an internship or an apprenticeship with a preceptor for 1,350 out-of-hospital clinical hours. So she does not have to take any kind of accredited education. She self-studies, and she does these clinical hours with a preceptor, and then she passes the CPM examination, which I don't know what that entails. I've never seen the exam before.
So that is one way to become a licensed midwife in the state of Texas. And if you become a CPM through NARM, then your next step is to take the Texas licensure exam. And then they assign you licensure based on whether or not you pass that exam. Another way to become a midwife is through going through a MEAC accreditation course. It is basically direct entry midwives accredited colleges.
And it accredits certain programs for midwifery. They're all held to the same standard. And from what I understand, to become accredited by Meek is actually a pretty difficult task. Some of these programs within Meek are 18 months long certification programs, and some of them are three to four year collegiate level degrees. And there are some that are in between.
And then the last route is through a Texas approved course, which the minimum requirement to become a Texas approved course for midwifery here, is 250 curriculum hours. And then once upon completion of the programs and your preceptorship, you take that same state exam, you pass it, you become licensed. So there are very many different ways to become a licensed direct entry midwife.
For me, it screams red flags within the profession. It is very scary because you don't know what you're So how are you as a consumer supposed to differentiate and then understand the ramifications of those differences? Understand how it correlates to your care, how it affects that professional's ability to be able to clinically judge what's happening to you during your pregnancy.
I was looking for the best birth center in Dallas. I wanted something that was close enough to a hospital that if I needed or if my son needed medical attention, we could get it pretty easily. That is where I stumbled across Origins Birth & Wellness.
I had read many, many stellar five-star reviews, not only on their Google page, but also by magazines, and I believe DFW Child, all recommending Origins being one of the best birth centers in the Dallas area. They are located on Swiss Avenue and kind of like a historical district of Dallas, literally a stone throw away from one of the best hospitals in Texas, Baylor University Medical Center.
You could actually run to Baylor from Origins Birth and Wellness if you wanted to. For context, my husband and I, we both work in the restaurant industry. At the time, he was a chef at a restaurant in Dallas. If you're familiar with service industry, you'll know that we work a lot of hours and odd hours at that. So he worked a lot of the time. He was like, you know, you pick out some places.
We'll talk about it. This is your body. This is your pregnancy. And I'm here to support you through that. So, you know, we can make these decisions together. But ultimately, I want you to choose where you're comfortable.
So I went in to do a tour at the Dallas location. They did have open houses every Thursday. The facility is beautiful. Imagine Victorian style house across the street being a beautiful park with a gazebo. It had a first and a second story. The rooms were absolutely beautiful. Huge porcelain tubs and large beds everywhere. I mean, all the amenities you can imagine.
So it was very comfortable, very home-like setting, very different than what you typically see in a hospital room, right? Like no beeping, no weird things sticking out of walls, no monitors. It almost felt like you were at home in your own room in a lot of ways. And that's how it was meant to be set up. It was meant to be as comfortable as possible in people.
to help pregnant women feel like they were in their element at the birth center. If I recall correctly, I met Amy Tate, Jennifer Crawford, and I believe there was one or two other midwives there. None of them were Gina Thompson and Caitlin Wages as the owners of Origins Birth & Wellness. I spoke to those midwives and I felt really good about what I was being sold.
I was told that they only hire experienced professionals and they specialize in preventative care, basically. So they keep an eye out on anything that would go wrong before it does go wrong. If anything is abnormal, we would be sent to an OBGYN, which they had backup OBGYNs and they had a great relationship with Baylor.
I was told that if something was wrong with a baby during delivery or birth, that, you know, the NICU team would come literally running down from the hospital if the ambulance couldn't get here fast enough, which was very reassuring to me. My mother had worked for Baylor for 20 years. So I knew that Baylor was a great hospital.
And if I wasn't going to be at that birth center, I was going to birth at Baylor. It's not only all over Origins Birth and Wellness webpage and interviews with the owners, but I was told that they had the same standard of care as any hospital and any OBGYN. They did all the same testing standards and whatnot. Not only that, but they followed ACOG protocols and clinical guidelines.
So this, for me, stuck out. I didn't want an overly medicalized birth. But for me, this was very validating. I have a lot of respect for the medical field, doctors and medical staff. So to me, for them to hold themselves to this same very stringent standard of care to me was a green flag. It was like, okay, great. I'm safe with these people. They're professionals.
If anything was to go wrong, they would recognize it as it was happening or before it was happening.
Once you decide whether or not you're going to use Origins for your care, they went through a self-pay or insurance method at the time. I had Blue Cross Blue Shield of Illinois through my husband's work. So at the time, they were not taking out-of-state insurance, but I was told that there could be an in-network exception and now we just need to apply for it.
Most direct entry midwives do not take insurance, but Origins did. Origins billed globally under their APRN, who was their nurse practitioner. They would also have a CNM hired. So you can bill underneath an APRN. You can bill underneath a CNM. When I was billed, I was billed under their nurse practitioner.
She was listed as my provider, even though in the state of Texas, nurse practitioners don't perform prenatal care. It was another loophole that they got around to get more clientele. to get more money, in my opinion. This was after I'd started to begin care. And before I went to my first prenatal visit, I was given a series of paperwork and contracts to sign.
One of them was kind of like their orientation packet, what Origins was about, what kind of services they delivered, what they believed in, things of that nature. And then I was given an informed consent document that listed all of the midwives that would be attending me in my care.
When their neonatal resuscitation certificate was, how many births they had attended, and whether or not they were licensed under the regulatory body for midwives in the state of Texas, TDLR. I signed it acknowledging that the midwives that would be taking care of me were on there. and that they all had the certifications they needed to be licensed by the state of Texas.
Then I was given another consent document. It was basically a liability waiver. I would also like to state that while I was overviewing this paperwork, I was sitting in their waiting room. The front desk gave me this packet and said, just go through and sign. None of these documents were explained to me. There was no one there really to answer any questions for me if I had any.
So I was looking at this consent document and this was the first icky feeling I had about this place was looking at this liability document. It basically stated that me, my husband, and nobody who is related to us, no third party would sue Origins even in the event of neglect and death. I'm sure that there are going to be people who hear that and go, why would you ever sign anything like that?
At the time, I had been told and was convinced that they abided by these high standards. Well, they were in a hospital, so I guess this is just to cover themselves. This is just a formality. But me and my husband looked at that document and that was our first real, I'm not so sure about this. But we came to the decision. We signed it. We're like, well, it's just a sue.
And I'm sure that nothing like this would happen to us anyway. And so we signed the document and continued in care. My OBGYN, she printed out all of my paperwork that Origin sent over to her. And she said, Kristen, never sign anything like this ever again. She said, no physician would ever ask you to sign anything like this ever. This is unethical at best.
Looking back, what I know now versus what we knew then, and I say this in the kindest way to like the people we were then, we were very naive to a lot of that stuff. We assumed that these people were professionals that were being regulated by the state of Texas. They claimed authority. to be upheld to these really high standards of care.
So to us, certified midwife or licensed midwife was the equivalent of a nurse or a doctor. We trusted them because of the titles that they carried. I wish, looking back then, that we had consulted with an attorney to give this document a once-over. This put a bad taste in our mouths. And that's something that we thought about periodically throughout our care there.
But when things like in my first trimester were going well and everything, we thought it would be fine. And all these people who had all these great experiences were like, well, surely this is just a formality.
Origins Birth and Wellness used several different midwives in one practice. The idea was you would see all of these midwives. So by the time your birth and labor and delivery came along, you'd be familiar with whoever walked in the door. So I saw very many different people. At first, I saw a woman named Rachel. I believe I saw someone else named Danielle. I saw Jennifer Crawford several times.
I even believe I saw Amy Tate once. I was always seen by one person at a time. This is also a really important context for kind of the era that I entered into. Origins was originally owned by three people, Amy Tate, Caitlin Wages, and Gina Thompson. From what I understand, Amy Tate owned 49% of the business. Gina and Caitlin owned the rest, the majority half.
During my first and second trimester, there was some sort of split in ownership. Amy Tate left to have her own practice, and Gina and Caitlin kept Origins. I got an email about it. Everything seemed fine and dandy. Gina and Caitlin wished Amy the best. During this split, most of the midwives at Origins left. Thank you. Thank you. Thank you.
Thank you. Thank you. Thank you.
Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. Thank you very much. Thank you. Thank you.
,,,,,,, ,,,,,,, But that is the only abnormal lab result that is on my glucose test. About 30, 32 weeks, I experienced a big bleed. I was at work. I was managing. At the end of shift, I was outside with a coworker and he was locking up the back door for me. While we were doing that, I felt this gush. I looked down my leg and my legs are streaming blood.
I just very calmly look at my coworker and I say, you need to call an ambulance. And he's still chitter-chattering. And I say again, you need to call an ambulance. And he looks at me and looks at my leg and kind of freaks out and runs inside. I sit down. And at this point, I am doing my very best to keep calm. I was born through a full placental abruption.
And I knew from my own story, from my mother birthing me, that during a placental abruption, it is extremely important to remain calm. So your heart doesn't pump faster, so you don't lose more blood. I assume, because of how much blood was pouring out of me, that I was having a placental abruption.
I text my husband, Thomas, and I'm sitting in this chair. One of my other managers comes out and she's sitting with me and we're waiting for this ambulance to come and get me. My husband and I were only driving one car at the time. And so I had the vehicle. He was skateboarding to work. We lived in downtown. Where we worked wasn't very far.
My husband ran from his job, which was probably about a mile away. ran from his job down to my restaurant and got there just as the ambulance was pulling up. So ambulance takes me to Baylor L&D and I'm kept overnight for observation. I bleed through most of the night. When I speak with the doctors, I asked them, what is worst case scenario here?
They say worst case scenario is that we're performing an emergency C-section tonight. And they said, we're going to continue to monitor, see if things get worse. And we hope that that's not the case. It was a very scary moment for us.
Through ultrasound, they were not able to tell. The doctors that were on my case, they came in and they said, we do think that this was a placental abruption, but a very small one, like the size of a nickel or something that wasn't detectable via ultrasound. And they said, if you have experienced any cramping, any more bleeding, you need to come back straight away.
And I was released the next morning after the bleeding had dissipated and I stayed in bed for the rest of the day. The midwives knew what was going on. We had called them when we had gone to the hospital. I go back to work a few days later and I start experiencing cramping. And it feels like period cramping. No bleeding, but just cramping. I called the midwife line and Jennifer answers.
And I tell her what's going on. She doesn't have me go to the hospital. She does have me come into office though. So I leave work a little early and go to an appointment to see Jennifer. I tell her what happened at the hospital. She said that she thought that what happened to me was a subchorionic hemorrhage.
Subchorionic hemorrhage is a pocket of blood that is essentially trapped between the uterus and the, I believe it's the like the amniotic sac. And sometimes when that's trapped there, the amount of blood is released and it produces a bleed. She was going to treat my cramping with a supplement called eutrophin. She essentially said that it would calm an agitated uterus.
This is Jennifer, the student. Is there a midwife overseeing this visit? No, it was just me and Jennifer in the room. I felt like I had a good relationship with Jennifer. She was the one I saw the most. So when Jennifer said that, this was just a subchorionic hemorrhage, nothing to worry about. I believed her. After I have this abruption, things really start to snowball downhill for me.
My mom had bought me a BP monitor because at this point I was gaining weight. I was beginning to puff up and swell. And my mother was worried. She was like, you know, I'm really worried about your blood pressure, Kristen. I'm worried about you having preeclampsia. Here is a BP monitor. It was cuff and everything. You can buy it at CVS. Just keep an eye on your blood pressure for me.
And so I did that. I had a reading at home that was 138 over 90. I was pretty stressed at that time because I was supposed to have this big meeting with the owner of the restaurant I was working for. I figured that it wasn't a big deal, but I went to another visit with Elizabeth. Elizabeth is one of the midwives who came on in my third trimester after there was a split in ownership.
So Jennifer went from running clinic by herself to having Elizabeth Fuell and a CNM working with her. So there were three midwives at the time. Elizabeth said, if you can't work less than what you're working, get off your feet as much as you are, then you are going to have to go on bedrest. So from what we understand, direct entry midwives specialize in low risk, normal pregnancy.
I've gotten to a point thus far where I have out of range labs. I have several instances of high blood pressure and symptoms of spots in my vision. I have this big bleed. I continue to cramp and have problems after this bleed. I'm not sent to an OBGYN and I'm threatened to be put on bedrest, but you're still continuing to keep me in care.
If I was having a normal pregnancy, there was no reason why I would need to be put on bedrest. Did they know about the edema too, the swelling? They never said anything, but looking at my flow chart, from 30 weeks to 32 weeks, I'm 136 pounds. From 32.3 to 34.3, I'm 143 pounds. I almost gained 10 pounds in two weeks. And then at 36.4 weeks, I go from 144 pounds and then to 38 weeks, 151 pounds.
So in less than two weeks, I almost gain another 10 pounds. There is severe fluid retention there. It was never addressed. My weight was never a concern. I looked into this because I was like, how did I have preeclampsia and not know? That weight gain at the end there was a big sign for preeclampsia.
I'm being threatened to be put on bed rest because of this bleeding episode that I have that the doctors at Baylor considered a placental abruption. My pregnancy is not normal at this point. Things continue to get worse.
At that time, I was still feeling confident in my team. I was always told that this was a variation of normal and that I had no reason to worry. I was never referred to an OBGYN to be tested for preeclampsia ever or any kind of further testing for my glucose readings. I was invested in my team. I believe that they cared about me. I liked Jennifer. I cared about Jennifer.
I thought she was looking out for me. I thought I was in good care. I really did. After 34 weeks, you sign in your financial contract that you will not receive any refund for services rendered, even if you transfer care. That being said, it was definitely frowned upon for people to transfer out of care. Because when you transfer it out of care, it just didn't look good.
Exactly. And also, too, even though you pay your cost for care up front, There are many other things that they're pushing for you to buy, such as their chiropractic packages, their placental encapsulation, their supplements, massages, IV therapy. At one point they were even doing Botox.
They offer a wide range of services, so they can't crank out any more money from you if they transfer you out of care early in your pregnancy. At 36.4 weeks, we're looking at January 12th of 2022 at this point. It is discovered that my son is breech. It's recorded, but on my flow chart, they record that I was breech at 32 weeks.
But 32 weeks was around the time that I had gone into Baylor for that placental abruption. And they had never mentioned this to you if that was the case? No, they never mentioned. Well, they wouldn't have known. So my scan wasn't done until 36 weeks. And I don't know why they would record it that way because my son was discovered to be breech at 36 weeks, not at 32.
But it was recorded as such in my chart. At 36 weeks, I see a brand new midwife. She's a CNM. I think I saw this midwife once, maybe twice. And upon seeing her, I was 36 weeks, but I was measuring at 31 centimeters fundal height. So that means my baby was not growing normally anymore. She sends up red flags. I was like, what does this mean?
She says, honestly, it can mean that there's something wrong with your placenta. that your placenta is not doing what it's supposed to and your son's not growing normally anymore. Those are along the lines of what she said to me. It was very upsetting. And she wasn't being rude or anything of that nature. That's not what I mean. But she was the one that was like, something's not right.
She says, you need to get an ultrasound. And they had a guy that came in every Wednesday that did ultrasounds. So it is Wednesday on the day that I have this visit. I go to the front desk and they say, we'll get you scheduled for an ultrasound next week. I'm sorry. You just told me that my son is weeks behind in growth.
And you're telling me that you're not going to get me in for an ultrasound until next week. I went out to the car and I was crying. And my husband was like, you know what? No, we're going to go in there and we're going to demand to get an ultrasound that day. And so we went back in, we talked to the front desk and we were basically like, we need to get this done today.
If there are issues or if there are signs that our son's not growing normally, we need to know now. We get this ultrasound done by Moody Diagnostics, Dr. Brunson. My son is breech positioned. There are many different types of breech positioning for babies. My son is what was called transverse breech. So that's like when your baby is laying like a banana in your uterus.
So he's laying across side to side in my belly instead of up and down. Looking at this ultrasound, my son, who had been developing normally my entire pregnancy, suddenly was almost two weeks behind in growth. This is also another major red flag that my provider should have recognized as being abnormal. I'd had multiple high BP readings. I had started to swell pretty severely.
At this point, I had abnormal lab results. At 36 weeks, my hemoglobin was low. My hemocrit was abnormal as well. So all of these things were suggesting that there was something more going on than just a normal pregnancy. When you have preeclampsia, your body is beginning to deteriorate. Your kidneys are not functioning normally. Your liver is not functioning normally.
In worst case scenario, you have seizure-like episodes. Looking back at my records, I don't understand why I wasn't referred. Even at 36 weeks and four days, I was not referred to an OBGYN. Because my son was breech, they did refer me for what is called an ECV, which is a medical procedure that moves the baby.
So I'm scheduled for this, but also at the same time, I'm told to perform like a spinning babies exercise. Spinning babies is like a natural program or philosophy that if you do these exercises, sometimes you can naturally turn your baby over. There's one night where I feel like my son is like jumping up and down in my womb.
So I call the midwives the next day and I say, hey, I think my son turned over. Can I come in and have my baby looked at? I think it was Elizabeth who felt around for my baby. She proclaimed after doing a manual examination, pressing down on my abdomen, things like that, that my son had turned over, that he was no longer breech and he was in the right position.
No ultrasound was done to confirm that my son had flipped over at 36 weeks. And this is important to note because of how my labor and delivery will go.
great, I'm safe with these people. They're professionals. If anything was to go wrong, they would recognize it as it was happening or before it was happening.
We assumed that these people were professionals that were being regulated by the state of Texas. They claimed to be upheld to these really high standards of care.
I had spots in my vision. Jennifer told me that, oh, that's nothing to be worried about.
And this is when all hell breaks loose. This is a life-threatening emergency. If we don't deliver this baby in the next few minutes, you are risking serious, serious harm and death.
There's a quote that says, at some point, we need to stop pulling people out of the river and travel upstream and discover why they're falling in the first place.
My name is Kristen. Me and my husband became pregnant in 2021. At the time, I wasn't one way or the other when it came to choosing a provider for my pregnancy. And honestly, when I was first looking for a provider, I wasn't really thinking about midwifery at all. I assumed that I would give birth in a hospital with an obstetrician. I didn't really even know that there was another option.
However, I was talking to a coworker who spoke about his wife's experience with a home birth midwife and how it was just a great experience, very easy. His wife recovered very quickly. I was like, okay, that's interesting. And then I was kind of looking into more personal how I wanted to birth, how I wanted to labor and deliver, and what I wanted my pregnancy to look like.
And I stumbled across what's coined now as natural birth or physiological birth. Ideally, I wanted to try to give birth without any pain management, things of that nature, just to give it a shot on my own. And when you begin to look into natural birth or physiological birth, you come across a lot of different types of content.
You come across bloggers, birth gurus and doulas and midwives and all these different types of accounts that talk about you don't need to give birth in a hospital. Historically speaking, women were built to birth. And so I started looking into more of how to quote unquote train for natural birth and delivery.
You know, when you look on Instagram and you see all these pictures and videos of these women like having these beautiful transcendent births in bathtubs filled with flowers in their home or That victory face after a woman's just given birth, unmedicated on her own. You look at that and you think, I can do that too.
And you're further convinced by these people on these platforms that you were built to birth. When you're consuming these types of platforms that tell you that physiological birth and natural birth is the best way to go, there's also some other stigmas that come with it where if you walk into a hospital to birth, you better be prepared to advocate for yourself.
You better be prepared to know more than the doctor about certain procedures and statistics. more or less, you're going to experience obstetric violence, trauma, and a cascade of interventions, which leads to higher rates of cesarean sections and whatnot. And above all else, I just did not want to be traumatized. It didn't matter to me whether or not I was with an obstetrician or with a midwife.
I was raised by a nurse. So I had a very neutral... feeling in a good respect and understanding for the medical field. This concept that my providers wouldn't be for me or wouldn't make the best decisions for me was kind of a foreign concept to me. I started spreading my feelers and looking for other options. I'd heard about birth centers.
I know in a lot of other countries similar to the United States, economically, primarily use midwives in their maternity wards. For example, New Zealand, they have some of the lowest mortality rates in the world. Texas had lots of obstetric deserts. 46% of our counties are considered obstetric deserts where women do not have access to a hospital or a maternity ward over a 30-mile radius.
That is almost half of our counties. And there are more and more and more people flooding into Texas in the last few years. Obstetricians are fleeing our state because of strict abortion bans and bars on their practice. We are in a lose-lose situation right now.
If we are looking at direct entry midwives as the answer to our lack of prenatal care and access into the state of Texas, we are in bad shape indeed. There is such a lack of foundational regulation and educational standards here. There's not a lot of unification or standardization inside of the profession itself across the United States. I really do love midwifery.
And there are going to be a lot of people who listen to this and go, does she really? But it's true. I was enamored by the belief in physiological birth and a woman's ability in the miracle to produce life.
I do believe there is room for less hands-on intervention and to allow what is normally considered a natural process to happen under expert guidance and supervision to be safe keepers if things do go wrong. And I think America as a whole needs more of that in their awards. We need more respect for women's autonomy.
We need to allow women to make choices for themselves by giving them the safest options available to them and talking to them in ways that to help them understand the situations that they're in. Because oftentimes I see women who have gone through birth trauma, which occurs to more than you would think. And it was through an intervention that was necessary, but no one explained what was happening.
No one was holding her hand while these things were happening and telling her, this is what we need to do to keep you safe. This is how we're going to do it. Can we do this? The way that we talk to women inside of hospital rooms when they're giving birth can be at times dehumanizing. We forget about the woman and
focus solely on the safety of the baby, which more or less this is what this is about, but it is about the whole. It is about mother and the baby and how they begin to come apart and how we treat her in this process is going to affect everything about the mother that she is.
And that is kind of the key point of what drives me to tell my story because this misunderstanding and this mistreatment of women is not just happening in hospitals. It happens in out-of-hospital births, and I think that there is a lack of discussion with inside of the midwifery community about what can we be doing to bridge the gap, closing the parameters of risk.
That is what I'm hoping to incite here, is that I believe in this process. I really do. But I believe in it when it's done safely, when it's done ethically, and when it's done in a way that gives the woman that is taking these services in a way that allows her to see the full picture.
that isn't swaying her one direction or another is laying out the risk and really letting her understand and decide those things for herself. So that's really what I'm hoping to get here. In no way am I trying to discriminate against the midwifery community or signal that there needs to be an end of midwifery in the United States. What I'm trying to wave here is a red flag that says we need help.
This field needs help. There's a quote out there that says, at some point, we need to stop pulling people out of the river and travel upstream and discover why they're falling in the first place.
And I think that's what we need to do as a community, as a whole, as consumers and as midwives, is we need to start looking at why people are falling in the river in the first place and not just writing it off. We cannot write off these instances. For the most part, The community tries to focus on the good because mostly good happens. Mostly pregnancy and delivery go normally.
But that means people like me are not truly safe. When complications arise and you are in the presence of people with varying degrees of education... Texas has multiple pathways to licensure for midwifery through apprenticeship model or a state-approved course, or you can go to an accredited college, but it's not required. I did not know this. This is what I learned later.
When you're hiring a midwife, one, you don't know to ask. Two, you don't know what kind of education they received. You don't know what kind of education their preceptor received and what they believe in and how that was passed on and how that's going to affect your care. Abnormalities and complications can happen to anybody. And that is the thing you don't realize as you're walking into care.
You think it's not going to be you. I was a healthy 20-something-year-old. No prior complications or medical conditions. There was no reason for me really not to have a normal, uneventful pregnancy. But it happened to me. We cannot write off death. We cannot write off morbidity and extreme trauma because I know this personally, you affect a whole generation. Let's be honest.
What happened to me affected the mother that I am today. In a lot of ways, I felt like the mother that I was supposed to be was stolen from me because of what had happened to me. And I've had to work really, really, really hard to get back to who I thought she would be. I think that I probably would have been a lot less anxious.
This has never been about getting rid of midwifery or abolishing midwifery or insert X thing that people like to say about us and our organization. We see on Instagram and on social media that These perfect, beautiful births that are happening in out-of-hospital settings, but we don't talk about what happens when things go wrong. I've had someone say to me before, I can never do what you're doing.
You absolutely can. Let me tell you, before all this, I definitely was not like a confrontational person. I kept mostly to myself. I wasn't a leader of a movement. I didn't feel like I had that in me. But when the only other option is to do it yourself and your reason why is meaningful enough, important enough, you will do the damn thing regardless of how scared you are.
regardless of how confident or not confident you are. When I started this, I had no confidence. I was like, I have no idea what I'm doing and everyone's going to be able to see it the moment I walk into a room. Even now, sometimes I feel that way. I have imposter syndrome. I'm no expert in what I'm doing, but I know that if I do it right, that this could potentially save lives.
That propels me to figure it out. And that's what all of us are doing. Anybody who has ever started a movement or a nonprofit or became a lobbyist or whatever, they started from ground zero, which meant I know nothing about this, but I have a reason. And so I'm going to figure it out. And that is how you do things like this. I would like to think that most people could take up arms and do this.
I'm extremely grateful. It was not by my own fruition that has gotten us this far. It is by everyone who's entrusted me with a story, everyone who has reached out to me to give me information to help me along my way. Anybody who's reached out with the power to help, the ability to help, That is what's helped us get this far, and I'm so grateful to all of those individuals.
In Frozen 2, Anna sings the song, The Next Right Thing, even though internally she's feeling awful. She's in despair, and she chooses to do the next right thing, and that led her to all the things that led to the solution and the happy ending that you see in Frozen. The quote from that song, the next right thing repeats in my head often. Just keep walking, keep moving, doing the next right thing.
And I think I'll eventually get to where I want to go.
I just appreciate what you do so much. I truly do. I admired your podcast before, and I'm so honored to be here to be able to tell my story. If this changes one person's mind or makes one person ask questions about safe practices in their state, we've made the dream come true. So thank you so much for giving us the opportunity to speak here. I really appreciate you, Tiffany.
Not at all, Kristen. What I'm saying is the American dream is not let them eat flat screens. If American families aren't able to afford a home, don't believe that their children will do better than they are, the American dream is not contingent on cheap baubles they have from China, that it is more than that. And we are focused on affordability, but it's mortgages, it's cars, it's real wage gains.
And we are The Prosecutors. Today on The Prosecutors. Last week, you got a look behind the mic on some of our bloopers. This week, you're getting more of the same. Happy New Year.
See, that tells you who's the bigger person.
There's some things I'll never change.
I think it's more of a long pause.
I did have a good day.
Is that right? I guess that is right.
It was too cold for us.
Were you at the dinosaurs?
Did I ever get you a copy of The Call of Cthulhu for beginning readers?
No. Well, I'll have to get you a copy of that. Cthulhu has cephalopod-ish tendencies.
Well, that's not what you do anymore.
You keep the bad guys out of jail.
Okay, we ready to do this?
I got to put the name. Sorry. I was too busy talking. I was listening to you. I'll go back to ignoring you since that's a better way to do it.
That's true. We sure will.
I'll let you shout out the school because I forget which one it was.
Ooh, let's do it! Okay. I gotta think of something to call you. Sorry. I got all hyped up for nothing. Okay.
It wasn't you, Sophie. It wasn't you.
You know, I guess by the time this comes out, we'll be back from CrimeCon. How is that possible?
Yeah, hopefully we're still alive. If not, enjoy this final episode of The Prosecutors. It's been fun. But assuming that we do make it back from CrimeCon, and probably even if we don't, because we'll probably record this before we go to crime.
i'm gone done all right i'm gonna start the start to live up okay i need to think about um you just it's no rush no rush you'll be thinking i'm feeling this is the first time today i feel like i've got to sit down so oh no has it been a crazy day oh it's been a wild day
I put it on like two times. Basically, from the moment I got home until like 20 minutes ago, I was watching it.
Yeah, I had to do this sentencing for this lawyer who decided to leave the office and join private practice. So I was left with the case.
We can talk about it later. It went fine. It went fine.
And we didn't have witnesses. Two hours? It was just.
I'll tell you all about it later.
Wow. I'm making you nervous. Yes, they really did sneak me out the back because there were people waiting on me up front. So I had to go out the back.
No, they took me out through the back.
No, it was just pretty obvious that there was a group of people waiting on me if I walked out the front.
You did in so many ways.
That's why you get those removals.
Yeah. How do you feel? Everybody wants to know how you feel. Do you feel better?
I mean, look, somebody's got to prosecute, right? Somebody's got to say you did a bad thing and you have to go to prison.
I'm sorry. I'm sorry you have to go to prison. It's not my fault.
What do you need lungs for, anyway?
I don't know. Anybody in the... There you go. Sneaky. Perjurous.
People get mad when we say somebody lied. They get mad.
Do that. Yeah. Yeah, while she's gone. I mean, goodness gracious. I mean, it's like a different language over there. In South Carolina. In Chocolana. They're like, do it. I just don't get it. Low country. Got great grits. But it could have been Barnwell County. It sounded like Arnwell or Arnold to me. Could be Barnwell. Could be anything. Any number of things. But anyway, Barnwell. Sharklina.
Anyway. So I had this like crazy. Today was a really busy day. So I'm glad to be with you guys. Drinking bourbon. You know. This is when bourbon tastes especially good. You sound the same, Brett. That hurts my feelings, Lillian. But it would be Lillian who would hurt my feelings. Because that's what she does. Just constantly. There we go. Wouldn't be alive without Lillian.
Looking all serious in her photograph. No. Thank you, Mr. Blair. Thank you. I do what I can. I don't have a Odyssey, so I can't talk about that. I do love Costco. Costco, by the way. Excellent liquor department, if you guys are ever looking. The Costco brands, fantastic. Highly recommend Costco tequila. Silver Costco tequila, great. Just as good as like Patron or Don Julio. Don Julio.
I do not get heartburn from bourbon. I do get heartburn from Sonic on occasion. Yeah, so for a long time you couldn't buy alcohol, or you could buy alcohol, but you couldn't buy liquor at the Costco in Alabama, but they have changed that. And there's Jason Ussery saying Merry Christmas, as always. Kirkland Savion Blanc. I'd get all my wine some first leaf, like you should. I'm just saying.
There you go. Punishment.
All right. Sorry I kept you so long, Alice. I forgot you were actually trying to, like, do work tonight.
We didn't quit our jobs. That's what I've decided. I was watching the hearing at two times speed because I couldn't watch it live because I was in the sentencing. I was like, why are we still working?
I was like eating ramen because I didn't I couldn't eat anything else.
We'll just call it part two.
And we have ads to record too. Yes. We can do that as well at the end. So if I'm sniffly, that's why.
Um, well, yeah. And I also, I mean, I don't know.
Well, the thing that I always think is funny is when people talk about how we go on and on about stuff and I'm like, but we really don't. You compared to most podcasts.
That managed to get like eight or nine episodes out of one story where there's no information. It's like, I don't know. I think people just like to complain though.
Apparently some people are, there's a hockey game on, so we may have a lower number. I let all of you who are not watching hockey be the good friend.
That's true. That's true. We see you, Lily. We see you.
Okay. I'm ready. I sent you the email. I got you. So that was what I wanted to talk about. Turn your volume up just a little bit.
It's been a little low lately.
Yeah. I have a few suspects. I'm going to go ahead and go live.
All right, here we go. Now, look, we'll probably record more with you guys.
Yeah, I mean, we'll probably be recording for 2025 in late December. You may. Right. There's probably going to be a few weeks here, maybe all of November, that you don't see Alice at least. You may see me some.
And Alice is just so into the Delphi thing that.
She actually will see us at least one more time because I think Sunday. We'll do one more recap. Assuming.
She is superhuman though.
There you go. In case you're wondering. Are you ready to start the show?
Okay, do you want to stop recording?
Okay. Yesterday, my daughter, who was supposed to be taking a nap, gets up from her nap and comes in to the living room where my wife is working and says, Mommy, I just have one question. Who is DB Koopa, and why did he steal the money?
Whenever you're ready to start, I'm ready to start.
It says it's obviously aliens.
Yeah, it's because it's coming out of my speakers.
Just gotta tell it where to go through. Let's see.
We got home yesterday. Nice.
Oh, and you didn't even invite me.
Oh, that's funny. Okay, let's see. All right, I've changed the audio output, so it should work now.
I'm testing it real fast.
24, 25. No more cases until 2026.
Okay, let's see. We started making jokes.
Let's do it. You ready? You got to start.
Have you ever not been spicy?
I mean, we can probably get three episodes out of Mr. Bojangles alone.
Yeah, and like Snapping Turtles. We need to do a whole episode on Snapping Turtles. Like, was there a wrestling match that night or not? Who knows, right? It's a complete mystery.
No, but I'll tell you what.
I really enjoy making people mad. I mean.
See, that's the thing. Like, Alice pays no attention to the social media at all.
Barely any. Just a little bit.
Yeah, Jo. That is so true. No, like, yeah. Alice notices social media usually when I've gotten people stirred up about something. She's like, what is going on?
You know, I mean, I'm just...
I don't know. If people come here to get some bowler plate what you expect to hear thing, that's not going to happen. I'm sorry.
Let's just be clear for those of you, the 59 of you here still in the room. Alice doesn't know anything about Westminster.
She could not name the three.
If we do it and we think they're guilty at the end of it. we are going to tell you that they are guilty. So if you want us to cover this case, just know that if we get to the end of it and the evidence, not the documentaries, not the books, not the, the, you know, shiny statements by Pearl jam say that they're guilty. That's what we're going to say. And on the other hand, Oh yeah.
Eddie Vedder, big supporter. On the other hand, If when we get to the end, we don't think they're guilty, that's what we're going to say. And it just doesn't matter to me who gets mad about that or how mad they get. That is what's going to happen. And that is the only promise we've ever made to you is we will not lie to you. We will tell you exactly what we think about any case we look at.
Why don't you just write a cookbook
Yeah. I mean, and that's the thing with courts. It's, it's, it's always fun. To sort of see how they support their reasoning. I mean, because that's the thing. I mean, court opinions are reasoning. That's what's great about the courts.
As I think it was Madison said, or Hamilton, maybe it was Hamilton, that the Supreme Court, the judiciary was the least dangerous branch because it doesn't have armies, can't pass laws. All it can do is convince you that it's right. And the reason you, at the end of the day, I mean, the reason that you uphold it is because the reasoning's good.
And if the reasoning's bad, then eventually some other courts can overturn it. The opinions that endure tend to be the opinions that at some point, even if they're not initially, become unassailable. And then other things fade away because, even if it takes decades, You know, eventually people see through it. I mean, it's something like Plessy versus Ferguson, which is an 8-1 opinion.
I mean, you got eight justices and there's one guy, one guy who's like, hey, I don't know about this, guys. This seems to be contrary to the Constitution. And it took a long time. I mean, it took 60 years, but eventually that was overturned by a 9-0 opinion.
And I mean, we will do it eventually, guys. I don't know where this idea came that we were never going to do West Memphis 3. We're going to do West Memphis 3 eventually.
I'm hoping this podcast has a lot of longevity, so it might be a while, but we'll do it eventually. And Paradise Lost, some people are discussing Paradise Lost in the chat. The first Paradise Lost is really good. And I think you can watch the first Paradise Lost episode and come out either way.
I really think you can watch the first Paradise Lost and think that at least Damien is guilty, even if you think the other two aren't. Or you can watch it and be absolutely convinced that a horrible injustice was done. Paradise Lost 2 is trash, as Joe says. Absolute, exploitive trash. And if you want to see an example of just horrendous, money-grabbing documentary, Paradise 2 is your go-to.
And then you got West of Memphis, which is obviously a, you know, they were in the bag. Yeah, it's an advocacy piece for the West Memphis Three. And then Paradise Lost Three, which brings everything around and sort of it and West Memphis are very similar. And then the book, The Devil's Not.
If you haven't read The Devil's Not, obviously from someone who believes West Memphis Three are innocent and is honest with you from the very beginning. That's what she thinks. Very well written. I really enjoyed that book a lot. So if you're looking for things to look at while you await our eventual inevitable coverage of this case.
I mean, I don't know when it's going to be. It could be, it literally could be years from now.
Yes, it will take a while.
Yeah. I think Gina needs to spend a little bit more time with the record if she thinks there's no evidence against the West Memphis Three.
Jesse Miskelly's confession, which didn't even come in in the trial of...
This has been fun. We will talk to you guys soon. Alice, I want to record one thing with you after we let everybody go. But we'll see you guys soon. Thursday, probably, right, Alice? Probably Thursday, yeah.
No, let's do Thursday. Thursday's fine. Thursday, for those of you who want to know who D.B. Cooper is, you will find out.
On Thursday. So we'll see you guys then. All right. Bye, everybody.
Yeah, something light to end on. Okay. Well, I don't know when we'll be back. We have that other thing we're doing on Thursday.
This is going to be a wild one, guys. This is going to be a wild one.
I don't know what's going to happen on this. We'll just go. Okay, here we go.
All right. Well, you guys are awesome. We'll see you soon. At some point, we'll get Alice to do that cookbook.
Is that adrenaline pumping?
The sweet 16, baby. I know y'all are all watching. Pulling for Bama. Well tied. Two down, four to go. It's three two-game tournaments. Remember? Won the first one. Personally, I was just glad to see Florida lose and Yale win. Right, Paige? Let's see. How's Yale doing? I'll give Alice an update when she gets back. No, Yale's losing.
And now they're playing a good team this time, so they're having trouble. Yeah, they're down 12 now.
Yeah. Chocolates. Good for you.
Oh yeah. You gotta do that. That's right. There you go. Great. That's what I'll do too. I'll watch the documentary.
Yeah, we're doing an interview tomorrow, but you guys can't take part in it. Sorry.
You'll have to hear about it later.
We did, but I mean, whatever, you know.
I had it scheduled for next week. I told Jason to do it next week.
It slipped my mind because I was gone.
Because I want to go ahead and release the Delphi one because it's timely.
We'll see y'all later. Talk to y'all soon. Bye. Bye, Alice. I love you. Bye. You're the best.
If somebody else puts it together, we'll show up as the special guests.
Don't forget to stop recording.
What's funny is, you know, we did that GetVocal, and it was like 100 people, and that was the most people we'd ever had.
They were trying to move towards that.
Do you want to record an ad real fast?
Well, they're doing those pre-records like the Huggies ones.
Which I like those a lot.
In a quiet suburb, a community is shattered by the death of a beloved wife and mother. But this tragic loss of life quickly turns into something even darker. Her husband had tried to hire a hitman on the dark web to kill her, and she wasn't the only target. Because buried in the depths of the internet is the kill list.
A cache of chilling documents containing names, photos, addresses, and specific instructions for people's murders.
We talked very slow. It was the slowest I've ever talked.
We have to do it tomorrow.
Oh, was this at the club or whatever?
We're out. We leave. Tuesday.
It was fun at the beginning and it was fun at the very end. The in-between was a little stressful.
I love that. I love how y'all are huge. Hopefully we didn't ask that before.
I wondered the same thing.
Hey, David. Sorry we picked Kristen over you. It's not because we don't like you.
we love you david oh thank you guys for picking me most people one second before you sign off guys i have to end the stream to download the local things but we love you we'll see y'all soon then we go live so you stop talking about all of our fans whatever i love our fans yeah you notice that i i because i'm the bigger person
Because I'm the bigger person. I took out one of my dashes. Even though I think one dash is inferior to two dashes, because I'm the bigger person.
Hi, thank you so much for taking my call. So my current situation is I recently turned 30. I lost my job four months ago. And right now I'm living with friends on EBT and have state insurance. Okay. And I'm also in $42,000 a day. And so I've been actively on the hunt for a job, but I just haven't had any luck.
And so obviously it's just been like a really dark and heavy place to be because at 30, I literally lost everything and I had nothing going for me.
Okay. Thank you. Well, in the meantime, I've kind of revisited this dream that I've had on my heart for seven years, which is to start a nonprofit. And so I was like, well, the market's so bad. Let me just maybe go after my dreams. And so As I've been looking for work, I've also been taking steps towards a nonprofit.
And I've just been getting green light after green light and after green light, which doesn't make sense because I always thought when I started this nonprofit, I would be stable and 100% out of debt. Well, this is kind of where I'm at right now. My dilemma, which is why I'm calling you, is I have a chance to receive $5,000 from someone who believes in me.
And I could take that $5,000 and it could cover my basic needs for about three months And so do I use that $5,000 to go into creation mode and pursue this dream, or do I stay in survival mode and wait until I get mad at it?
Hi, thank you for taking my call. My husband and I have a slight disagreement. I have... Most of what our income is, is rental houses. And in 2023, we purchased four new houses. That puts us up to 24. And we've already paid one of them off. We still have three outstanding mortgages. And the total for all of them combined is right about $420,000.
And I have a stock portfolio that has $506,000 in it. His idea is that we go cash it out right now and go just pay off the mortgages. I'm like, no, that's kind of my, that was my plan for retirement in case everything else went south. The way things are sitting up, we're scheduled to have all three of these other mortgages paid off by the mid of 2028.
And I don't see what would be the point of cashing out all of my stock portfolio to pay them off now if we're literally going to have them paid off in the next couple of years.
For the most part, it's literally, that is mine aside from, I only work 26 hours a week doing home health care. And so then I also manage our 24 rentals. So I only have $7,000 in a 401k of my own, and then he has $22,000 in his 401k. But other than that, that's really... Is this stock portfolio non-retirement?
It's in a combination of mutual funds, independent stocks as well. I've had it... Managed by the same gentleman for the last 20, I'm 41. And he's managed it and he gets somewhere between a 13, 14% every year return, even when the market took a crash in 2023. Okay. So you trust this person. He knows what he's doing. Yes.
And I just, I don't know if it would be worth pulling it out to pick because we bring in If you average, we always have one or two tenants who is either late or misses a month. But we bring in about $21,500 every month on rent. So it's not like if we were to have to worry about something, there's enough to cover.
The three of them combined, the minimums would be $3,800. We're putting $10,000 a month on the other one, on one of the three.
Well, our market here has been absolutely nuts. So I have the tax valuation at $4.2 million.
I would say it's probably closer to $5 million.
That would be entirely doable.
But I'm not sure what she realistically expects. I'm not sure.
Potentially. Though I think that my husband was already suspicious beforehand, so I think that they could realistically have a conversation that... Yeah, your husband would have to kind of fib and not be like, your wife told my wife and I know what's going on.
Ich denke, dass es wahrscheinlich relativ normal ist, fΓΌr Menschen, die vielleicht auf dem gleichen Niveau sind, zu hΓΌpfen. Ich denke, dass jeder mit dem Gehirn wahrscheinlich die... Power Dynamics of an upper level resident and applicant.
Und dieser Versuch ist brandneu, also denke ich, er ist wie ein Puppe, der nicht denkt, brandneuer Versuch, ja, los, erste Person, die ich sehe.
Genau. Und ich denke, es war wahrscheinlich ein bisschen auf die gleichen Linien, als er sie anruft. Die Beratung ist bereits passiert, wo sie in Theorie ihre Entscheidung machen, aber sie haben diese Entscheidung noch nicht offiziell gemacht. Diese Entscheidung wird nicht mehr fΓΌr ein paar Wochen offiziell werden.
So the but at least on paper they have and I don't know, this is closed off information to my husband, of course me. So I don't know what that decision says, but at least in that meeting or the meeting leading up to it that my husband was in along with this upper level resident, he was, you know, advocating for her like.
Yeah, I want my hot new little girlfriend to be here and not thinking through the consequences of that. And I think now he's starting to realize that this could potentially end his career.
So should I just kind of give that advice to my friend?
Good. My name is Kristen. I am 30 years old. And an applicant is sleeping with superiors, including my friend's husband. Should we tell the boss?
Distances himself and then we just hope that if she does end up here at this program, that she doesn't... The good news is, short of her
Right. And I think that even though there is still some risk with that, that's the best case scenario, is that she ends up not here, but she does get a position somewhere else. And like, at least for us and our program and our friends, this is all in the past. I just think that it's looking like that if nothing changes, there is a decent chance that she is going to end up here at our program.
Ja, wenn jemand am Arbeit ist, sieht es so aus, als wΓ€re es schmutzig, aber ja. Wenn seine Frau es den Leuten sagt? Ja, naja, zu Beginn war sie einfach nur gespannt auf das Arrangement und dass ihr Mann sie weniger fΓΌr Sex interessiert. Und zuerst war sie einfach so, ja, ist das nicht eine interessante, neue, neue Sache? Ich glaube nicht, dass sie zuerst erkannt hat, dass das problematisch war.
So, this is someone applying for the residency program. So, my husband is a surgical resident. So, these are doctors who are in training for their surgical specialties. And they are doing applications for the incoming class of residents.
Okay, but yeah, so I'll just focus on being a good friend.
The one idea that my husband did, like is somewhat seriously considering, is going to the program director and saying like, hey, this applicant told me that their interview process was discontinued at both of the other institutions that They rotated at, I thought that was weird, do you know why?
And just leave it as a, like, I heard this information, I thought it was weird, do you happen to know why? and not directly get involved in what's happening here. But I don't know if even that is... I mean, that's definitely an option.
Part of me, and I just also need to get over this, part of me just feels a little bit guilty as well for the program director that she's potentially stepping in shit and doesn't even realize it.
Yeah. So the boss, so the person who is ultimately in charge of the program. Is a woman. Und ich fΓΌhle mich ein bisschen schlecht fΓΌr sie, wenn sie jetzt in dieser Situation endet, in der sie mit all diesem zusΓ€tzlichen Drama in ihrem Programm handeln muss.
Ich glaube, der Applikant wird technisch in ein paar Monaten Doktor werden.
Yeah, I agree. That makes sense. I'll just focus on being a good friend, giving advice to my friend. Let the chips fall where they may with the rest of it.
Wir sind ein sehr festgelegtes Programm. Es ist mein Mann, der tatsΓ€chlich in dem Programm ist, aber wir sind alle sehr nahe. Ich bin also sehr gute Freunde mit der Frau eines anderen Besuchers. Sie hat mir mit Ungewissheit gesagt, dass ihr Mann mit diesem Applikanten schlΓ€ft.
It was like not that big of a deal to her because they had recently decided that they were going to like have an arrangement where they would like be okay with sexual activity outside of their marriage.
Es scheint so zu sein, dass es andere gibt, von denen ich nicht sicher bin, wie viel Informationen jeder in der Gruppe hat. Ich weiΓ, dass meine, natΓΌrlich dieser Freund, ich und ein anderer Freund, wir alle haben all die Informationen. Einige der anderen Leute im Programm fΓΌhlen sich einfach ein bisschen ungeheuer mit dem Niveau der BlΓΆdsinnigkeit.
Und dann gibt es auch einen Teil davon, dass wir herausgefunden haben, dass sie eine Geschichte davon hat, dass sie mehrere Wehr-Rotationen an verschiedenen KrankenhΓ€usern gemacht hat und dass sie mit hochwertigen Residenzen an all ihren verschiedenen Rotationen schlief. And the other hospitals, they've all like discontinued her application process. I assume because of this revelation.
But here at our program, I guess because it's still within, like this knowledge is still within our small group and hasn't reached higher levels. Like her, she's, you know, still in this application.
His main concern is that he feels like the program is kind of being duped. Like all of these other programs like have their eyes open to what she's been doing, you know, hooking up with all the upper level residents, I guess, to, you know, sleep her way to the top or whatever her intentions are.
Um, but like, yeah, he just feels like our programs being duped maybe. And like, he just, he like feels kind of guilty, I guess that they don't have all of the information just to make like an informed decision.
Er ist definitiv betroffen, dass er WΓ€lder kreiert. Er wΓΌrde definitiv nicht wollen, dass unser Name daran verbunden ist, wenn wir did kind of warn the residency director about what was happening and or If we kind of went with an anonymous amount of information.
Und das ist genau das, warum ich nicht vΓΆllig sicher bin, wie ich es behandeln kann. Weil eine Teil von mir fΓΌhlt sich, als wΓ€re es die richtige Sache, um es zu machen. Ja.
Yeah. And I also, this, my close friend, like the one whose husband is sleeping with the applicant, she is really concerned that this could come back and bite them. Like she's worried that he could get fired.
Yes. And so I'm also concerned that I wouldn't want to betray her trust and have her husband end up... How close are you with the friend? We're pretty close. All right.
And that is the point I've made. I think at first they maybe didn't really realize that or think that through. And then, like, I think partially from talking about it a little bit, like maybe not someone like directly that he works with, especially someone who's currently applying and he has a say in their work.
application because he does he has power in this process who has power and so the my friend's husband the upper level resident who the applicant is sleeping with has say in the this upcoming so she's sleeping with a guy who like she's sleeping with her boss in a sense she's she's up for a promotion she's up for a promotion and he has a say in this promotion
Ja, dieser Kerl, ich meine, er spricht fΓΌr sie.
He definitely did not think this through. Now the deed's done.
And I think he's making a mistake by advocating for her because if she ends up here at this program, then you've just increased the chances of this information getting out that they were sleeping together during the application process. Who knows if they will continue to. But if she's around, that just increases the chances of this information
So my close friend who's the wife and me and our other close friend. So the three of us ladies and then I told my husband.
I'm not sure if it's gone any further than that.
And at the very least, many people are suspicious because they see them, you know, being blurtier, at the very least friendlier than you would expect.
Er ist in der Zwischenzeit. Er ist auch ein Resident, aber er ist aktuell ein niedrigeres Resident.
Right. I've been trying to play out like, okay, what's the worst case scenario? And I mean, it's really, it's pretty limited. Like if I really stretched it, she could end up here and continue to cause drama and distraction and potential legal issues. And that would, and if that got out, hurt the reputation of the Ja, ich meine, es klingt mehr wie fΓΌr dich, wie die Freundschaft. Ja.
Wie gut sind Freunde deinem Mann mit ihrem Mann? They are more like professional level friends.